ID: 1183568231

View in Genome Browser
Species Human (GRCh38)
Location 22:38632089-38632111
Sequence TGGAGGAAAAGCAGAACGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 0, 2: 10, 3: 48, 4: 672}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183568224_1183568231 16 Left 1183568224 22:38632050-38632072 CCAGGTGGAAAGCTGTGTTTTCA 0: 1
1: 0
2: 3
3: 25
4: 228
Right 1183568231 22:38632089-38632111 TGGAGGAAAAGCAGAACGGATGG 0: 1
1: 0
2: 10
3: 48
4: 672
1183568223_1183568231 17 Left 1183568223 22:38632049-38632071 CCCAGGTGGAAAGCTGTGTTTTC 0: 1
1: 0
2: 2
3: 30
4: 244
Right 1183568231 22:38632089-38632111 TGGAGGAAAAGCAGAACGGATGG 0: 1
1: 0
2: 10
3: 48
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183568231 Original CRISPR TGGAGGAAAAGCAGAACGGA TGG Intronic
900040409 1:457615-457637 TGGAGGAAAAGAAAAACGGAGGG + Intergenic
900061839 1:692586-692608 TGGAGGAAAAGAAAAACGGAGGG + Intergenic
900309784 1:2028131-2028153 TGGAGGAAAAGCACACAGGTGGG - Intronic
900498207 1:2986300-2986322 TGAAAGAAAAGAAGAAAGGAAGG - Intergenic
900863021 1:5246280-5246302 TGGAGGGAAGGAAGAAAGGAAGG - Intergenic
901212002 1:7532046-7532068 TGGAAGAAAGGCAGAGAGGAAGG + Intronic
901658636 1:10785156-10785178 GGGAGGAAAAGAAGGAAGGAAGG - Intronic
902185151 1:14719463-14719485 AGGAGGAAAAGAAGATGGGAGGG + Intronic
902331278 1:15732248-15732270 TGGAGGGAGAGCAGAAGGGCTGG + Intronic
902472162 1:16656730-16656752 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
902486641 1:16750716-16750738 TGGAGGAGGAGCAGCAGGGAGGG + Intronic
902729839 1:18362209-18362231 TGGAGGAAAACCAGCACCCATGG + Exonic
903331761 1:22600215-22600237 GGGAGGGAAAGAAGAAAGGAGGG + Intronic
903546679 1:24128413-24128435 TGGGGATAAAGCAGAAGGGAGGG - Intronic
906276529 1:44520633-44520655 TGGGGGAAGAGCAGTAGGGAAGG - Intronic
906577638 1:46905099-46905121 AGGAGGAAGAGAAGAACAGAGGG - Intergenic
907122630 1:52020873-52020895 TGGAAGGAAAGCAGCAGGGAAGG - Exonic
907923621 1:58935671-58935693 TGGAGGAAATGCAGAAAGGCTGG - Intergenic
908441527 1:64159833-64159855 TGGATGAAAAGCAAAAGGGAAGG - Intronic
909007688 1:70296744-70296766 TGGAAGAAAGGAAGAACTGAAGG + Intronic
909059387 1:70862735-70862757 AGGAGGAAAAGAAGAAAGAAGGG + Intronic
909067684 1:70955492-70955514 TGGAGGAAAGGAAGAAGGGAAGG + Intronic
909157028 1:72091370-72091392 GGGAGGAAAGGAGGAACGGAGGG - Intronic
909699325 1:78503967-78503989 TGAAGGAGAAACAGAACGCAAGG + Intronic
909724419 1:78816810-78816832 TGGAGGAAAGGAAGAAATGAAGG - Intergenic
909966814 1:81922885-81922907 AGGAGGAAAAGAAGAAAGGCAGG - Intronic
910184382 1:84521170-84521192 AGGAAGGAAAGAAGAACGGAAGG + Intergenic
910433805 1:87184816-87184838 TGGAGGAAAATCAGTATTGAAGG + Intergenic
911102379 1:94104836-94104858 AGGAGGAAAAGCAGGAGGGCTGG - Intronic
911187203 1:94915961-94915983 TGGGGGCAAAGCAGAAGGGCAGG - Intronic
911348821 1:96727053-96727075 GGAAAGAAAAGCAGAAAGGAGGG - Intronic
912115650 1:106403743-106403765 TGGAGGAAAAGGGCAACTGAAGG + Intergenic
912379683 1:109240667-109240689 GGGAGGAAAAGCAGGACAGACGG - Intergenic
912391188 1:109304291-109304313 AGGAGGAAAGGAAGGACGGAAGG + Intronic
912442131 1:109707223-109707245 AGGAGGAAGAGAAGAACAGAGGG - Intronic
912492875 1:110071485-110071507 TGGAGGATGAGCAGAAGGGCTGG + Intronic
913601048 1:120421434-120421456 GGGAGGGAAGGCAGAAGGGAAGG - Intergenic
913940321 1:125097754-125097776 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
913944289 1:125143114-125143136 AAGAGGAAAAGTAGAAAGGAAGG + Intergenic
913954898 1:143280664-143280686 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
913969622 1:143404903-143404925 AGAAGGAAAAGAAGAACGGAGGG - Intergenic
913982538 1:143534702-143534724 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
914063997 1:144230496-144230518 AGAAGGAAAAGAAGAACGGAGGG - Intergenic
914086005 1:144455195-144455217 GGGAGGGAAGGCAGAAGGGAAGG + Intronic
914115153 1:144735858-144735880 AGAAGGAAAAGAAGAACGGAGGG + Intergenic
914489438 1:148142080-148142102 GGGAGGGAAGGCAGAAGGGAAGG + Intronic
914964654 1:152244180-152244202 TGGAGAAGAAGGAGAAGGGAGGG - Intergenic
915562783 1:156697152-156697174 AGGAGTAAAAGCAGAGGGGAAGG - Intergenic
915623415 1:157099634-157099656 TGGAGGGAAAGAAGGAAGGAAGG + Exonic
916009210 1:160689497-160689519 AGGAGGAAGAGAAGAACAGAGGG + Intronic
916126885 1:161579643-161579665 TAGAGGAAAAGCAGGCTGGAGGG - Intergenic
916136804 1:161661447-161661469 TAGAGGAAAAGCAGGCTGGAGGG - Intronic
916410837 1:164545480-164545502 TGGAGGAAAAGAAGGCTGGAGGG + Intergenic
916446953 1:164881323-164881345 AGGAGGAAAAGAAGGAAGGAAGG + Intronic
916446961 1:164881359-164881381 AGGAGGAAAAGAAGGAAGGAAGG + Intronic
918128966 1:181608313-181608335 GGGAGAAAAAGCAGAAAGGCTGG + Intronic
918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG + Intergenic
918301498 1:183208137-183208159 AGGAGGAAAAGAAGAAGGAAGGG + Intronic
919047534 1:192472296-192472318 TGGAGGAAAGGCAGACTGGAAGG - Intergenic
919395027 1:197035515-197035537 TGAATGAAAAGCAGAAGAGATGG - Intergenic
919617008 1:199820411-199820433 AGGAGGAAAGGAAGAAGGGAGGG + Intergenic
919640731 1:200041614-200041636 TCTAGGGAAAGAAGAACGGACGG - Intronic
920356322 1:205375909-205375931 TGGAGCAAAAGCAGCAGAGAAGG - Intergenic
920428283 1:205896534-205896556 GGGAGGAAAAGAAAAAAGGAAGG - Intergenic
920849949 1:209621986-209622008 TGGGGGACAAACAGATCGGATGG + Intronic
920912541 1:210232532-210232554 GGGAGGAAAAGGAGGAGGGAGGG + Intergenic
922020856 1:221703113-221703135 TGAAGGAAAAGGAGAGAGGAAGG + Intronic
922613100 1:226944325-226944347 TGGAGGAGAAGCAGAGCCTATGG + Intronic
923189934 1:231610719-231610741 GGGAAGAGAAGCAGAACAGAGGG - Intronic
923712015 1:236395454-236395476 AGGAGGAGAAGAAGAAGGGAGGG + Intronic
923988893 1:239412336-239412358 TGGAGGAAAAGAGGGAGGGAGGG - Intronic
924116516 1:240753136-240753158 GGGAGGGAAAGAAGAAAGGAAGG - Intergenic
1063734527 10:8738054-8738076 AGGATGAAAAGAAGAAAGGAAGG + Intergenic
1063782490 10:9341929-9341951 AAGAGGAAAAGCAGAGTGGAGGG - Intergenic
1064002242 10:11673317-11673339 GGGAAGAAAGGGAGAACGGAAGG - Intergenic
1064023975 10:11832141-11832163 TGGAGGAAAAGCAGAATCATAGG + Intronic
1065870653 10:29953308-29953330 GGGAGCATAAGCAGAACTGAGGG + Intergenic
1065925058 10:30427826-30427848 GGGAGGAGAAGGAAAACGGAAGG + Intergenic
1066010927 10:31192805-31192827 AGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1066524985 10:36267562-36267584 AGGAGGGAAAGAAGAAAGGAAGG + Intergenic
1066951385 10:42121589-42121611 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1067925855 10:50507275-50507297 TTGAGCAAAAGCAAAACAGAAGG + Intronic
1068022341 10:51601002-51601024 AGGGGGAAAAGAAGAAGGGAGGG + Intronic
1069369955 10:67737337-67737359 TAGAGGAAAAGCAGTACTAAGGG + Intergenic
1069490448 10:68856327-68856349 TGGAGGAAATGCAAAAAGGGAGG + Intronic
1070401196 10:76055182-76055204 TGGAGGGAAGGCAGAACCCAGGG + Intronic
1070687816 10:78502715-78502737 TGCAGGGACAGCAGAATGGATGG + Intergenic
1071337186 10:84610413-84610435 TGGAAGGAAAGCAGAAGAGAGGG + Intergenic
1071342684 10:84663175-84663197 TGGATAAAAAGGGGAACGGAGGG + Intergenic
1071468413 10:85961511-85961533 AGGAAGAAAGGCAGAAGGGAGGG - Intronic
1071988642 10:91077307-91077329 GGGAGGAAAAGTAGGAGGGAGGG - Intergenic
1072162262 10:92779430-92779452 CGGAGGAAAAGGAGAAGAGATGG - Intergenic
1072309560 10:94141469-94141491 GGGAGGAGAAGGAGAAGGGAAGG + Intronic
1072368079 10:94734682-94734704 TGGAGGAGATGAAGAATGGAAGG + Intronic
1072793807 10:98338843-98338865 TGGGGGACAAGGAGAAGGGAGGG - Intergenic
1072925607 10:99613839-99613861 TGGAGGATTATAAGAACGGAGGG - Exonic
1072945158 10:99803436-99803458 AGGAGGAAAGGGAGAAGGGAAGG - Intronic
1073662646 10:105493862-105493884 TGGAGGGAAAGAAGAAGGAAGGG + Intergenic
1073941214 10:108700446-108700468 GGAGGGAAAAGCAGAAGGGAAGG + Intergenic
1074874030 10:117600637-117600659 AGGAGGAGAAGGAGAAGGGAGGG - Intergenic
1075185514 10:120252750-120252772 TGGAGGAAATGAAGAAAGGTGGG - Intergenic
1075537140 10:123280941-123280963 TGGAGGAAAAAAAGAAAGAAGGG - Intergenic
1076966629 11:93517-93539 TGGAGGAAAAGAAAAACGGAGGG + Intergenic
1077070323 11:667418-667440 AGGAGGAAAAGAGGAAAGGAAGG + Intronic
1078108170 11:8371751-8371773 TGGAGGGAAAGAGGAAGGGAGGG - Intergenic
1078399975 11:11017627-11017649 TACAGGAAAAGCACAAGGGATGG + Intergenic
1078605440 11:12771085-12771107 TTGGGGAAAAGGAGAAGGGAAGG + Intronic
1078665431 11:13321086-13321108 TGGAGGAAAGGCAGAGTGAAGGG - Intronic
1079470565 11:20774007-20774029 GGGAGGAAAAAAGGAACGGAGGG - Intronic
1080086063 11:28283921-28283943 TGGAGGAAAAGAAGAAGTAAAGG + Intronic
1080173094 11:29329620-29329642 TGGAGGAATAGAAGAACTGGAGG + Intergenic
1080423424 11:32134047-32134069 TGGGGGTAGAGCAGAAGGGAGGG + Intergenic
1080478360 11:32619844-32619866 AGGAGGAAAAGTAGAAGGGAAGG + Intronic
1081245987 11:40766884-40766906 GGGAGGAAAAGAGGAAAGGAGGG + Intronic
1081896719 11:46593496-46593518 GGGGGGAAAAGGAGAAAGGAAGG + Intronic
1082096812 11:48137706-48137728 TGGAGGAAGAGCAGGAGGCAAGG + Intronic
1082216981 11:49583360-49583382 TGGAAGAAAAGGAGGAGGGAAGG - Intergenic
1082572790 11:54763237-54763259 AGGAGGAAGAGAAGAACAGAGGG - Intergenic
1082763652 11:57149457-57149479 TGGAGGAAAAGAGGAAGGGTGGG + Intergenic
1083142314 11:60732269-60732291 TGGAGGAAAAGCAGGGAGTAAGG + Intronic
1083683874 11:64364611-64364633 TGCAGAAAAAGCAGAACCAAGGG - Intronic
1083831206 11:65234946-65234968 GGGAGGAAAGGAAGAAGGGAGGG - Intergenic
1084036132 11:66511545-66511567 TGGAGGGAAAGTAAAAAGGAGGG + Intronic
1084223936 11:67703196-67703218 AGGAGGAAGAGAAGAACAGAGGG - Intergenic
1084292675 11:68184703-68184725 TGGTGGAAAAGCATAACAGCAGG - Intronic
1084749801 11:71197148-71197170 GGGAGTCAAAGCAGAACTGAAGG + Intronic
1084953964 11:72681521-72681543 TGGAGGAGGAGCAGGAGGGAAGG + Intergenic
1085040496 11:73323782-73323804 TGGAGGAATAGGAGAAGGGTGGG + Intronic
1085331213 11:75652965-75652987 AGGAGGAAAAGGAGTAGGGATGG - Intronic
1085410523 11:76287930-76287952 TGGATGAATAGCAGAATCGAAGG + Intergenic
1085475892 11:76788752-76788774 TGGAGGAAGAGCAGGATGAACGG - Intronic
1086632573 11:89040806-89040828 TGGAAGAAAAGGAGGAGGGAAGG + Intronic
1088434166 11:109792400-109792422 TGGAGGATGAGCAGAACAGTTGG - Intergenic
1088640478 11:111868290-111868312 TGGAGGAAAAGTACAATGTACGG - Intronic
1089306554 11:117530028-117530050 CACAGGAAAGGCAGAACGGAGGG - Intronic
1090085720 11:123649275-123649297 TGGAGGGAAAGCAGTCAGGATGG + Intronic
1090982332 11:131734398-131734420 AGGAGGAAAGGAAGAAGGGAAGG - Intronic
1091617210 12:2058798-2058820 TGCAGAAAAAGCAAAATGGAAGG + Intronic
1091693211 12:2610978-2611000 GGGAGGAGATGGAGAACGGAGGG + Intronic
1091693275 12:2611303-2611325 GGGAGGAGATGGAGAACGGAGGG + Intronic
1092206102 12:6614959-6614981 TGGAAGAAACGGGGAACGGAAGG - Intergenic
1092956447 12:13554985-13555007 TGAAGGAAAAGCAAAAGGTAGGG + Exonic
1093044242 12:14424161-14424183 AGGAAGTAAAGCAGAATGGAAGG + Exonic
1093110318 12:15144177-15144199 TGCAGGAAAAGCAGGTTGGAGGG + Intronic
1093282587 12:17212542-17212564 GGGAGGAAAGGAAGAAAGGAAGG - Intergenic
1093652444 12:21660922-21660944 TGGGGAAAAAGGAGAACTGAGGG + Intronic
1094169256 12:27474747-27474769 TGGAAGCAAAGCAGAACAAAAGG - Intronic
1094865702 12:34527990-34528012 AGGAGGAAGAGAAGAACAGAGGG - Intergenic
1095803839 12:46296719-46296741 TTGAGGAAAAGCAGAAGGACTGG - Intergenic
1096550897 12:52370911-52370933 AGTAGAAAAAGCAGAAGGGAAGG - Intergenic
1096780614 12:53989859-53989881 AGGAGGAAATGCAGCAAGGAAGG - Exonic
1096805900 12:54141009-54141031 TGGAGGGAAAGCTGAGGGGAGGG - Intergenic
1096910274 12:54976540-54976562 AGGAGGAAAAGAAGGAGGGAGGG + Intronic
1096939933 12:55332163-55332185 TGGAGGAGAAGCATAAGGGGTGG - Exonic
1097056874 12:56255673-56255695 TGAAGGAGAAGCAGCCCGGATGG - Intronic
1099077980 12:78135834-78135856 TGGAAAAAAAGAAGAAAGGATGG - Intronic
1099228343 12:79994821-79994843 AGGAGGAAAAGAAAAAAGGAAGG + Intergenic
1099555380 12:84103212-84103234 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
1099678439 12:85791978-85792000 TGTAGGAGAAGCAAAAAGGAAGG + Intergenic
1099905329 12:88763513-88763535 TGGAGGAAAGGCACCACTGAGGG + Intergenic
1100514193 12:95310725-95310747 TGGAAGAAAAACAGATAGGAAGG - Intergenic
1100758431 12:97777946-97777968 GGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1100795908 12:98181737-98181759 TGGAAAGAAAGCAGAAAGGAAGG + Intergenic
1102483163 12:113237812-113237834 TGAAAGAAAAGCAGAGCTGATGG + Intronic
1102661940 12:114536739-114536761 TGGAGGTAGGGCAGAATGGAAGG - Intergenic
1102665744 12:114571284-114571306 TGGAGGTAGGGCAGAATGGAAGG + Intergenic
1102753441 12:115316727-115316749 AGGAAGAAAAGAAGAAAGGAAGG + Intergenic
1103402856 12:120654971-120654993 GGGAGGAAAAGGAGAACTGGTGG + Intronic
1104010834 12:124928986-124929008 TGGAGGAAGAGCATCACAGACGG + Intergenic
1104086167 12:125475993-125476015 AGGAGCAAAAGCAGAAAGCAGGG - Intronic
1104427762 12:128692194-128692216 TGGAGGAAAGGATGAACAGATGG - Intronic
1105283078 13:18980914-18980936 GGGAGGAAAAGAAGAAAGGAAGG + Intergenic
1105614960 13:22003294-22003316 TGGAGAGAAACCAGAACTGAAGG - Intergenic
1106568273 13:30905763-30905785 TGAAGGAAAGGCTGAAAGGAGGG + Intergenic
1107476925 13:40745949-40745971 TGCAGGCAAAGCACAAGGGAAGG + Intronic
1108457738 13:50633626-50633648 TGGAGAAAAAGCAGAGTGGAAGG - Intronic
1108767508 13:53650557-53650579 TGGAGGAAAAGAAGCAAAGAAGG - Intergenic
1108958960 13:56198102-56198124 TGGAGGTAAAGGAAAACTGAAGG - Intergenic
1109010907 13:56942822-56942844 AGGAGGAAAGGCAGTATGGAAGG + Intergenic
1110093137 13:71479854-71479876 TGGAGGAAAAGCATTCAGGAAGG - Intronic
1110226364 13:73123811-73123833 AGGAAGAAAAGGAGAAAGGACGG - Intergenic
1110264306 13:73520683-73520705 TGGAGAAAAAGTGGAAGGGAGGG + Intergenic
1110316280 13:74111259-74111281 TGAAGGAAAAACAGAACAGATGG + Intronic
1110347430 13:74464869-74464891 TGAGGGAAAAGCAGCAGGGAGGG - Intergenic
1111184632 13:84717190-84717212 TGGATGAACAGAAGAATGGATGG + Intergenic
1113306995 13:109089840-109089862 TGAGGGAAAAACAGAAGGGAGGG - Intronic
1114148545 14:20008066-20008088 GGGAGGAAAAGAAGGAAGGAGGG + Intergenic
1114148609 14:20008218-20008240 GGGAGGAAAAGAAGGAAGGAAGG + Intergenic
1114563766 14:23612844-23612866 TGGATTAAAAGCAGAAGGTAAGG + Intergenic
1115308009 14:31951794-31951816 TGGAGGGAAACAAGACCGGAGGG - Intergenic
1115309478 14:31965112-31965134 AGGATGAAAAGCTGAACGGGGGG - Intergenic
1115611423 14:35052122-35052144 TGGGGGAGAAGCAGAAGGCAAGG - Intronic
1115888987 14:38005884-38005906 AGGAGGAAAAGCAAAGCAGAAGG - Intronic
1116010623 14:39347411-39347433 AGGAGGAAAAGAAGGAAGGAGGG + Intronic
1116035493 14:39622262-39622284 TGGAGGAAGAGCAGAGGGAATGG - Intergenic
1116673579 14:47875857-47875879 TGGAGAAAAAGTAGGATGGAGGG - Intergenic
1117152735 14:52905731-52905753 TGGAGGAAGGGCAGAAAGGAGGG + Intronic
1117660517 14:57999501-57999523 TGGAGGAAAATCATAATGCAAGG - Intergenic
1118128105 14:62931852-62931874 TGAAGGAAGAGCAGAAAGTAGGG + Intronic
1118203442 14:63699338-63699360 TGGAGGGAAAGAGGAAAGGATGG + Intronic
1118632936 14:67722824-67722846 GGCAGGAAAAGCAGGAAGGAAGG + Intronic
1119733174 14:76964115-76964137 TAGAGGAAAGGAAGAAGGGAAGG + Intergenic
1120030691 14:79637448-79637470 TGGAGGGAGAGCAGCAAGGATGG + Intronic
1121612831 14:95293212-95293234 GGGAGGAAAAGAAGGAAGGAGGG - Intronic
1121612849 14:95293264-95293286 GGGAGGAAAAGAAGGAGGGAGGG - Intronic
1121612877 14:95293340-95293362 GGGAGGAAAAGAAGGAGGGAGGG - Intronic
1121847556 14:97186679-97186701 GGGAGGAAAAAAAGAAAGGAAGG - Intergenic
1122578484 14:102756490-102756512 GGGAGGAAAGGAAGAAAGGAAGG - Intergenic
1122776859 14:104120975-104120997 GGGATGAACAGCAGAAAGGATGG + Intergenic
1202937426 14_KI270725v1_random:104181-104203 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1123395794 15:19933694-19933716 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1123453720 15:20395677-20395699 TGGAGGAAAAGGAGAAAAGGAGG - Intergenic
1124598428 15:31110917-31110939 AGCAGAAAAAGCAGAAGGGAGGG - Intronic
1124918285 15:33998120-33998142 TGGAGGAAAGGCAGAATATATGG - Intronic
1125090247 15:35782435-35782457 GGGAGGAAAATAAGAAAGGAAGG - Intergenic
1125567719 15:40689916-40689938 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
1126102399 15:45127665-45127687 TGTAGGAAAAGCAGGACTGTGGG - Intronic
1127267567 15:57374234-57374256 GGAAGGAAAAGCAGAAGGTAAGG - Intergenic
1127630484 15:60822981-60823003 TGGAAGAAAAGAAGAAAGGAAGG - Intronic
1127664110 15:61128046-61128068 TGGAGGAAAAAAACAAGGGAAGG + Intronic
1128793393 15:70449081-70449103 TGGAGGAAGAGAAGGATGGAGGG + Intergenic
1128796927 15:70472854-70472876 TGGAAGAAAAGAAGGAAGGAAGG + Intergenic
1130126033 15:81094735-81094757 GGGAGGAAAGGCACAACTGATGG + Intronic
1130127411 15:81105349-81105371 AGGAGGAAAAGAAGGAAGGAGGG - Intronic
1130688671 15:86061416-86061438 TTGAGGAAAGGCAGAAAAGAAGG - Intergenic
1130766473 15:86876352-86876374 TGGAGGGAAAGCTGCACCGATGG + Intronic
1130915173 15:88299393-88299415 AGGAAGAAAACCAGAAAGGAAGG + Intergenic
1130989920 15:88870163-88870185 TGGAGGGAGAGCAGAACAGGGGG - Intronic
1131937769 15:97525723-97525745 TGAAGGAAATGAAGAAAGGATGG + Intergenic
1131947966 15:97648663-97648685 TGGTGGAAAATCAGAAAGCAGGG + Intergenic
1132441499 15:101870006-101870028 TGGAGGAAAAGAAAAACGGAGGG - Intergenic
1132748439 16:1446569-1446591 GGGAGGAAATGCAGAAGGGCCGG + Exonic
1133392404 16:5420936-5420958 AGGAGGAAAAGCAGGAGGAAGGG - Intergenic
1134630039 16:15749960-15749982 TGGAGGAAAAGGAGGAAGGGAGG - Intronic
1134822524 16:17258189-17258211 GGAAGGAAAAGAAGAAAGGAGGG + Intronic
1134977199 16:18580183-18580205 GGGAGGGAAAGCAGAAGGTAAGG - Intergenic
1136065153 16:27753745-27753767 AGGAGGAAAAGAAGGAAGGAGGG - Intronic
1136769365 16:32821993-32822015 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1136798742 16:33049141-33049163 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1136901117 16:34038898-34038920 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1136935587 16:34460927-34460949 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1136939642 16:34510768-34510790 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1136960178 16:34837792-34837814 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1136964231 16:34887643-34887665 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1136968381 16:34942332-34942354 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1137800992 16:51262062-51262084 AGGAGGAAAGGAAGAAGGGAAGG - Intergenic
1138351289 16:56347562-56347584 TGGGGGAAAAGCAGAAAGAATGG + Exonic
1138440342 16:57030529-57030551 TGGATGAAAAGATGAATGGATGG + Intronic
1138612764 16:58140497-58140519 TGGAGGGAAAGAAGGAAGGAAGG - Intergenic
1138767963 16:59626602-59626624 TGGAGGGAGAGCAGCACAGATGG - Intergenic
1139221582 16:65187815-65187837 TGGAGGAAAAGCAGATATCAAGG + Intergenic
1140937977 16:79692581-79692603 TGGGGGAAATGCAGAATGCATGG + Intergenic
1141045838 16:80715570-80715592 TGGAGGAAAGGGAGGCCGGAGGG - Intronic
1141220671 16:82066586-82066608 AGGAGGACAGGCAGAATGGAGGG - Intronic
1141259492 16:82439879-82439901 TGGTGGAAAAGGAGACAGGAAGG - Intergenic
1141734620 16:85844084-85844106 GGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1142378702 16:89720299-89720321 GGAAGGAAAAGCAGGCCGGAGGG - Intronic
1203071781 16_KI270728v1_random:1084098-1084120 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1142474979 17:183382-183404 GGGAGGAAAGGGAGAAGGGAGGG - Intergenic
1143843184 17:9751044-9751066 TGGAAGAAGATCAGAAGGGATGG - Intergenic
1144865749 17:18334687-18334709 TGGAGGATAAGGAGAACCCACGG + Intronic
1145692407 17:26756108-26756130 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1145709142 17:26952745-26952767 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1145741637 17:27279831-27279853 AAGAAGAAAAGCAGAAAGGAAGG - Intergenic
1145801531 17:27689185-27689207 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
1147534524 17:41310703-41310725 TTGAGGAAGAGCAGAAAGGCTGG - Intergenic
1147594077 17:41705545-41705567 TGGAGGAAAGGAGGAAAGGACGG + Intergenic
1148152988 17:45407230-45407252 TGGAGGAAACACAGCAGGGACGG - Intronic
1149494883 17:57111061-57111083 TGAAGGAAAAGCAGGCAGGACGG - Intronic
1151007502 17:70454990-70455012 TGGAGGAAAGGAAGGAGGGAGGG + Intergenic
1151189204 17:72385858-72385880 TGGAGGAAAAACACCAGGGAAGG - Intergenic
1203183929 17_KI270729v1_random:93660-93682 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1153209079 18:2739474-2739496 AGGAGGAAAAACAGTACAGATGG + Exonic
1153527558 18:6012173-6012195 TAGAGGAAAAGCAGAAAACACGG + Intronic
1154519110 18:15208007-15208029 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1156165936 18:34421169-34421191 GGGAGGAAAAGAGGAAAGGAAGG + Intergenic
1156456209 18:37296048-37296070 TGGGGGACAAGGAGAAAGGAAGG - Intronic
1156548295 18:37987798-37987820 TTGAGTAAAAGCAGAGAGGATGG + Intergenic
1156601375 18:38611192-38611214 TTAAAGAAAAGCAGAACAGAGGG + Intergenic
1156761798 18:40601036-40601058 GGGAGGAAGGGCAGAAGGGAGGG - Intergenic
1157087877 18:44600272-44600294 TGGAGGAAAAGAGGGAGGGAAGG + Intergenic
1157268490 18:46249761-46249783 TGGAGGAAAAGGAGATAGGATGG - Intronic
1157605417 18:48923145-48923167 AGGGGGAAAAGCAGAGGGGAAGG + Intronic
1157968431 18:52237155-52237177 AAGAGGAAAAGCAAAACAGAAGG + Intergenic
1158840385 18:61379831-61379853 AGGAGGAAAAGCAGAGAGGTAGG + Intronic
1159687274 18:71438244-71438266 TGGTGGATAAGCAGAAGGTATGG + Intergenic
1159706752 18:71699238-71699260 TGTACCAAAAGCAGTACGGAGGG + Intergenic
1160072764 18:75643004-75643026 AGGAGGAAAAGGAGAACCCAGGG + Intergenic
1160373583 18:78394105-78394127 AGTAGGAACAGCAGAAAGGAGGG + Intergenic
1160643432 19:163140-163162 TGGAGGAAAAGAAAAACGGAGGG + Intergenic
1161586985 19:5110973-5110995 TGGAGGAGAAACAGAACAGGAGG - Intronic
1162190691 19:8944093-8944115 TGGATGGAAAGAAGAAAGGAGGG - Intronic
1162742787 19:12782953-12782975 TGGAGGAAAAGCAGGATGGCTGG - Intronic
1163050598 19:14680507-14680529 AGGGGGAAAAGCAGACTGGAGGG - Intronic
1163224063 19:15942790-15942812 AGGAAGAAAAGAAGAAAGGAAGG - Intergenic
1163468630 19:17484193-17484215 TGGAGGGAAAGAATAAAGGAGGG + Intronic
1163854266 19:19687338-19687360 GGGAGGGAAAGCAGTAGGGATGG - Intergenic
1163941904 19:20502915-20502937 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
1164289004 19:23850349-23850371 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
1164378001 19:27706396-27706418 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
1164697034 19:30252821-30252843 TGTAGGAATGGCAGAAGGGACGG + Intronic
1164771929 19:30816210-30816232 AGGAGGAAGGGCAGAAGGGAGGG - Intergenic
1165037426 19:33043845-33043867 GGAAAGAAAAGCAGAAAGGAAGG - Intronic
1165770913 19:38379709-38379731 TGGAGAAAAAGCAGGAAGGAGGG + Intronic
1165961509 19:39538683-39538705 TGGAGGAAAACAAGAATGGAAGG + Exonic
1166868934 19:45858852-45858874 TGGAGAAAAAGCAACACAGATGG - Intronic
1167248496 19:48388818-48388840 AGGAGGAAAGGAAGAAAGGAAGG + Intronic
1167634199 19:50644509-50644531 TGGAGGAATAGATGAAGGGATGG + Intronic
1167977550 19:53242562-53242584 TGTGGCAAAAGCAGAACTGAAGG + Intronic
1168567320 19:57435783-57435805 TGGAGGCACTGCAGAACGGGCGG + Intronic
1202682404 1_KI270712v1_random:19026-19048 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1202704558 1_KI270713v1_random:13524-13546 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
925548683 2:5044959-5044981 TGGAGGAAAAGAAGAGAGGAAGG + Intergenic
925759597 2:7171654-7171676 TGGAGGGAAAATGGAACGGAAGG - Intergenic
925759763 2:7173004-7173026 TGGAGGGAAAATAGAAAGGAAGG + Intergenic
926346435 2:11950544-11950566 TGGCTGAAAAGCAGAACAAAGGG + Intergenic
926363425 2:12111571-12111593 AGGAGGAAAAGGAGAAGGCAAGG - Intergenic
926481575 2:13403581-13403603 TGGAGGAAAAGGAGAAAAGGAGG + Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928574905 2:32644840-32644862 AGGAAGAAAAGAAGAAAGGAAGG - Intronic
928793020 2:34981285-34981307 TGGAGGAAAAAGAGACTGGAAGG + Intergenic
928902494 2:36335418-36335440 TGGAGGAAAGAAAGAAAGGAAGG - Intergenic
929073233 2:38055494-38055516 TGGAGGAAAATCAGAAGCGTAGG + Intronic
929137355 2:38637603-38637625 GGGAGGGAAAGCAGGAAGGAAGG + Intergenic
929380787 2:41350558-41350580 TGGAGGAGAAGCAGAAGAGTGGG + Intergenic
931665625 2:64608189-64608211 TGGAGGAAAGGAAGACAGGAGGG - Intergenic
931683074 2:64768717-64768739 AGGAGGAAAAGAAGGAGGGAGGG - Intergenic
932496738 2:72149346-72149368 AGGAGGAAAAGAGGAAGGGAAGG - Intergenic
932625950 2:73295964-73295986 GGGAAGAACAGCAGAAGGGATGG - Intergenic
932974359 2:76579837-76579859 AGGAGGAAAAGCAGACCAGTTGG - Intergenic
933041556 2:77473818-77473840 TGGAGAAAATGCACAATGGAAGG - Intronic
933427068 2:82126731-82126753 TGGCAGAAGAGCAGAGCGGAGGG - Intergenic
933898531 2:86833134-86833156 AGGAGGAAAAGCAGGATGCAGGG - Intronic
934174315 2:89565816-89565838 AGAAGGAAAAGAAGAACGGAGGG - Intergenic
934249384 2:90336140-90336162 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
934260197 2:91467330-91467352 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
934284630 2:91640166-91640188 AGAAGGAAAAGAAGAACGGAGGG - Intergenic
934303511 2:91799266-91799288 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
934329748 2:92053491-92053513 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
934467964 2:94283404-94283426 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
935096661 2:99951525-99951547 TGAAGGACAAGTAGAATGGATGG + Intronic
935579242 2:104742330-104742352 TGGAGAAGAAGAAGAAGGGAAGG - Intergenic
936581803 2:113706475-113706497 TGGAGGAAAAGTTCAATGGAAGG + Intronic
936697105 2:114964246-114964268 TGTAAGAAAAGAAGAAAGGAAGG - Intronic
936846371 2:116839958-116839980 TGGAAGGAAAGAAGAAAGGAGGG + Intergenic
936895166 2:117419697-117419719 TGGAAGAAAAGAAGAAATGAAGG - Intergenic
937255251 2:120550907-120550929 GGGAAGAAAAGCAGGACTGAGGG + Intergenic
937957894 2:127432463-127432485 TGGAGGAAGAGAAACACGGATGG + Intergenic
938519112 2:132048561-132048583 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
939179265 2:138784933-138784955 TGGAAGAAAGGCAGGAAGGAAGG - Intergenic
939379369 2:141414355-141414377 GGGAGGAAGAGCGGAAAGGAGGG + Intronic
939875049 2:147568296-147568318 AGGAGGGAAAGAGGAACGGAGGG + Intergenic
940010146 2:149044584-149044606 TGGAGGAAGAGAAGGAGGGAGGG - Intronic
940029326 2:149244276-149244298 GGGAGGAAAAGAAGAAGGGAAGG - Intergenic
940029330 2:149244296-149244318 GGAGGGAAAAGCAGAAGGGAGGG - Intergenic
940306510 2:152232838-152232860 TGGCTGAAAAGCAGAAAGTAAGG - Intergenic
940374369 2:152941254-152941276 GGGAGGAAAGGAAGAAAGGAAGG - Intergenic
940555001 2:155213357-155213379 AGGAGTAAAAGAAGAAGGGAAGG + Intergenic
942906890 2:181193769-181193791 TGGTGGAAATGCAAAACGGTAGG + Intergenic
943452218 2:188057937-188057959 TGGAGAAAAAGCAAAATGGACGG + Intergenic
943967727 2:194358927-194358949 TGGAGTACAAGAAGAAAGGAAGG + Intergenic
943991327 2:194696447-194696469 TGGAGGAAAAGCAGCAATCAAGG - Intergenic
945437413 2:209835240-209835262 TGCATGAAAAGCAGAAGTGAGGG - Intronic
945473662 2:210256288-210256310 TGGAGGAAATGCAGACCGTATGG + Intergenic
946170904 2:217894957-217894979 GGGAGGAGAAGGAGAACAGATGG - Intronic
946475851 2:220005716-220005738 TGCAGAAAAAGCACAAGGGAGGG - Intergenic
946516171 2:220413583-220413605 GGAAGGAAAAGGAGAAGGGAGGG - Intergenic
946838731 2:223798633-223798655 TGGAAGAAAAGAAGGAAGGAAGG + Intronic
946892369 2:224291062-224291084 GGGAGGGAAAGCAGAACTAATGG + Intergenic
946997002 2:225404846-225404868 TGGAGGAAAGGCAGAGAGGGAGG + Intronic
947154090 2:227143889-227143911 TGTAGGAAAAGGAGAACAGAAGG + Intronic
947542410 2:230988117-230988139 GGATGGAAAAGCAGAATGGAGGG - Intergenic
947943382 2:234078037-234078059 TGGAGGAAAAGCAGCAACAAGGG - Intergenic
948386122 2:237582103-237582125 AGGAGCAGAGGCAGAACGGACGG - Intronic
948533930 2:238632253-238632275 GGGAGGTTAAGCAGAACTGATGG + Intergenic
948688425 2:239686405-239686427 TGGAGGAAAATAAGAACAGTTGG - Intergenic
1169291439 20:4356626-4356648 TGGAGGTGAAGCAGAAGGAAGGG - Intergenic
1169585982 20:7086044-7086066 AGGAGGAAAAGAAGGAAGGAGGG - Intergenic
1169709703 20:8547965-8547987 TGGAGGAAAAGTATAACTAAGGG - Intronic
1169889572 20:10437628-10437650 GGGAGGAGAAGCAGAAAGGCTGG - Intronic
1169991082 20:11503118-11503140 TGGAAGGAAAGCAGAAAGGAAGG - Intergenic
1170000939 20:11612632-11612654 AGGAGGGAAAGAAGAAAGGAGGG - Intergenic
1170418732 20:16171365-16171387 TGGAGGAAAGGGAGGAAGGAAGG + Intergenic
1170522076 20:17197143-17197165 TGGAGGAAAAGAGGGAAGGAAGG + Intergenic
1170706065 20:18745678-18745700 TGGAGGAATTGCAGAAGGGTGGG + Intronic
1171340230 20:24421575-24421597 AGGAAGAAAAGAAGAAAGGAAGG - Intergenic
1172032342 20:31990992-31991014 TGGAGGAAGAGAAGAGAGGAGGG - Intronic
1172428409 20:34871848-34871870 AGGAGGAAGAGCAGCAGGGAAGG + Intronic
1172558829 20:35867798-35867820 GGGAGGAAAAGAGGAAGGGAAGG - Intronic
1172855010 20:37994950-37994972 TGTAGGAAAAATAGAATGGATGG + Intronic
1173432366 20:43000041-43000063 TGGAGGAAGGGAAGAAGGGAAGG + Intronic
1173438874 20:43057390-43057412 AGGAGGAAAAGAAGGAAGGAGGG + Intronic
1173590193 20:44219153-44219175 AGGAGGGAAAGGAGAAAGGATGG - Intergenic
1173847846 20:46199356-46199378 AGGAGCAAAAGCTGAAGGGAGGG - Intronic
1174409244 20:50322827-50322849 AGGAGGAATAGAAGAATGGATGG - Intergenic
1174462419 20:50691993-50692015 TGGGGGAAACCCAGGACGGAAGG - Intergenic
1174595716 20:51681845-51681867 TGCATGAAAAGGAGGACGGAAGG + Intronic
1174869340 20:54168782-54168804 GGGAGGGAAGGCAGAAGGGAGGG - Intronic
1174970605 20:55271115-55271137 TGTAGGAAAACCACAAAGGAAGG - Intergenic
1175518060 20:59581406-59581428 TGAAGGAGAAGCAGACCTGAGGG - Intronic
1175631527 20:60542153-60542175 TGGAGGAAAAGGGGAACAGCTGG - Intergenic
1175765868 20:61592626-61592648 TGTAGGAAAAGCAGGGTGGAGGG - Intronic
1176585905 21:8584937-8584959 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1176742604 21:10617624-10617646 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1177207434 21:18026412-18026434 TGGAGGAGAAACAGAACAGTAGG + Intronic
1177285083 21:19039487-19039509 TGCAGGAAAAGGAGACTGGAAGG + Intergenic
1179076301 21:38125053-38125075 TAGAGGCAAAGCAGAATGGTGGG - Intronic
1179077321 21:38135011-38135033 TGGATGAAAAGAAGGAAGGAAGG - Intronic
1179399506 21:41070790-41070812 AGGAGGAAAAGAAGGATGGAGGG + Intergenic
1179587852 21:42385067-42385089 GGGAGGAAAAGAGGAAGGGAGGG - Intronic
1180268712 22:10561842-10561864 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1180525479 22:16255096-16255118 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1180991415 22:19939372-19939394 AGGAGGAAGAGAAGAACAGAGGG - Intronic
1181046047 22:20214785-20214807 TGGAGGAAAGGCAGAAAGGGCGG + Intergenic
1181421053 22:22799390-22799412 TGGAGGAAAGGCAGTGCCGAGGG + Intronic
1181537773 22:23555603-23555625 TGGAGCAAGAGCAGAAATGAAGG + Intergenic
1181908757 22:26220957-26220979 TGGAGGGAAGGAAGAAAGGAAGG + Intronic
1183404659 22:37624564-37624586 TGGAGGAAGAGAAGCAGGGAAGG + Intronic
1183568231 22:38632089-38632111 TGGAGGAAAAGCAGAACGGATGG + Intronic
1183593491 22:38795620-38795642 TGCAGGAAGAGCAGATTGGAGGG - Intergenic
1183593887 22:38798101-38798123 TGCAGGAAGAGCAGATTGGAGGG - Intergenic
1183625699 22:39000011-39000033 TGGAGGAAATGGAGAGAGGATGG - Intergenic
1183848430 22:40562646-40562668 AGGAGGGAAGGCAGAAAGGAGGG + Intronic
1184642613 22:45880412-45880434 TTGAGGAAAAGCAGAAAAGGTGG + Intergenic
1184880596 22:47302044-47302066 TGGAGGAAACGCAGATCTGTGGG + Intergenic
1184949937 22:47834103-47834125 CGGAGGAAGAGCAGAGTGGAAGG + Intergenic
1185164152 22:49248701-49248723 CGGAGAAATAGAAGAACGGAAGG - Intergenic
1185354278 22:50357465-50357487 GGGAGGAAAAGGGGAAAGGAAGG - Intronic
1203290031 22_KI270735v1_random:27796-27818 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1203322888 22_KI270737v1_random:85825-85847 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
949293776 3:2496597-2496619 TGGTTGGAAAGCAGAACAGAAGG + Intronic
949508075 3:4745160-4745182 TGAAGGAAAAGGGGAAAGGAAGG - Intronic
950112075 3:10425620-10425642 TGGAGGAAAAGAAGAGATGATGG - Intronic
950526903 3:13529526-13529548 TGGAGGAAGGGAAGAATGGATGG - Intergenic
951816891 3:26763999-26764021 AGGAGGAAAAGAAGGAAGGAAGG + Intergenic
952590127 3:34942557-34942579 GGGAGGAAAGGAAGAAAGGAAGG - Intergenic
952671886 3:35978681-35978703 GTGAGGAGAAGCAGAAGGGAGGG - Intergenic
953098841 3:39806625-39806647 TGGAAGAAAAGAAGGAAGGAAGG + Intergenic
953434153 3:42865408-42865430 TGGGGGAAAAGCAGCAGTGAAGG - Exonic
954427886 3:50453210-50453232 TGGAGGAAGAGGAGAGCTGAGGG - Intronic
954569688 3:51630250-51630272 TCTAGGAAAAGCAAAATGGAAGG - Exonic
955042514 3:55331693-55331715 TGGATGAATAGCTGAATGGATGG + Intergenic
955274966 3:57538591-57538613 AGGAGGAAAAGCAGAAGAGCAGG - Intronic
955901840 3:63764330-63764352 TGGAGGAAAGGAAGGAAGGAAGG + Intergenic
956203489 3:66731795-66731817 AGGAGAAACAGCAGAAAGGAAGG - Intergenic
956530253 3:70211244-70211266 AGAAAGAAAAGCAGAAAGGAAGG - Intergenic
956530430 3:70211843-70211865 AGAAAGAAAAGCAGAAAGGAAGG - Intergenic
957208189 3:77226414-77226436 TGGAGGAATAGCAGAAAAAAGGG - Intronic
957344306 3:78942453-78942475 TGGAGGACAAGCAGAGGGTAGGG + Intronic
957353856 3:79057633-79057655 AGGAGGAAGAGAAGAACAGAGGG - Intronic
958425487 3:93974050-93974072 TGGAGGAAAAGCAGCAACTAGGG - Exonic
959153720 3:102640236-102640258 TGAAGGAAAGGCAGATCTGAAGG + Intergenic
959536052 3:107485897-107485919 TGGAAGAAACACAGAAGGGAGGG + Intergenic
960035131 3:113094598-113094620 CAGAGGAAAAGAAGAAGGGAAGG + Intergenic
960120335 3:113942602-113942624 GGAAGGAAAGGCAGAAAGGATGG + Intronic
960440898 3:117687353-117687375 GGGAGGAAAATCAAAAGGGAAGG - Intergenic
960696098 3:120398086-120398108 TGGAGGAAGATGAGAATGGAGGG + Intronic
961383341 3:126509913-126509935 TGCTGGCAAAGCAGAACTGATGG + Intronic
961443806 3:126968708-126968730 TGCAGAAAAAGCAGAGGGGATGG + Intergenic
961922888 3:130446432-130446454 AGGAGGAAGAGAAGAACAGAGGG + Intronic
963196958 3:142543362-142543384 GGGAGGAAAAGAGGGACGGAGGG - Intronic
963624348 3:147652029-147652051 GGGAGGAAGAGGAGAAGGGAGGG + Intergenic
964050315 3:152384236-152384258 TAGAGGAAAAGCATAACGATTGG + Intronic
964474194 3:157083983-157084005 TGGAGGAAAAACAGAAATGCGGG - Intergenic
965582907 3:170288427-170288449 AGGAGGAAAGGCAGAAAGGGAGG - Intronic
965830020 3:172775590-172775612 TGGCACAAAAGCAGAATGGAAGG + Intronic
965867714 3:173225767-173225789 TGGAGGAAAAGCAAAAAGCAAGG + Intergenic
965896946 3:173589534-173589556 TGGAGGAAAAGCAGAAGTTGGGG + Intronic
966244774 3:177794977-177794999 TAGAGGAAAAGGAGAAGAGAAGG - Intergenic
967171227 3:186825042-186825064 GGGAGGAACGGAAGAACGGAGGG - Intergenic
967256465 3:187597723-187597745 TGGAGGAAAAGAAGGAAGGAAGG - Intergenic
967446927 3:189577883-189577905 GGAAGGAAAAGAAGGACGGAAGG - Intergenic
967598554 3:191357055-191357077 TGGAGGAAAAACAGACAGGAAGG - Intronic
967726754 3:192869357-192869379 GGGAGGAAAGGAAGAAGGGAAGG + Intronic
969908020 4:10415804-10415826 GGGGTGAAAAGCAGAAAGGATGG - Intergenic
970564359 4:17317075-17317097 TGGAGGTAAAGCAGGAAAGAGGG - Intergenic
970914940 4:21321816-21321838 AGGAGAAAAAGAAGAAGGGAAGG + Intronic
972061629 4:34881600-34881622 AGGAAGAAAAGAAGAAAGGAAGG - Intergenic
972132081 4:35850373-35850395 AGAAGGAAAAGCAGAAGGAAGGG - Intergenic
972535733 4:39998352-39998374 TGGGGGAATAGCAGAACAAAAGG + Intergenic
973717295 4:53689857-53689879 AGGAGGAAAAGGAGAACATAGGG - Intronic
973778975 4:54270832-54270854 TGGAAGAAAAGCAGCACTTAGGG + Intronic
974435983 4:61857694-61857716 AGGAGGAAAGGAAGAAAGGAAGG - Intronic
974998857 4:69195947-69195969 AGGAGGAAGAGAAGAACAGAGGG - Intronic
975402046 4:73949827-73949849 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
975524987 4:75339243-75339265 TGGAAGAAAAGGAGAGAGGAGGG - Intergenic
975558798 4:75690531-75690553 TGGAGGAATAGCAGGACTGAGGG + Intronic
975593666 4:76026138-76026160 AGGAGGAAAAGCATACCAGATGG - Intronic
975852212 4:78584089-78584111 TGGAGGAAAAGCATTCCAGATGG - Intronic
976511322 4:85912390-85912412 GGGAGAAAAAGCACAATGGACGG + Intronic
976754325 4:88482365-88482387 GGGAGGAAAAGAAGAGCAGAGGG - Intronic
977992973 4:103466843-103466865 TTGAGGGAAAGGAGAAAGGAAGG + Intergenic
979919765 4:126481232-126481254 TGGAGGAAAAGCAGTACCAGTGG + Intergenic
980344559 4:131596272-131596294 GGGAGGAAAGGAAGAAAGGAAGG - Intergenic
981350536 4:143724599-143724621 AGGAAGAAAAGAAGAAGGGAAGG + Intergenic
981569889 4:146140364-146140386 TGGAAGAAAAACAAAACTGAGGG - Intergenic
981646966 4:147009851-147009873 GGGAGAAAGAGCAGAACTGAGGG + Intergenic
982163210 4:152590710-152590732 GGGAAGAAAAGCAGAACAGAAGG - Intergenic
982226254 4:153170162-153170184 TGGAGGAGAAGGAGAATGAAGGG + Intronic
982227270 4:153177677-153177699 TGGAAGAAAGGGAGAATGGATGG + Intronic
982596718 4:157395010-157395032 TGGAGGGAAAGTAGAAAGGAAGG + Intergenic
982963623 4:161873547-161873569 TGGAGGAAGAGAGGAAGGGAAGG - Intronic
983466424 4:168098345-168098367 GAGAGGAAAAGCAGAAAGAAAGG + Intronic
984465859 4:180100255-180100277 TGGGGGATAAGCATAATGGATGG + Intergenic
984911220 4:184676335-184676357 GGAAGGAAAAGGAGAAAGGAAGG - Intronic
985238070 4:187898554-187898576 AGGAAGAAAAGCAGGAAGGAAGG + Intergenic
986235759 5:5908442-5908464 AGAAGGAAAATCATAACGGATGG - Intergenic
986431931 5:7689909-7689931 TGGAGGAAAAGTCTAACAGAAGG - Intronic
986436235 5:7734391-7734413 GGGAAAAAAAGCAGAAAGGAAGG + Intronic
986464469 5:8007882-8007904 TGGAGGGCAAGGAGAAGGGAGGG + Intergenic
986464963 5:8011894-8011916 TTGAGGAGAAGCAGTACAGACGG + Intergenic
987092618 5:14521696-14521718 TGGATGAAAGGCAGAAGGTAGGG - Intronic
987183764 5:15393251-15393273 AGAAGGAAGAGCAGAAAGGAAGG - Intergenic
989306713 5:39966329-39966351 TGGAGGAGAGGCAGAAAGGTGGG - Intergenic
990716250 5:58640350-58640372 TGGGGGAAAGGCAGAGGGGAAGG - Intronic
991090066 5:62685675-62685697 TGGGGGAAAAGCAGAAAGTGGGG + Intergenic
991230184 5:64323669-64323691 TAGAGAAAGAGCAGAAGGGATGG + Intronic
993290848 5:86067918-86067940 TGGAAGCAAAGAAGAAAGGAAGG + Intergenic
993957860 5:94258513-94258535 TGGGGGAAAAACAGAACCTAAGG - Intronic
994730048 5:103481241-103481263 TGGCAGAAAAGCAAAATGGAGGG - Intergenic
995007399 5:107216649-107216671 TGGAGGAAAGGCATAATGGGAGG + Intergenic
995669897 5:114590727-114590749 TTAAGGAAAAGCAGAACGAGTGG + Intergenic
996710546 5:126538974-126538996 TGCAGGGAAAGAAGAATGGATGG + Intergenic
997492970 5:134294652-134294674 TGAAGGAGAAGAAGAAAGGAAGG + Intronic
997826608 5:137112206-137112228 TGGAGGGGAAGAAGAAGGGATGG - Intronic
997854913 5:137364558-137364580 TGGAGGCAAAGCAGAACTATAGG - Intronic
997855211 5:137367140-137367162 TGGAGGCAAAGCAGAACTATAGG - Intronic
998486678 5:142508960-142508982 CAGAGGAAAAGCAGAAAAGAAGG - Intergenic
998701963 5:144713257-144713279 TGGGGAAAAAACAGAACAGAAGG + Intergenic
998733587 5:145109012-145109034 TGGATGAATAGAAGAATGGATGG - Intergenic
998883299 5:146667486-146667508 TGGAGAAAAAGAAGAAAGCAGGG + Intronic
999029433 5:148274767-148274789 TGGAGGTAAAGCAGAATAGAAGG + Intronic
999610146 5:153360606-153360628 TGGAGGAGAAGAAAAATGGAAGG - Intergenic
1000349747 5:160343979-160344001 TGGAGTAACAGCAGAGCTGAAGG - Intronic
1000360990 5:160447371-160447393 GGGAGGAAGAGAAGAAGGGAGGG - Intergenic
1000435998 5:161209342-161209364 GGGAGGAAAAGAAGGAAGGAAGG + Intergenic
1000662977 5:163959142-163959164 TGGAGGAAGAGAAGAAGGAAGGG - Intergenic
1000888888 5:166781040-166781062 TAGAAGAAAAGCAGGAAGGAAGG + Intergenic
1001288541 5:170440469-170440491 TGGAGGAAACACGGAACTGAAGG + Intronic
1001514335 5:172344949-172344971 TGGAGGAAAGGAAGGAAGGAGGG + Intronic
1001514352 5:172345024-172345046 GGGAGGAAAGGAAGAAGGGAAGG + Intronic
1001521816 5:172399713-172399735 AGGAGGAAGAGAAGAACAGAGGG - Intronic
1001617730 5:173056524-173056546 TGGGGGAAGAGCGGAACGGGGGG + Intronic
1001686350 5:173597579-173597601 TGGAGGGAAAGAAGGAGGGAGGG - Intergenic
1002733438 5:181361330-181361352 TGGAGGAAAAGAAAAACGGAGGG - Intergenic
1002751103 6:112788-112810 TGGAGGAAAAGAAAAACGGAGGG + Intergenic
1002875187 6:1203972-1203994 TGGAGGACAAGCAGAACCTGGGG + Intergenic
1002994786 6:2272572-2272594 TGCAGGACATGCAGAAAGGAGGG + Intergenic
1003075847 6:2983124-2983146 AGGAGGAAAAGAAGAAAGGATGG - Intergenic
1003339307 6:5204416-5204438 TGAAAGAAAAGCAGAATCGAAGG + Intronic
1003377023 6:5588830-5588852 AGGATGAAAAACAGAACTGAAGG - Intronic
1004068498 6:12275009-12275031 TGGGGGAAAAGAAGGAAGGAAGG - Intergenic
1004073632 6:12325372-12325394 TGAAGGAAACGCACAAGGGATGG + Intergenic
1004960384 6:20782025-20782047 TGAAGAAAGAGCAGAACAGAAGG - Intronic
1005205131 6:23393912-23393934 TGGAAGAAAGGAAGAAAGGAAGG + Intergenic
1005577956 6:27207685-27207707 TGGAGGGATTGCAGAAAGGATGG + Intergenic
1006134773 6:31888754-31888776 TGGAGGAAAAGAGGAGCTGAGGG + Intronic
1006309313 6:33246525-33246547 TGAAGGAAAAGCTGAACAGGCGG - Intergenic
1007163061 6:39808448-39808470 TGAATGAAAATCAGAAGGGAAGG - Intronic
1007972289 6:46064727-46064749 TGAAGGAAGAGAAGAAGGGAGGG + Intronic
1008022680 6:46598975-46598997 TGGAGTAAAAGTAGATAGGAAGG - Intronic
1008320901 6:50112684-50112706 AGGAGCAAAAGCAGTAGGGAAGG + Intergenic
1008612593 6:53197840-53197862 TGGAGGGAAGGAAGAAAGGAGGG + Intergenic
1009042288 6:58193499-58193521 TGCAGGAAAAGCAGGAAGGAAGG + Intergenic
1009218127 6:60947719-60947741 TGCAGGAAAAGCAGGAGGGAAGG + Intergenic
1010492197 6:76489774-76489796 AGGAGGAAGAGAAGAACAGAGGG + Intergenic
1011185140 6:84666362-84666384 TGGAGGAACAGGAGCATGGAGGG + Intergenic
1011339575 6:86298972-86298994 TGGAGTAAATGCAGAAGGGTGGG + Intergenic
1012693532 6:102348452-102348474 AGGAGGAAAAGAATAACGGATGG + Intergenic
1013459973 6:110365476-110365498 AGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1013994971 6:116297392-116297414 GGTAGGAAAAGGAGAAAGGAAGG - Intronic
1014242446 6:119032637-119032659 GGGAGGAAAAGAGGAAGGGAGGG + Intronic
1014697431 6:124640874-124640896 TGGAAGGAAAGAAGAAAGGAAGG - Intronic
1014853238 6:126367468-126367490 TGGTGGAAAAGGATAAAGGAGGG + Intergenic
1014932154 6:127347926-127347948 AGGAGGAAAAAAAGAAAGGATGG - Intergenic
1015082432 6:129243938-129243960 GGCAGGAAAAGCAGATAGGAAGG + Intronic
1015122569 6:129716063-129716085 TGGAGAAAAAGAAAAATGGAAGG + Intergenic
1015250753 6:131125007-131125029 GGGAGGGAAAGAAGAAAGGAAGG - Intergenic
1015466057 6:133549896-133549918 TGGAGGAAAAAAAGAAAAGAAGG - Intergenic
1015685666 6:135856941-135856963 GGGAGGAAGGGCAGAAAGGAAGG - Intronic
1015689502 6:135905897-135905919 TTGAGGAGAAGCAGGACAGAAGG + Intronic
1015837280 6:137433998-137434020 TGGAAGAAAGGGAGAAGGGAGGG - Intergenic
1016028852 6:139316848-139316870 GAGAGGAAAAGCAGAAGGAAAGG + Intergenic
1016183327 6:141173174-141173196 TGGAGGAAAAGCAGAGAAAAGGG + Intergenic
1016329637 6:142944123-142944145 TGGGGGAAAGGAAGAAGGGAAGG - Intronic
1016404997 6:143720427-143720449 TGAAGGAAAGGCAGGAAGGAGGG + Intronic
1016446013 6:144132566-144132588 TGGAGAGAAAGAAGAAAGGAAGG - Intergenic
1016509086 6:144819756-144819778 TGAAGGAAAAGCTGAAGGGCAGG + Intronic
1017190840 6:151651040-151651062 TGGAGGAGAAGGAGAAAAGAAGG - Intergenic
1017511937 6:155122302-155122324 GGGAGGGAATGCAGAATGGAAGG + Intronic
1017511958 6:155122380-155122402 GGGAGGGAATGCAGAATGGAAGG + Intronic
1018395162 6:163372871-163372893 CTGAGGAAATGCAGAACGAATGG - Intergenic
1018688167 6:166319429-166319451 TGGAGGAGAAGCAGAGAGGGCGG - Intergenic
1018912349 6:168109147-168109169 GGGAGGAAGAGCAGAGCAGAGGG + Intergenic
1019237688 6:170633652-170633674 TGGAGGAAAAGAAAAACGGAGGG - Intergenic
1019266797 7:121631-121653 GGGAGGAAATGCAGGAAGGAAGG + Intergenic
1019334865 7:478330-478352 GGGAGGAAAGGAAGAAAGGAGGG + Intergenic
1019334927 7:478562-478584 AGGAGGAAAGGAAGAAAGGAAGG + Intergenic
1019860720 7:3656197-3656219 TGGAAGTAAAGGAGAAGGGAAGG - Intronic
1020106419 7:5424169-5424191 GGGAGGAGAAGGAGAAAGGAGGG - Intronic
1020681548 7:11243304-11243326 TGGAGGAAGAGTAGAAGGGTTGG + Intergenic
1021086594 7:16427753-16427775 TACAGGAAAAGCAGAGTGGATGG - Intergenic
1021258300 7:18422049-18422071 TGGAGTAAAAGTAGAATAGAAGG - Intronic
1022343210 7:29487652-29487674 AGGAGAAAAAGAAGAAAGGAGGG - Intronic
1022477430 7:30720721-30720743 AGAAGGACAAGCAGAAGGGATGG - Intronic
1023763030 7:43484281-43484303 AGCAGGAAAGGCAGGACGGAAGG + Intronic
1024130724 7:46350254-46350276 TGGAGGAACAGCAGAGCAGCAGG + Intergenic
1024421396 7:49171055-49171077 AGGAGGGAAAGTAGAACTGATGG + Intergenic
1024947525 7:54825242-54825264 AGGAAGAAAAGAAGAAAGGAAGG - Intergenic
1025307713 7:57879127-57879149 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1025488078 7:61076995-61077017 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1025565895 7:62433477-62433499 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1025837959 7:65113300-65113322 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1025879310 7:65519781-65519803 AGGAGGAAAAGAAAAAAGGAAGG - Intergenic
1026511113 7:71027934-71027956 TGGAGAGAAAGCAGAACCGTGGG - Intergenic
1026520505 7:71113694-71113716 GGGAGGGAAAGAAGAAAGGAAGG - Intergenic
1027956871 7:84889843-84889865 TGCAGGAAAAGCAGATAGAAAGG - Intergenic
1027978107 7:85184976-85184998 AGAAGGAAAAGGAGAAGGGAGGG + Intronic
1028246674 7:88487378-88487400 AGGAGGAGAAGGAGAAGGGAAGG + Intergenic
1029144095 7:98433760-98433782 TGGAAGAAAAGAAGAAAGGAAGG - Intergenic
1030200358 7:106896699-106896721 GGGAGGAAATGCAGAGGGGATGG + Intronic
1030770409 7:113468232-113468254 TAGAGGAAAAGAAAAAAGGAGGG - Intergenic
1031040846 7:116837058-116837080 TGGAGGAAAAAAAGAAAGGCTGG - Intronic
1031345783 7:120664477-120664499 GGGAGGAAAAGAAGAAAGGAAGG + Intronic
1032341830 7:131080901-131080923 AGAAGGAATAGCAGAAGGGAGGG - Intergenic
1032508419 7:132453100-132453122 TGGAGGAAAAGGAGGAGAGAAGG + Intronic
1035510080 8:172959-172981 TGGAGGAAAAGAAAAACGGAGGG + Intergenic
1035862045 8:3039435-3039457 AGGAGGAAAGGAAGAAAGGAGGG - Intronic
1035971267 8:4251872-4251894 TGGAGGAAGAGGGGAAGGGAGGG + Intronic
1036126598 8:6068614-6068636 AGGAAGGAAAGCAGAAAGGAAGG - Intergenic
1036504692 8:9344732-9344754 GGGAGGGAAAGAAGAAAGGAAGG + Intergenic
1037109564 8:15149482-15149504 TGGAGGAAATGCAAAAAGCAGGG - Intronic
1038120389 8:24607971-24607993 AGGAGGAAAAGGAGAAGGGGAGG + Intergenic
1038123336 8:24642749-24642771 TGGAGGAAAAGAAGATGGCATGG - Intergenic
1039039674 8:33395326-33395348 TGGCAGAAAAGCAGAAGAGAAGG + Intronic
1039110138 8:34032790-34032812 TGGAGAAAAATCAGAACATAGGG + Intergenic
1039717282 8:40123479-40123501 GGAAGGAAAAGAAGAAGGGAGGG + Intergenic
1039742703 8:40396853-40396875 TGGAGGAAAAGCAGGCTTGAGGG + Intergenic
1039796898 8:40923446-40923468 TGGAGGAATTGCAGAAAAGAGGG - Intergenic
1040352957 8:46586959-46586981 AGGAGGAAGAGAAGAACAGAGGG - Intergenic
1040436717 8:47398432-47398454 TGGAGAAAAAGCAGAAAAGGGGG + Intronic
1040695785 8:49996441-49996463 TGAAGGAAAAGGAGAAGGCAAGG - Intronic
1040728872 8:50418352-50418374 TGGAGGAAAAGAGGAATGCAGGG - Intronic
1041421002 8:57666972-57666994 TGGAGGGGAAGCAGAGGGGAAGG - Intergenic
1042470625 8:69183405-69183427 AGGAGGGAAAGGAGAACGGGAGG + Intergenic
1043325268 8:79042760-79042782 GGGAGGAAAAGCAGAAAAAATGG - Intergenic
1043651447 8:82598295-82598317 TGGAGAAAAAACAGCACAGATGG - Intergenic
1044813845 8:96090619-96090641 GGGAGGAACAGCAGAATGGAAGG + Intergenic
1045018025 8:98015679-98015701 TGGAGGAAGAGCAGGATAGAAGG - Intronic
1045206403 8:100045407-100045429 AGGAGGAAAAGCAGGACTGGAGG - Intronic
1045600752 8:103712999-103713021 AGGAGGAAAAGAAGGAAGGAAGG - Intronic
1045650831 8:104340500-104340522 TGGAACAAAAGAAGAATGGAGGG - Intronic
1045791686 8:105991215-105991237 TAGAGGAATAGCAGGAGGGAAGG + Intergenic
1045913614 8:107439994-107440016 TGCAGGGAAAGCAGAATAGATGG + Intronic
1046796961 8:118383991-118384013 TGAAGAAAAAGCAGAATGAAGGG + Intronic
1047066721 8:121292113-121292135 AGGAAGAAAAGCAAAAAGGAAGG - Intergenic
1048184077 8:132223178-132223200 TGGAAGAAAGGAAGAAAGGAAGG + Intronic
1048257588 8:132916977-132916999 TGGAGGGAAAGAAGGAAGGAAGG - Intronic
1048317305 8:133371684-133371706 ATGAGGAAGAGCAGAAAGGAAGG + Intergenic
1049458277 8:142706204-142706226 TGGATGGAAGACAGAACGGAGGG + Intergenic
1049575019 8:143385942-143385964 TGTTGGCAAAGCAGAAAGGACGG - Intergenic
1049996360 9:1038021-1038043 TACAGGAAAACCAGAATGGAGGG - Intergenic
1050041329 9:1496883-1496905 TGAAGGAAAGGAAGAAAGGAGGG - Intergenic
1050650139 9:7767031-7767053 TGGAGGAGAATTAGAAAGGAGGG + Intergenic
1051160843 9:14205278-14205300 GGGAGGGAAAGAAGAAAGGAAGG + Intronic
1052179648 9:25508215-25508237 AGGAAGAAAAGAAGAAAGGAGGG - Intergenic
1052387294 9:27837013-27837035 AGGAGGAAAAGCAGTAAAGATGG - Intergenic
1052520469 9:29541519-29541541 GGCAGGAAGAGCAGAAAGGAGGG - Intergenic
1053141131 9:35683290-35683312 TGGAGGGAAAGAGGAAAGGAAGG + Intronic
1053698386 9:40661457-40661479 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1053944390 9:43291675-43291697 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1054309677 9:63460864-63460886 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1054408466 9:64785001-64785023 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1054441619 9:65268812-65268834 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1054444294 9:65297933-65297955 TACAGGCAAAGAAGAACGGAGGG - Intergenic
1054488661 9:65752677-65752699 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1054980820 9:71203812-71203834 AGGAGGAGAAGCAGAAAAGAAGG - Intronic
1055411299 9:76032633-76032655 TGGAGGCAAAGCTGAATCGAAGG - Intronic
1055716414 9:79122781-79122803 AGGAGGAAAAGAAGGAAGGAAGG + Intergenic
1056381752 9:86062625-86062647 GGGAGGAAAAGGACAAAGGAAGG + Intronic
1057723281 9:97549846-97549868 TGGAGGATAAGCTGAAGGGAGGG - Intronic
1057724433 9:97558123-97558145 AGGACGAAAAGAAGAAAGGAGGG - Intronic
1057953453 9:99388223-99388245 AGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1058225932 9:102363319-102363341 AGGAGGAAAAGATGAAGGGAAGG + Intergenic
1059198719 9:112395069-112395091 AGGAGGAAGAGAAGAACAGAGGG + Intronic
1059415992 9:114162812-114162834 GGGAGACAAAGGAGAACGGAAGG + Intronic
1059437252 9:114284274-114284296 TGGAAGAAATGCAGCAGGGAAGG + Intronic
1059499287 9:114737443-114737465 GGGAGGGAAGGCAGAAAGGAAGG - Intergenic
1059542526 9:115144379-115144401 GGGAGGAAAAGGAGAAGGGGAGG - Intronic
1059658368 9:116377315-116377337 TTGAGGAGAAGCAGAACTGGAGG - Intronic
1059672309 9:116503095-116503117 TGGAAGAAAAGAAAAAAGGAAGG + Intronic
1059683454 9:116609125-116609147 TGGAGGAAAAGAAAAATGGCGGG + Intronic
1061568100 9:131457691-131457713 TGGAGGACAGGCTGAAAGGATGG - Intronic
1062085510 9:134646025-134646047 TGGAGTAAAAAGAGAAGGGATGG - Intronic
1062757895 9:138313949-138313971 TGGAGGAAAAGAAAAACGGAGGG - Intergenic
1202780749 9_KI270717v1_random:34647-34669 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1203587526 Un_KI270747v1:20253-20275 AAGAGGAAAAGAAGAAAGGAAGG - Intergenic
1203615805 Un_KI270749v1:62455-62477 AAGAGGAAAAGAAGAAAGGAAGG + Intergenic
1185581330 X:1213159-1213181 TGGGGGAGAGGCAGAAGGGAAGG - Intergenic
1185766856 X:2732614-2732636 AGGAGGAAAAGAAGAAGGGAGGG - Intronic
1186092742 X:6067313-6067335 TGGAAGAAAAGAAGATGGGAAGG - Intronic
1186107105 X:6219445-6219467 AGGAGGGAAAGAAGAAAGGAAGG - Intronic
1186145724 X:6621927-6621949 TGGAGGAAAGGAAGGAAGGAAGG + Intergenic
1187129617 X:16489693-16489715 TGTAGGAAAAGCAGGAGGGAAGG - Intergenic
1187231749 X:17430102-17430124 TGGAGGAAAGGAAGGAAGGAAGG - Intronic
1188601984 X:31978363-31978385 TGGAGGAAAAGCAATAACGATGG - Intronic
1188823295 X:34800498-34800520 AGGAGGAAGAGAAGAACAGAGGG - Intergenic
1189509280 X:41645733-41645755 AGGAGGAAGAGAAGAACAGAGGG - Intronic
1189978559 X:46486784-46486806 AGGAGGAAGAGAAGAACAGAGGG + Intronic
1190427249 X:50345254-50345276 GGGAGGAAAAGCAGGAGGAAGGG - Intronic
1190453876 X:50606957-50606979 TGGAGGGCAAGCAGAAGAGAAGG + Intronic
1191851090 X:65587030-65587052 TGGAGGAAAGGCATCAAGGAAGG + Intergenic
1194512790 X:94816162-94816184 AGAAGGAAAAGCAGAAGGGCGGG - Intergenic
1196353866 X:114764963-114764985 TGGAGGGAAGGAAGAAAGGAAGG - Intronic
1196686248 X:118512989-118513011 TTGAGGAAAATCAGAATGGGGGG - Intronic
1196923010 X:120603916-120603938 TGCAGGAAGAGAAGAATGGAGGG - Intronic
1197616692 X:128699913-128699935 TGGAGGAAGAGAAGAAGGGAGGG + Intergenic
1198017202 X:132623447-132623469 TGGAGGAAGAGCAGGAGGGAAGG + Intergenic
1198243034 X:134803000-134803022 TGGAGGAAAGGGAGAAAGTAGGG + Intronic
1198596711 X:138243820-138243842 TGGAGCAAAGGCAGGACAGAAGG + Intergenic
1198613373 X:138426200-138426222 TGCAGGAAAAGAAGAAAGCAAGG + Intergenic
1199485475 X:148342694-148342716 TGGAAGAAAGGAAGAAAGGAAGG + Intergenic
1199849413 X:151714793-151714815 AGGAGGAAAAGAAGAAGGAAGGG - Intergenic
1200757019 Y:6999733-6999755 GGGAGGAAGAGAAGAAGGGAAGG - Intronic
1200828103 Y:7663719-7663741 TGGAAGAAAAGAAGGAAGGAAGG + Intergenic
1201475492 Y:14376852-14376874 AGGAGGAAGAGAAGAATGGAGGG + Intergenic
1201691769 Y:16774986-16775008 GGGAGGAAGAGAAGAAAGGAGGG - Intergenic
1202093290 Y:21216591-21216613 TGGAGAAAAAGAAGAATAGAGGG + Intergenic
1202247033 Y:22830522-22830544 GGGAGGAAGAGAAGAACAGAGGG + Intergenic
1202400022 Y:24464270-24464292 GGGAGGAAGAGAAGAACAGAGGG + Intergenic
1202470759 Y:25205816-25205838 GGGAGGAAGAGAAGAACAGAGGG - Intergenic