ID: 1183573663

View in Genome Browser
Species Human (GRCh38)
Location 22:38673078-38673100
Sequence AGCAAGGCCGGCCCTACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183573663 Original CRISPR AGCAAGGCCGGCCCTACACA CGG (reversed) Intronic
903265750 1:22157001-22157023 AGGAAGGCCGGCCCTCTCCATGG + Intergenic
904032638 1:27542837-27542859 AACAAGGCCTGGCCTAAACATGG + Intronic
907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG + Intronic
908476224 1:64491434-64491456 AGCAAGGCATGCCTTATACATGG + Intronic
921159739 1:212464429-212464451 AGGAAGGCAGGTGCTACACATGG - Intergenic
922543108 1:226433828-226433850 AGCATGTCCAGCACTACACAAGG + Intergenic
922697496 1:227738361-227738383 AGAAAAGCCGGCTCTACACCAGG - Intronic
1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG + Intergenic
1066656921 10:37705078-37705100 AGCCAGCCAAGCCCTACACAAGG - Intergenic
1074831735 10:117254395-117254417 AGCATGCCCATCCCTACACAGGG - Exonic
1076199152 10:128544563-128544585 AGAAAGGCTGGCTCTACACTTGG - Intergenic
1078087904 11:8245233-8245255 AGCAAGGCAGGGCCCAGACATGG - Intronic
1079007712 11:16803796-16803818 AGGAAGGCTGGCCTTACCCACGG - Intronic
1080419939 11:32100818-32100840 GAAAAGGCTGGCCCTACACAAGG + Intronic
1082895032 11:58181005-58181027 AGCAAAGCTGACCCTACTCAAGG + Exonic
1089387355 11:118077142-118077164 ACCAAGGCCTGCCCTGCACTCGG + Exonic
1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG + Intergenic
1094714704 12:33001187-33001209 ATCAAGGCCGGCAGAACACAAGG - Intergenic
1103954383 12:124568031-124568053 CGCAGGGAGGGCCCTACACAGGG + Intergenic
1104081315 12:125432760-125432782 ACCAAGGCCGGCCCATCAAAGGG - Intronic
1104455665 12:128909879-128909901 TGCAAGGCAGGCCGTACACAAGG + Intronic
1104950485 12:132437687-132437709 GGCCAGGCCTGCCCAACACAGGG + Intergenic
1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG + Intronic
1122272663 14:100575332-100575354 AGCGATGCCAGCCCTTCACAGGG - Intronic
1122730492 14:103793441-103793463 AGCAAGGCAGCTCCTCCACAAGG - Intronic
1202858189 14_GL000225v1_random:64260-64282 AGCAAGGCTGCCCCGGCACAGGG - Intergenic
1128735493 15:70051519-70051541 AGCAAGACCTGCCCTAGACATGG + Intronic
1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG + Intronic
1136316255 16:29456031-29456053 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1142697050 17:1639580-1639602 GGAAAGGCGGGCCCTTCACATGG - Intronic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1146302949 17:31705477-31705499 AGCAATGCCTTACCTACACACGG + Intergenic
1153097780 18:1427805-1427827 TGCAAAGCTGGCCCTGCACAGGG - Intergenic
1154210128 18:12372528-12372550 AGCAATGCCATCCCTACCCAAGG + Intronic
1155440119 18:25853514-25853536 GGCAAGGTCTCCCCTACACAGGG + Intergenic
1155965606 18:32032700-32032722 ACCAAGCCCGGCCCTCCACTGGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG + Intronic
925152156 2:1622453-1622475 AGCAAGGCACGCCCTAACCAGGG + Intergenic
925244392 2:2367427-2367449 AGCCAGGCCCGCCCCACAGATGG - Intergenic
926424825 2:12731277-12731299 AGCACAGCCCTCCCTACACACGG - Intronic
928413292 2:31070824-31070846 AGAGAGGCTGGCCCTACCCAGGG + Intronic
935841995 2:107123550-107123572 AGCAAGGCAGGTCCCACAGAAGG - Intergenic
937888216 2:126915086-126915108 AGCCAGGCCTGTGCTACACAGGG + Intergenic
938155893 2:128939684-128939706 AGCAAAGCCTGCCCAACAGAGGG - Intergenic
946940562 2:224765750-224765772 AGCAACTCCGGCCCTACCCACGG - Exonic
947013444 2:225591110-225591132 AGCATGGCGGGCCCTCCAGATGG + Intronic
1170448624 20:16457737-16457759 AGTAAGGCCTGCCCTAGATAAGG + Intronic
1171396639 20:24838720-24838742 AAGAAGGCTGGCCCTGCACAAGG + Intergenic
1172662420 20:36576269-36576291 AGCAAGGCCCACCCTCCACTTGG - Intronic
1174959957 20:55144655-55144677 AGCAAGGCACCCCCTTCACAAGG - Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1179054529 21:37918806-37918828 GGCAAGGCCAGATCTACACATGG - Intergenic
1179346582 21:40563985-40564007 AGCAAGGCCAGCCATGCAAAAGG + Intronic
1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
961394595 3:126578272-126578294 AGCATGGGCGGCCCCACACCAGG - Intronic
962722434 3:138187961-138187983 TGCAAGCCCGGCGCTTCACAAGG - Intronic
963538800 3:146561449-146561471 AGCAAGGCATGTCCTTCACAAGG + Intergenic
966986479 3:185184599-185184621 AGCAAGGCAGTCCCTAAAGAAGG + Intergenic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
986130902 5:4929105-4929127 TGCAAGGCAGGCTCTTCACAAGG + Intergenic
998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG + Intronic
1006531924 6:34662936-34662958 AGCCAGGCTGGGACTACACAGGG + Intronic
1014587657 6:123219843-123219865 AGTAAAGCCGGCCCTGCACAAGG + Intronic
1016385308 6:143525074-143525096 AGCATGGCCTGCTCTGCACAGGG + Intergenic
1019442543 7:1054744-1054766 AGCTGAGCCGGCCCCACACACGG - Intronic
1020063269 7:5168500-5168522 AGCAAGGACTGACCTTCACAGGG + Intergenic
1028291383 7:89069291-89069313 GGCAAGGCCGTCCCCACAGAAGG + Intronic
1029652191 7:101901189-101901211 AGCTGGGCCCGCCCTACCCAGGG - Intronic
1035270045 7:157714380-157714402 CGCAAGCCCAGCCCTGCACAGGG - Intronic
1039977940 8:42383219-42383241 GGTAAGGCCAGCCCTCCACAAGG + Intergenic
1040605428 8:48927082-48927104 AGCAAGGCAGGCACACCACATGG - Intergenic
1040866854 8:52056261-52056283 AGCAAGGCTGGGCTCACACACGG - Intergenic
1043102382 8:76061686-76061708 AGCAAGACAGGCCCATCACATGG - Intergenic
1050105907 9:2166534-2166556 AGTAAGGCTGGAACTACACAGGG - Intronic
1060860712 9:126952502-126952524 AGCATGGCCATCCTTACACAAGG + Intronic
1061271582 9:129546767-129546789 TGCCAGGCCAGCCCTACACTAGG - Intergenic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic
1198390372 X:136168065-136168087 AGCAGGGCCTCCCCCACACAAGG - Intronic