ID: 1183577537

View in Genome Browser
Species Human (GRCh38)
Location 22:38701241-38701263
Sequence CGTCCAGGTAGGACTCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183577537_1183577543 3 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577543 22:38701267-38701289 GCCTGCCCTTCTCCCGGGCGTGG 0: 1
1: 0
2: 3
3: 16
4: 191
1183577537_1183577551 16 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577551 22:38701280-38701302 CCGGGCGTGGGCGTTGTTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183577537_1183577552 17 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577552 22:38701281-38701303 CGGGCGTGGGCGTTGTTTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1183577537_1183577541 -2 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577541 22:38701262-38701284 CGCCAGCCTGCCCTTCTCCCGGG 0: 1
1: 0
2: 1
3: 45
4: 467
1183577537_1183577554 28 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577554 22:38701292-38701314 GTTGTTTCGGGGCGGCAGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1183577537_1183577549 15 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577549 22:38701279-38701301 CCCGGGCGTGGGCGTTGTTTCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1183577537_1183577540 -3 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577540 22:38701261-38701283 ACGCCAGCCTGCCCTTCTCCCGG 0: 1
1: 0
2: 5
3: 21
4: 235
1183577537_1183577545 4 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577545 22:38701268-38701290 CCTGCCCTTCTCCCGGGCGTGGG 0: 1
1: 0
2: 3
3: 11
4: 176
1183577537_1183577553 20 Left 1183577537 22:38701241-38701263 CCTGAGGGAGTCCTACCTGGACG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1183577553 22:38701284-38701306 GCGTGGGCGTTGTTTCGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183577537 Original CRISPR CGTCCAGGTAGGACTCCCTC AGG (reversed) Intronic
903126523 1:21251894-21251916 CCTCCTGGTAGGAGGCCCTCAGG + Intronic
904650313 1:32000687-32000709 GGTCCAGGAAGGTCTCTCTCGGG - Intergenic
906200113 1:43954466-43954488 AGTCCAGATAGAACTCCCTCTGG + Intronic
920011788 1:202873435-202873457 CACCCAGGTAGGAGTCCTTCTGG - Intergenic
920680374 1:208067978-208068000 AGTCCAGGGAGGCCTCCCTGAGG - Intronic
920691352 1:208148812-208148834 CCTCCAGGAAGTACCCCCTCAGG - Intronic
921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG + Intronic
922605559 1:226887866-226887888 CATGCAGACAGGACTCCCTCAGG - Intronic
923864650 1:237926974-237926996 CGCCCACGTAGGAGTCCTTCTGG - Intergenic
1069610093 10:69767187-69767209 CGTCCAGGCAGGAGGCCCTTTGG + Intergenic
1071992748 10:91115851-91115873 CCTCCAGGCAGGACGCCCTGCGG - Intergenic
1077096116 11:799840-799862 CCTCCCGGTAGGACACCCCCAGG + Exonic
1079115710 11:17639361-17639383 TGTCCAGGTAGGAATCCCCTGGG - Intronic
1083158700 11:60841584-60841606 CCCCCAGGTAGCAGTCCCTCAGG + Intergenic
1084456390 11:69270293-69270315 GGTCCCTGTGGGACTCCCTCCGG - Intergenic
1084785325 11:71438622-71438644 GGTCCAGGAAGGTCTCCCTTGGG - Intronic
1084789139 11:71462551-71462573 CGTGTAGTTAGGACCCCCTCGGG + Intronic
1084963827 11:72733105-72733127 CCTCCAGGAAGGCCTTCCTCTGG - Intronic
1085389156 11:76173521-76173543 CGTCCAGGTGCCACTCCCCCTGG - Intergenic
1089734050 11:120537522-120537544 CATCCAGGTAGGACTCCCCCAGG - Intronic
1091122081 11:133065113-133065135 CGTCCAGGTCCGGCTCTCTCGGG - Intronic
1091885951 12:4017164-4017186 GGTCCAGCAAGGACTCCATCAGG + Intergenic
1092669522 12:10847295-10847317 GGTCTAGGTAGGAGTCCTTCAGG + Exonic
1096391032 12:51229215-51229237 CCTCCAAGTAGGACTGTCTCGGG + Intergenic
1103060037 12:117851228-117851250 CCTCCACATAGGCCTCCCTCTGG - Intronic
1108578576 13:51809936-51809958 CGTCCAGGTGAGTCTCCCTCAGG + Intergenic
1115645351 14:35365490-35365512 CGTCCAGGCAGGGGCCCCTCAGG - Intergenic
1122601332 14:102923298-102923320 GGCCCAGGTAGGACTCCTCCGGG + Intronic
1126705580 15:51402214-51402236 CGGCCTGGGAGGACTCCATCAGG - Intronic
1133224837 16:4336078-4336100 CGCCCAGGCAGCACTCCCTGTGG + Intronic
1134042863 16:11081459-11081481 CCTCCAGGTAGGGCTCCTCCAGG + Intronic
1135265829 16:21024634-21024656 TGTCCATGTAGGAATCCTTCAGG + Exonic
1137057879 16:35754050-35754072 CTTCCAGGGTGGACTCCCACAGG - Intergenic
1141766839 16:86064433-86064455 CTTCCAGGTGGGACTGCCTCTGG - Intergenic
1142263524 16:89053311-89053333 CGTCCAGTTGGGATGCCCTCTGG - Intergenic
1144768144 17:17744140-17744162 TGTCCACCTAGGACTCCCTGTGG + Intronic
1148124484 17:45229824-45229846 CGCCCAGCTGGGACTCCCCCAGG - Intronic
1148509133 17:48153828-48153850 TGTCCATTTAGGACTTCCTCAGG - Intronic
1149421448 17:56514461-56514483 TTTCCAGGTTGTACTCCCTCAGG - Intergenic
1152218433 17:79047851-79047873 TGTGCAGGTAGGTCTCCTTCTGG - Exonic
1152654088 17:81512100-81512122 CGCCCACGTAGGAGTCCTTCTGG + Exonic
1152965659 18:111919-111941 CGTCCAGGCCTGACACCCTCCGG - Intergenic
1161265365 19:3361127-3361149 CCTCCAGCCAGGACCCCCTCGGG - Intronic
1161736214 19:5993809-5993831 GGTCCAGGTGGGACTCGCTGGGG + Exonic
1165110640 19:33500122-33500144 GGTCCAGGTTGGACTCCCAGTGG + Intronic
1168270464 19:55247146-55247168 CGTCCAGTGGGGACTCCCTGGGG - Intronic
932734554 2:74245527-74245549 CCTGCAGGTAGGATCCCCTCTGG + Intronic
938732271 2:134155894-134155916 GGTCCAGGGAGGCCTCCCTGCGG - Intronic
1171413897 20:24964578-24964600 CGTCCCTGTAGGCGTCCCTCAGG - Intronic
1175963944 20:62650849-62650871 CGTTCAGCAAGGACTCCCTCAGG + Intronic
1176035544 20:63034753-63034775 CATCCAGGCAGGACTCCGCCAGG + Intergenic
1176051153 20:63120405-63120427 CGTCCAGGTCCAACTCCATCCGG - Intergenic
1176270280 20:64232625-64232647 CAGCCAGGAAGGACTCCATCAGG - Intronic
1176516087 21:7784606-7784628 CATCCAGGAATGACTTCCTCTGG - Intergenic
1178650115 21:34414618-34414640 CATCCAGGAATGACTTCCTCTGG - Intergenic
1178740958 21:35200773-35200795 TGGGCAGGTAGGATTCCCTCAGG - Intronic
1183177952 22:36238059-36238081 CATACAGGTAGAGCTCCCTCTGG - Intronic
1183577537 22:38701241-38701263 CGTCCAGGTAGGACTCCCTCAGG - Intronic
1184600751 22:45541954-45541976 CAGCCAGGTAGGGCTGCCTCTGG + Intronic
1184761538 22:46547485-46547507 TGTGCAGGGAGGACTCCGTCAGG + Intergenic
1185380856 22:50507002-50507024 CTTGCAGGTAGGATGCCCTCGGG + Exonic
961325296 3:126105936-126105958 AGTCCAGGAAGAACTCCCTGAGG + Intronic
961569505 3:127787664-127787686 CCTCCAGCGAGGACACCCTCAGG - Intronic
961779555 3:129313718-129313740 AGGGCAGGTAGGACTCCCACTGG + Intergenic
968497349 4:926100-926122 TGTCCAGGGAGGACCCCCTGGGG - Intronic
970004008 4:11393708-11393730 CCTCCAGGCAGGACAACCTCTGG - Exonic
979648090 4:123095263-123095285 CTTTCAGGTAGAACTCCCTGTGG + Intronic
984708163 4:182862866-182862888 CCTACAGGTAGGATTCGCTCTGG - Intergenic
997390436 5:133510729-133510751 CTTCCAGAAAGGACTCCCTGGGG - Intronic
1001245374 5:170102155-170102177 TGTCCAAGAAGGCCTCCCTCTGG + Intergenic
1001606000 5:172960035-172960057 GGTCCAGGTACGTCTCCCTCCGG + Exonic
1007985684 6:46205119-46205141 CGCCCACGTAGGAGTCCTTCTGG - Intergenic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1019853495 7:3582393-3582415 CCCTCAGGTAGGTCTCCCTCAGG + Intronic
1024039063 7:45535472-45535494 CATCCATGTAGAACTCCCTAAGG + Intergenic
1039953540 8:42190616-42190638 AGTCCAGGTGTGACTCGCTCTGG + Intronic
1044475314 8:92618914-92618936 CGTGGAGGTTGGACTCTCTCAGG - Intergenic
1049594744 8:143478134-143478156 GGTCCAGCCAGGACTCCCTGAGG + Intronic
1050720261 9:8581106-8581128 CTTCCAGGTAGAACTCACCCTGG - Intronic
1059345594 9:113625775-113625797 CGGCCAGGTGTGACCCCCTCTGG - Intergenic
1200059878 X:153479482-153479504 CCTCCAGGGAGGGCTCTCTCAGG - Intronic