ID: 1183578607

View in Genome Browser
Species Human (GRCh38)
Location 22:38708570-38708592
Sequence CCTGTTAAGCAGCAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183578600_1183578607 8 Left 1183578600 22:38708539-38708561 CCATATTCTCAGTCACTTGGGTC 0: 1
1: 0
2: 2
3: 16
4: 176
Right 1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG 0: 1
1: 1
2: 0
3: 31
4: 242
1183578597_1183578607 16 Left 1183578597 22:38708531-38708553 CCACAGTGCCATATTCTCAGTCA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG 0: 1
1: 1
2: 0
3: 31
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183578607 Original CRISPR CCTGTTAAGCAGCAGGAGGC AGG Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900947000 1:5836685-5836707 TCTCTTAAGCAGGTGGAGGCAGG - Intergenic
901774316 1:11549542-11549564 CCTGTTAGGTAGCACAAGGCAGG + Intergenic
902427133 1:16332650-16332672 GCTGTTCAGCAGCTTGAGGCAGG - Intronic
902609486 1:17588682-17588704 CCTCTGAAACCGCAGGAGGCAGG + Intronic
903176716 1:21585908-21585930 CCTGTTTATCAGAAGGAAGCCGG + Intergenic
904449205 1:30600323-30600345 CGTGTTAAGCAGCAGCCGGGAGG - Intergenic
905629604 1:39511294-39511316 CCTGTTGAGCAGGTGGATGCTGG - Exonic
905668155 1:39774896-39774918 CCTGTTGAGCAGGTGGATGCTGG + Exonic
906114852 1:43349569-43349591 CGAGGTGAGCAGCAGGAGGCGGG - Intronic
906139384 1:43524707-43524729 CCTGTAAGGCAGCAGGAGAGAGG + Intergenic
906561094 1:46757512-46757534 CCTGTTAAGCAGGAGGAGTGGGG - Intergenic
907417925 1:54327183-54327205 CCTGTTGAGCATTAGGAAGCGGG - Intronic
907835768 1:58107057-58107079 GCTATTAAGCTCCAGGAGGCTGG - Intronic
907853440 1:58278707-58278729 CCTGATCAGCAGCAGGCGGGGGG + Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908732757 1:67243457-67243479 CCTGTCAAGGGGTAGGAGGCTGG - Intronic
909963159 1:81873641-81873663 CATGTTAGATAGCAGGAGGCTGG + Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
916012011 1:160714675-160714697 CCTGCTGAGCTGCAGGTGGCAGG - Intergenic
917552695 1:176051598-176051620 ACTGTAAAGCAGCCGCAGGCAGG + Intronic
918013672 1:180611481-180611503 CCTCTTTAGCAGCTGAAGGCAGG - Intergenic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920585010 1:207150338-207150360 CCTGTTAGGCGGCAGGGGGAGGG - Intergenic
920734526 1:208518875-208518897 TGTGTTAAGCAGCAGAAGTCAGG + Intergenic
923785959 1:237069983-237070005 CCAGTTAAGCTACTGGAGGCTGG + Intronic
924645324 1:245872345-245872367 TGGGTGAAGCAGCAGGAGGCGGG - Intronic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1062991329 10:1821984-1822006 CCTGTTAAGGAGGAGCAAGCTGG + Intergenic
1063306703 10:4909329-4909351 CCTGTGCAGCAGGAGGAGCCTGG + Intergenic
1064018494 10:11791148-11791170 CCTGGGAAGCGGCAGGAAGCTGG - Intergenic
1064614771 10:17141454-17141476 CCTTAAAAGCAGCTGGAGGCTGG - Intergenic
1065589994 10:27253734-27253756 TCTGATCAGCAGGAGGAGGCGGG + Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1067534550 10:47099372-47099394 GCTGTTAGGAAGCAAGAGGCAGG - Intergenic
1067705460 10:48603836-48603858 CCTGTGAATCCACAGGAGGCTGG + Intronic
1069962352 10:72086649-72086671 CCTGTCCAGCCGCAGGAGCCTGG - Intronic
1073518118 10:104097427-104097449 CATGGTGAGAAGCAGGAGGCTGG - Intergenic
1074822900 10:117194758-117194780 CCTGGTCAGCAGGAGGAGACAGG + Intergenic
1075348246 10:121700556-121700578 CCTATCAATCAGCAGGAAGCAGG - Intergenic
1075899960 10:126033648-126033670 CCTGGTGAGGAGCAGGAGGGAGG - Intronic
1075970853 10:126650890-126650912 CCTGTGAAGTGGCAGGTGGCTGG - Intronic
1076198164 10:128535666-128535688 CCTGGAAGCCAGCAGGAGGCTGG - Intergenic
1077112587 11:868532-868554 CGTGTCAAGCAGCAGCAGGGCGG + Exonic
1077795608 11:5488740-5488762 CCTGTTAAGAAGAAGGTGTCTGG - Exonic
1078125016 11:8552791-8552813 ACTGTTAAGCAGCCTCAGGCAGG - Intronic
1079085819 11:17444209-17444231 CCTGTTAAACACTGGGAGGCAGG - Intronic
1080083538 11:28251263-28251285 CTTGTTTAGCAAAAGGAGGCAGG - Intronic
1080319593 11:30991112-30991134 CCTGGTAACCATGAGGAGGCTGG + Intronic
1087485362 11:98753838-98753860 CCTGTCAAGGGGTAGGAGGCTGG + Intergenic
1087601831 11:100327181-100327203 GCTTTTAAGCAGGATGAGGCTGG - Intronic
1087878936 11:103392214-103392236 ACTGCAAGGCAGCAGGAGGCTGG - Intronic
1088248328 11:107840692-107840714 CCAGAGAAGCAGCAGGAGCCAGG - Intronic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089806296 11:121093797-121093819 TCTGATCAGCAGGAGGAGGCAGG - Intergenic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091770323 12:3147231-3147253 GCTGCTGGGCAGCAGGAGGCAGG + Intronic
1091953561 12:4616027-4616049 CCTGTTTAACAGAAGGAGGTTGG + Intronic
1092287229 12:7135691-7135713 CAGGTTAGGCAGCAGGACGCTGG - Intronic
1093013821 12:14136200-14136222 ACTGTTCAGCATCAGGAGGTAGG + Intergenic
1093680119 12:21992929-21992951 CATCTTAAGCAGCAGGAAGGAGG + Intergenic
1095536302 12:43252397-43252419 GCTGTTAACAAGCAGGTGGCAGG - Intergenic
1095802596 12:46283907-46283929 CCTGTGAAGCAGCAGGCTGGAGG + Intergenic
1096955601 12:55522436-55522458 TCTGTTAACCAGCAGGATGTTGG - Intergenic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1101965209 12:109277738-109277760 CCTGTCAAGCAGCAGGTCTCAGG + Intergenic
1103059214 12:117845323-117845345 ACTTTTAAGAAGCAGAAGGCAGG - Intronic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1104991260 12:132625044-132625066 CCTGTGAAGAAGCAGCAGGCAGG - Intronic
1107662759 13:42656369-42656391 CCTCTTAAGCAGCTGGGGGAGGG + Intergenic
1107768523 13:43764078-43764100 CCTATTAAGCTGCAGTAGGCAGG - Intronic
1108524934 13:51278558-51278580 CCTGGGTGGCAGCAGGAGGCAGG - Intronic
1111510562 13:89256446-89256468 GGTGTTAAGTACCAGGAGGCAGG + Intergenic
1111834461 13:93370629-93370651 CCTGTTATGGAGGAAGAGGCTGG + Intronic
1113708958 13:112451871-112451893 CCTGGAGAGCATCAGGAGGCTGG + Intergenic
1114004825 14:18301121-18301143 CCTGATTAGTAGGAGGAGGCAGG - Intergenic
1114362159 14:21985924-21985946 CCTCTTAAGCAGTAGAAGGCTGG + Intergenic
1115563180 14:34601515-34601537 CCTCTTAAGAAGTAGGAGCCAGG - Intronic
1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG + Intronic
1122939123 14:104973428-104973450 CCTGCCAAGCAGCAGGAGCAGGG + Intronic
1202917963 14_KI270723v1_random:2823-2845 CCTGAGGAGCACCAGGAGGCCGG - Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1127812628 15:62577841-62577863 CCTGTTAGGTAGTAGGAGGCTGG - Intronic
1128220979 15:65968401-65968423 CCTGCTAAGCAGGAGGGAGCAGG - Intronic
1130141257 15:81228186-81228208 CCTATTCCACAGCAGGAGGCTGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131094729 15:89648144-89648166 CCTGCTAATGGGCAGGAGGCAGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132525747 16:413697-413719 GGTGCTGAGCAGCAGGAGGCTGG + Intergenic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1141595487 16:85094729-85094751 CCTGGGAAGGAGCAGGACGCAGG + Intergenic
1142905343 17:3037375-3037397 CATGCTAAGGAGCAGGAAGCGGG - Exonic
1144202398 17:12953289-12953311 AGTGTGAAGCAGCAGGAGCCAGG - Intronic
1144576363 17:16432209-16432231 CATGTTGAGCAGCAGGATGTAGG - Exonic
1145011046 17:19368073-19368095 TCTGTTATGCTGCAGGAGGCTGG - Intronic
1145062151 17:19740074-19740096 CCTCTGAAGCAGCAGGAGCAGGG - Intronic
1150479640 17:65499396-65499418 CGGGTTAGGGAGCAGGAGGCTGG - Intergenic
1151144817 17:72030786-72030808 CCTGTGAAGCCACAGGAGGCTGG - Intergenic
1151194224 17:72420492-72420514 ACTGTCAAGCAGGAGGAGGGAGG - Intergenic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1152253942 17:79226564-79226586 CCTGTGGAGCAGGAGGAGCCTGG + Intronic
1152851099 17:82636507-82636529 CCTCTTCAGCTGCAGGAGGTGGG - Intronic
1153821934 18:8839463-8839485 CCTGCCAAGCAGCATGCGGCTGG - Intergenic
1153854989 18:9136852-9136874 CCTGTAAAGCCGCCGGAGCCGGG - Exonic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1155263343 18:24066833-24066855 CCTCTGGAGCATCAGGAGGCGGG - Intronic
1156779917 18:40838634-40838656 CCTTTCAAGCAGCAGGAGCTCGG - Intergenic
1158210822 18:55047816-55047838 CATGTTAGGCAGCAGGAGCTGGG + Intergenic
1158393271 18:57060772-57060794 CCTGGAATGCAGCATGAGGCTGG + Intergenic
1160192322 18:76724146-76724168 CCTGTTGAGCAGCAGGAAAGGGG - Intergenic
1160340032 18:78081904-78081926 CCTGTGAGGCAGTGGGAGGCGGG + Intergenic
1160975844 19:1792019-1792041 CCGGTTCTGCAGCAGGAGGCTGG + Exonic
1161406135 19:4092157-4092179 CCTCTTTTGCAGCTGGAGGCAGG + Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162473841 19:10888173-10888195 CCTCTTTAGCACCAGGAAGCAGG + Intronic
1163128807 19:15259192-15259214 GCTGCCAAGCAGCAGGAAGCAGG + Intronic
1164491798 19:28721354-28721376 CCTGTTAAGGAAGAGGAGCCTGG - Intergenic
1166148888 19:40856563-40856585 GCTATTCAGCAGCAGAAGGCAGG - Intronic
1166744396 19:45133742-45133764 CCTTTAAGGCAGCAGGAAGCAGG - Intronic
1167504376 19:49863320-49863342 CGTGTAAAACAGCAGGAGGGAGG - Intronic
926039392 2:9660586-9660608 GTCGTTCAGCAGCAGGAGGCGGG + Intergenic
926153493 2:10437160-10437182 GCTGTTAAGCAGCTGGAGGGTGG - Intergenic
926168020 2:10533748-10533770 CCTGTCACCCAGCAGGACGCAGG - Intergenic
926748417 2:16179354-16179376 CCTTTAAAAAAGCAGGAGGCCGG - Intergenic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
928407868 2:31028614-31028636 CCTTCGAGGCAGCAGGAGGCGGG + Intronic
929272747 2:39990798-39990820 TCTCTTCAGCAGCAGGAGACTGG - Intergenic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
931019499 2:58027451-58027473 CCTTTTAAACAGCAGAAAGCAGG + Intronic
931377630 2:61721587-61721609 CCTGATCAGCAGGTGGAGGCAGG + Intergenic
931759588 2:65404920-65404942 CCTGTTAGGGAGCAGGTGCCTGG - Intronic
932766320 2:74472749-74472771 CCTGCTAAGCAGCCGGCGGCCGG - Exonic
934666460 2:96174704-96174726 CATGTTGAGCAGCAGGGGGCAGG - Intergenic
936607590 2:113973635-113973657 CCCTTTAAGGACCAGGAGGCAGG + Intergenic
937280299 2:120713099-120713121 TGTCTTCAGCAGCAGGAGGCTGG + Intergenic
937365424 2:121257505-121257527 CCTGAAGAGCAGCAGGGGGCAGG + Intronic
937872268 2:126794370-126794392 GCTGCTCCGCAGCAGGAGGCAGG - Intergenic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
938757807 2:134396913-134396935 CTTGTAAAGGAGGAGGAGGCAGG + Intronic
942387240 2:175455378-175455400 TCTGTTAATCAGCAGAAGGGAGG - Intergenic
946767360 2:223053030-223053052 TTTGTACAGCAGCAGGAGGCTGG - Exonic
947752465 2:232540128-232540150 CCTGGTAAGCCGCAGGACGGAGG + Exonic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948815350 2:240507541-240507563 CCTGGTGAGGGGCAGGAGGCTGG - Exonic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169745323 20:8936982-8937004 CCTGTAGAGGAGCAGGACGCAGG - Intronic
1170568225 20:17618451-17618473 CCCGTTGAGCAGCATGGGGCCGG - Intronic
1171249115 20:23635373-23635395 CATGTGAAAGAGCAGGAGGCAGG + Intronic
1171781924 20:29427483-29427505 CCTGAGGAGCACCAGGAGGCCGG - Intergenic
1173630627 20:44511895-44511917 CCTGTTAACCAGTTGGAGGTTGG - Intronic
1174171151 20:48618931-48618953 CCTGTTAATCAGGAGGAGGAAGG + Intergenic
1174183031 20:48686942-48686964 CCTGGGAAGGAGCAGGAGCCCGG - Intronic
1175100189 20:56573916-56573938 CCTCTGAAGCAGAGGGAGGCAGG - Intergenic
1175101079 20:56579261-56579283 CCTGTTCATCAGCAGGAAGAAGG - Intergenic
1175301299 20:57944902-57944924 CCTGTAAAGCAGCCTTAGGCAGG - Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1179544875 21:42107288-42107310 CCTCTTACGCAGAAGGATGCCGG - Intronic
1179813041 21:43884525-43884547 CCTCTGAAGGAGCAGGAGGCTGG - Intronic
1180250661 21:46585269-46585291 TCTTTATAGCAGCAGGAGGCAGG + Intergenic
1180429339 22:15231911-15231933 CCTGATTAGTAGGAGGAGGCAGG - Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1181482027 22:23206127-23206149 CCTGGGAAGCAGCAGGAAACAGG - Intronic
1183071369 22:35398938-35398960 GCTGTTAAACAGAATGAGGCCGG + Intergenic
1183103383 22:35597888-35597910 CCTGCTAAGCACCTGCAGGCTGG - Intergenic
1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG + Intronic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184272636 22:43393389-43393411 CCTCTTCAGCAGAAAGAGGCCGG - Intergenic
1184321717 22:43746976-43746998 CCAGATAAGCAGCAGGATGCTGG - Intronic
1184678525 22:46056325-46056347 CCAGGTAGGCAGCAGGCGGCAGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
949788034 3:7763045-7763067 CCTGGTAAGCAGCAGAACTCAGG - Intergenic
949961598 3:9316841-9316863 CCTGCTAAGCATCTGAAGGCGGG + Intronic
953122010 3:40053723-40053745 CCTGTTGAGCAGTTGAAGGCAGG - Intronic
953211373 3:40878019-40878041 CCTGGCAAGGAGCAGGAGGTTGG - Intergenic
955218918 3:57007841-57007863 CCTGTTATGCAGGAGGAGAGGGG - Intronic
956420494 3:69081738-69081760 CATGTGATGCAGAAGGAGGCTGG - Intergenic
957083575 3:75658914-75658936 CCTGAGGAGCACCAGGAGGCCGG + Intergenic
958810916 3:98859152-98859174 ACTGCAAGGCAGCAGGAGGCTGG + Intronic
961214888 3:125151599-125151621 TCTGCTAAGCAGCCGGAAGCAGG - Intronic
962751682 3:138438398-138438420 CTTGACAAGCAGCAGGTGGCCGG - Intronic
963042081 3:141077409-141077431 ACTGGTGAGCAGCAGGGGGCTGG + Intronic
963427634 3:145152815-145152837 CCTGTTGAGCAGCAGATTGCAGG + Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
969273411 4:6118366-6118388 CCTTTTAAACAGCAGGATGATGG - Intronic
971540456 4:27809952-27809974 CCTGTTAAGCTGCATGAGAATGG + Intergenic
976269868 4:83219952-83219974 CCTGGTCAGAAGCAGGTGGCTGG + Intergenic
978613990 4:110575282-110575304 CCTGTTTAGCAGCAGGAATCAGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
980174962 4:129333413-129333435 CCTGTTAAGAAGAAGGGGCCTGG + Intergenic
984243800 4:177250232-177250254 CCTGTTAGGCGGCGGGAGGAAGG - Intergenic
985950680 5:3219508-3219530 CCTGATGAGCAGGAGGAGGTGGG + Intergenic
987230825 5:15892013-15892035 GCTGGTGAGCAGGAGGAGGCAGG - Intronic
988510852 5:31863356-31863378 CCTGTTAAGCATTAGTTGGCAGG + Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991479465 5:67061704-67061726 CTTGTTAAGCAGAAAGAGGGAGG - Intronic
996831431 5:127744357-127744379 CCTGTCAAGCAGAAGGAGAGAGG + Intergenic
997009053 5:129855375-129855397 CATATTAAGCATCAGGAGGTAGG - Intergenic
997255928 5:132427955-132427977 CCTGGCACCCAGCAGGAGGCAGG - Intronic
998137848 5:139683793-139683815 CATGTTCATCAGCAGGAAGCTGG - Exonic
998148625 5:139744704-139744726 CCTCATAAATAGCAGGAGGCTGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999726717 5:154444732-154444754 CATGTTTAGAAGCAGGTGGCTGG - Intergenic
1001002975 5:168024985-168025007 CCTGATAAGCACCTGGATGCTGG - Intronic
1001079730 5:168658865-168658887 AAAGTTAAGCAGCAGGATGCAGG + Intergenic
1001511970 5:172329835-172329857 CCTCTTAAGATCCAGGAGGCTGG - Intronic
1002357360 5:178641621-178641643 CCTGATGATCAGGAGGAGGCCGG - Intergenic
1002979530 6:2122310-2122332 CCTGTTAAGACACAGAAGGCTGG - Intronic
1003573492 6:7271289-7271311 ACTGTTAAGAGGCAGGAGGATGG + Intronic
1004237661 6:13888745-13888767 TGTATTAAGCAGCAGAAGGCTGG - Intergenic
1005844562 6:29767321-29767343 CCCCATAAGCTGCAGGAGGCTGG + Intergenic
1007778511 6:44237676-44237698 CCTGGTAAGGACGAGGAGGCGGG - Intergenic
1007810561 6:44482836-44482858 CCTCTTCAGCAGCGGGAGGAAGG + Intergenic
1011272468 6:85593578-85593600 CCTGTTAAGAAGCAGGGAGGCGG + Exonic
1011636156 6:89375673-89375695 CCTGTTAACCAGCAGGAGGCAGG - Intronic
1015928270 6:138331686-138331708 GCCCTTAAGCAGCAGGAGGATGG + Intronic
1017204833 6:151793389-151793411 CCTGTAAAACAGCATTAGGCAGG - Intronic
1017802496 6:157910115-157910137 CCTGTAGAGCAGCAGGATGCAGG + Intronic
1018473055 6:164113453-164113475 CCTGTCAAACTGGAGGAGGCAGG - Intergenic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1021316823 7:19157934-19157956 TCTGATAAGCAGGAGGAGGTAGG + Intergenic
1022766321 7:33416283-33416305 GCTGTCAAGCAGAAGAAGGCAGG - Intronic
1026025032 7:66737826-66737848 CCTGTTTAGCAGTAGCAGGCTGG - Intronic
1026595966 7:71734406-71734428 CTTGTTAAGCTGCAGAGGGCTGG + Intergenic
1026807671 7:73438086-73438108 CCTGAAAACCAGCAGCAGGCTGG - Intergenic
1028166139 7:87540276-87540298 CCTTTTAATCATCAAGAGGCAGG + Intronic
1030596571 7:111547085-111547107 CATTTTAAGCAGCAGAATGCTGG + Intronic
1032926818 7:136615596-136615618 CCTGTTCTACAGCTGGAGGCAGG + Intergenic
1033651970 7:143350671-143350693 CCATTTGAGCAGCAGGAGGGAGG + Intronic
1034853587 7:154519260-154519282 CATGTTATGCTGGAGGAGGCTGG + Intronic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1038067845 8:23982327-23982349 CCAGTGAAGCAGGAGGAGCCTGG - Intergenic
1039578621 8:38645807-38645829 CCTGTCTAGAAGCAGGAGGCTGG + Intergenic
1041117727 8:54556200-54556222 CAAGTCAAGCAGCAGGGGGCAGG - Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1048327093 8:133448275-133448297 CCTTTCAGACAGCAGGAGGCAGG + Intergenic
1048373963 8:133805462-133805484 CCTGTTAAGCATGGGGAGGGTGG + Intergenic
1049341120 8:142113194-142113216 CCTGGGAAGGAGCAGGAAGCAGG - Intergenic
1051638545 9:19203318-19203340 CCTGTTAAAGAGCTGGGGGCTGG + Intergenic
1052996021 9:34552018-34552040 CCTGCAGAGGAGCAGGAGGCCGG - Exonic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1056851103 9:90084918-90084940 GTTATAAAGCAGCAGGAGGCAGG - Intergenic
1056987303 9:91375363-91375385 CCTGTTAATCAGCAGCAGTGCGG + Intergenic
1057456659 9:95219250-95219272 TCTGTGAAGCAGCAGGAGTAAGG + Intronic
1057832364 9:98417122-98417144 GCTGGGAAGCAGCAGGATGCAGG + Intronic
1060799921 9:126537309-126537331 CCTAGGCAGCAGCAGGAGGCTGG - Intergenic
1062211182 9:135365146-135365168 CCTGTTCAGCTGCAGCAGCCTGG - Intergenic
1185943836 X:4352534-4352556 ACTGTAAAACAGCAGCAGGCAGG - Intergenic
1186402199 X:9270305-9270327 CCTGTGCACCAGCAGGAGCCAGG + Intergenic
1187182472 X:16956046-16956068 CCTCTTAACTAGTAGGAGGCAGG + Intronic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1189166392 X:38865135-38865157 ACTATTAAGCAGCAGAGGGCTGG + Intergenic
1191900917 X:66040028-66040050 CCTCTTTGGTAGCAGGAGGCTGG - Exonic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1195709893 X:107765306-107765328 TCCCTTAAGGAGCAGGAGGCTGG + Intronic
1198554694 X:137780574-137780596 TCTGTTAAGCACTAGGAAGCTGG + Intergenic
1199710226 X:150463779-150463801 GGTGGCAAGCAGCAGGAGGCAGG + Intronic
1199850527 X:151722473-151722495 CCTAGTGAGAAGCAGGAGGCTGG - Intronic