ID: 1183578620

View in Genome Browser
Species Human (GRCh38)
Location 22:38708682-38708704
Sequence CTACTTCAGGAGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183578618_1183578620 -8 Left 1183578618 22:38708667-38708689 CCTGAGGCTCAAAGGCTACTTCA 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1183578620 22:38708682-38708704 CTACTTCAGGAGAAGCAGAGAGG 0: 1
1: 0
2: 2
3: 25
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183578620 Original CRISPR CTACTTCAGGAGAAGCAGAG AGG Intronic
901379992 1:8866614-8866636 CTTCTTGAGGAGCACCAGAGGGG + Intronic
901840132 1:11949144-11949166 CAACTTCAGCAGAAGGAGACAGG + Intronic
902447850 1:16478435-16478457 TCCCTTCAGGACAAGCAGAGGGG + Intergenic
903102174 1:21040171-21040193 CAACCTCAGGGGAAGGAGAGGGG + Intronic
904367897 1:30028300-30028322 CTACCTCCGGGGAAGCAGAGAGG + Intergenic
906100074 1:43254562-43254584 CTCCTTCAGGAAATGCAGCGAGG + Intronic
906746593 1:48226282-48226304 CCACTTCAGGAGAAGCCCAGGGG + Intronic
907858068 1:58323328-58323350 ATTCTTCAGGAGAACCTGAGGGG - Intronic
910352884 1:86319566-86319588 CTAGTGCAGGAGAAGCAGAAAGG - Intergenic
911215988 1:95195282-95195304 TTTCTTCTGGAGAAACAGAGGGG + Exonic
912638473 1:111320900-111320922 CCACTTCAGTAGAAGTGGAGAGG - Intergenic
913229445 1:116729695-116729717 CTGCTCCAGGATAAACAGAGAGG - Intergenic
913998160 1:143668185-143668207 CTTCTGCAGGAGAAGGGGAGTGG - Intergenic
915523437 1:156462160-156462182 CTCCCTCAGTAGAGGCAGAGAGG - Intergenic
915607117 1:156959476-156959498 CTGCTTCTGGAGCAGTAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
917241806 1:172956727-172956749 CTGCCTCAGGAGAGGCAAAGGGG - Intergenic
917286451 1:173426311-173426333 GTGCTTCAGGAGAGGCAGATAGG + Intergenic
919865404 1:201778567-201778589 ATACATCAGGAGGAGAAGAGGGG + Intronic
919871144 1:201822470-201822492 CTACTTGAGAAAAAGGAGAGGGG + Exonic
920783015 1:209012871-209012893 CTCCTTCAGGAGAACCAGCTTGG - Intergenic
921218958 1:212959884-212959906 CCACTTAAGGAGAAGCAGAAAGG - Intronic
921307710 1:213813672-213813694 GTTCTTCAGGAGAAGGAGGGTGG + Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
924741041 1:246794305-246794327 CTCCTGCAGGAGAAGTGGAGAGG + Intergenic
1064805902 10:19132119-19132141 CATCTTCAGGGGGAGCAGAGGGG + Intronic
1065419944 10:25531936-25531958 CTATTTCTAGAGGAGCAGAGTGG - Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1069588619 10:69628174-69628196 CTACTTCAGGGAAAGCAAAGAGG + Intergenic
1070971107 10:80568024-80568046 GTCCTTCAGGTGAAACAGAGAGG - Intronic
1071518510 10:86314830-86314852 CTACTGCAGGAGCATCAGAAAGG + Intronic
1074317633 10:112373868-112373890 CTACCTCAGGGGAAGGAGAAGGG - Intergenic
1075275544 10:121089564-121089586 CTCCTTCAGGAGAGGAAGACTGG + Intergenic
1075725979 10:124611106-124611128 CTCATTCAGGAGCAGCAGAGTGG + Intronic
1075945632 10:126430699-126430721 CTCATTCAGCAGAAGCAGACAGG + Intronic
1076591725 10:131588176-131588198 ATACTCCAGGAAAACCAGAGCGG + Intergenic
1077849411 11:6060870-6060892 CTACAGAAGGTGAAGCAGAGGGG + Intergenic
1078769698 11:14337478-14337500 CTACTTGATGAGAAGCAGTGAGG - Intronic
1080988998 11:37507472-37507494 TTTCTTCAGGGGAAGAAGAGGGG - Intergenic
1083490043 11:63009318-63009340 CAGCTGCTGGAGAAGCAGAGAGG - Intronic
1085312494 11:75524979-75525001 CTATTTCAGGAGTAGCAGTGAGG + Intronic
1085454400 11:76657518-76657540 CTAATTTTGGAGAAGCAGTGTGG - Exonic
1086761341 11:90635154-90635176 CTACAACAGGAGAAGAATAGGGG - Intergenic
1096123642 12:49104616-49104638 CATTTGCAGGAGAAGCAGAGTGG + Intronic
1096700049 12:53376775-53376797 CTTCTTCTGGAGGAGCAAAGGGG + Intergenic
1096882299 12:54682912-54682934 CTCCCTCAGGAGAGGAAGAGTGG - Intergenic
1099065681 12:77975641-77975663 CTTCTTGAAGAGAAGCAGACAGG - Intronic
1104942382 12:132401087-132401109 CTCCTGCAGGAGAACCTGAGTGG + Intergenic
1106397994 13:29399999-29400021 CTACAAAAGGAGAAGCAGATAGG + Intronic
1106951505 13:34889834-34889856 ATACTTCAGGAGAAGCAGCCAGG + Intergenic
1108869225 13:54961877-54961899 CTTCTTCTTGAGAAGCAAAGGGG - Intergenic
1109979751 13:69892457-69892479 CTAGAGCAGGAAAAGCAGAGAGG - Intronic
1110376612 13:74801926-74801948 CTACTTCTGGAGAAGTGGACGGG - Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1112697835 13:101970575-101970597 GTGCTTTAGGAGAGGCAGAGGGG - Intronic
1112836771 13:103524434-103524456 ATACTTCAGGAAAAGAACAGCGG + Intergenic
1115646825 14:35374041-35374063 CTCCTTCAGGTGCAGCACAGGGG - Intergenic
1115834410 14:37381875-37381897 CTAATTCAGGTCAAGCACAGTGG - Intronic
1117008394 14:51445424-51445446 CTAGTCCATGAGAAGAAGAGTGG + Intergenic
1118290028 14:64511320-64511342 CTGCTTCTGGAGAGGGAGAGAGG + Exonic
1119281222 14:73409901-73409923 ATACTTAAGGATAAGCAAAGTGG - Intronic
1119532964 14:75376057-75376079 CTACTACAGGACTAGGAGAGGGG - Intergenic
1122714295 14:103684670-103684692 CTACTCCAGCAGCTGCAGAGGGG + Intronic
1125688642 15:41578841-41578863 CTACGCCAGGAGAAGTTGAGGGG + Exonic
1126096305 15:45093349-45093371 CCACTCCAGTAGATGCAGAGAGG + Exonic
1126360283 15:47838460-47838482 CTACTTCAGGCAAAACGGAGAGG - Intergenic
1127248182 15:57201559-57201581 CTACCTCTGGAGTAGAAGAGTGG - Intronic
1127294819 15:57599878-57599900 CTGCTTCAGGAGCAGCAAGGGGG - Intronic
1128789051 15:70419305-70419327 CCACTTTGTGAGAAGCAGAGAGG + Intergenic
1130896925 15:88178100-88178122 ATACTTGTGGAGAAGCAGTGAGG + Intronic
1133706525 16:8359905-8359927 CTCCTTCAGGGCAAGAAGAGAGG + Intergenic
1134032134 16:11000521-11000543 ATGCTTCAGGAGAAGATGAGAGG + Intronic
1138384001 16:56623585-56623607 CTATTACAGGAGACACAGAGAGG - Intergenic
1138480147 16:57297373-57297395 CTGCCTCCAGAGAAGCAGAGAGG + Intergenic
1139104915 16:63817150-63817172 CTACATTAGGAGAAGAAGATAGG + Intergenic
1139877285 16:70156502-70156524 CTCCTGCAGCAGAAGCAGAATGG + Exonic
1140040852 16:71406695-71406717 CTAACTCAGGAGAACCAGGGAGG - Intergenic
1140129933 16:72151710-72151732 CTACGTAAGGGGAAGAAGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141729105 16:85809914-85809936 CTCCCTCAGGAGAGGCCGAGAGG + Intergenic
1142040952 16:87893727-87893749 CTACCTCAGTAAAATCAGAGAGG + Intronic
1143594235 17:7904865-7904887 GTTTTGCAGGAGAAGCAGAGGGG + Intronic
1144858481 17:18284395-18284417 CTACCTCAGGAAGAGCAGAGGGG - Intronic
1146501918 17:33372075-33372097 CAGCTTCAGGAGAGGCAGAGAGG - Intronic
1147135912 17:38434210-38434232 CTCCTCCAGGAGAAGCTGGGGGG - Intronic
1147979574 17:44266246-44266268 GAACTTTGGGAGAAGCAGAGAGG - Intronic
1148569685 17:48658308-48658330 CTACTTCAGGAGGCTGAGAGGGG + Intergenic
1149571250 17:57673987-57674009 CTCCTGCAGGAGAAGGAAAGGGG - Intronic
1150556202 17:66256835-66256857 CTACTTTAGGAGGAGCAGGTTGG - Intergenic
1152776663 17:82206140-82206162 CTCTTTCAGGAGAACCAGTGGGG + Intronic
1154099998 18:11464265-11464287 CCACTTCAGTAGAAGCAGGTGGG + Intergenic
1156880844 18:42077526-42077548 CTCCTTCTGGATAAGCAAAGTGG - Intronic
1157423605 18:47566392-47566414 CAAGTTCAGGAAAAGGAGAGAGG + Intergenic
1158416955 18:57257032-57257054 CCAGTCCAGGAGAGGCAGAGAGG + Intergenic
1160440690 18:78889203-78889225 CTACTTGAGGGGAAGGAGGGAGG + Intergenic
925009948 2:476294-476316 CTATCTCGGGAGGAGCAGAGAGG + Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
927540181 2:23902776-23902798 CTACTTGAGGCCAAGCACAGTGG + Intronic
928052007 2:28008823-28008845 TTACTATAGGAGAAGCAGAAAGG + Intronic
929465862 2:42143177-42143199 AGACTTCAAGACAAGCAGAGAGG - Intergenic
931967702 2:67551636-67551658 GTACTCCAGGAGAAACTGAGGGG - Intergenic
932083751 2:68739092-68739114 CTTCTGCAGCAGCAGCAGAGTGG + Intronic
933164052 2:79055865-79055887 CATCTTCAGGAAAAGCAGAATGG + Intergenic
933289350 2:80420626-80420648 CCACTCCAGGAAAAGCAGAGAGG - Intronic
934684047 2:96307346-96307368 CTACTTCTACAGAAACAGAGTGG - Intergenic
936846156 2:116836115-116836137 GTACTTCAGGATAAATAGAGAGG + Intergenic
939616907 2:144371919-144371941 TTATTACAGGAGGAGCAGAGAGG - Intergenic
940824469 2:158395230-158395252 CTGCTTCAGAAGCAGAAGAGTGG - Intronic
941026905 2:160466770-160466792 CTGCTTCAAGGGAAGCAGTGAGG + Intronic
942484173 2:176422095-176422117 CTACTACAGGGAAAACAGAGAGG - Intergenic
943437239 2:187881350-187881372 GTGCTTCAGGAGAGGCAGAGGGG - Intergenic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
943874995 2:193055516-193055538 CTCCTACAGGACAAGCACAGGGG - Intergenic
945181425 2:207095479-207095501 CTACTTCAGAATACGGAGAGAGG + Intronic
945712485 2:213316177-213316199 CAAATGCAGGAGGAGCAGAGTGG - Intronic
945979093 2:216294704-216294726 TTACTTCAAGAGAAGAAGAGAGG - Intronic
947461223 2:230306367-230306389 CTGCTGCAGGAGACACAGAGAGG + Intronic
947885834 2:233570277-233570299 CTGTTTCAGGAGTGGCAGAGGGG - Intergenic
948111322 2:235458389-235458411 CTTCTTCAAGAAAACCAGAGGGG - Intergenic
948608309 2:239150604-239150626 ATACTTCAGGAGGTGCAGCGCGG - Intronic
948608315 2:239150663-239150685 ATACTTCAGGAGGTGCAGTGTGG - Intronic
948608321 2:239150722-239150744 ATACTTCAGGAGGTGCAGCGTGG - Intronic
948608341 2:239150916-239150938 ATACTTCAGGAGGTGCAGTGTGG - Intronic
1168930583 20:1620147-1620169 CCATTTCAGGAGAATCAGACAGG + Intergenic
1169865431 20:10194976-10194998 CTATTTCAGGAGAAGCAAGAGGG - Intergenic
1171036011 20:21713616-21713638 CTAGTGTAGGAGAAGCAGAGTGG + Intronic
1173562521 20:44016409-44016431 CTACTTCAGGCCAGGCATAGTGG - Intronic
1174409562 20:50325460-50325482 ATAGTTCAGGGGCAGCAGAGAGG + Intergenic
1174743310 20:53037861-53037883 CAACTTCATGAGATGCACAGGGG + Intronic
1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG + Intergenic
1176081366 20:63274950-63274972 CTGCTGCAGGACAAGGAGAGTGG - Intronic
1179339148 21:40488011-40488033 CTGGTTCAGGAGATCCAGAGAGG + Intronic
1181365806 22:22376220-22376242 ATGCTCCAGGAGATGCAGAGAGG - Intergenic
1182175435 22:28281760-28281782 CCACTTCAGGAGAAACAGTTCGG - Intronic
1183037125 22:35148879-35148901 CCAGTTCAGAAGCAGCAGAGTGG + Intergenic
1183136810 22:35896781-35896803 TGCCTTCAGAAGAAGCAGAGAGG - Intronic
1183365878 22:37406595-37406617 CTAATTGAGCAGATGCAGAGCGG - Intronic
1183510284 22:38230625-38230647 CTAGCTCAGGAGGAGCAGGGCGG - Intronic
1183578620 22:38708682-38708704 CTACTTCAGGAGAAGCAGAGAGG + Intronic
1184982797 22:48106195-48106217 CTACTTCAGGAGATTCACAATGG + Intergenic
951158816 3:19390039-19390061 CTACTTCAGGAGATGTACTGAGG + Intronic
951757580 3:26108424-26108446 CTATTCCAGGAGCAGGAGAGGGG - Intergenic
952208263 3:31202438-31202460 CTACTTTAGTACAAGCAGAGAGG - Intergenic
953033192 3:39191088-39191110 CTACCTCAGAAGGAGGAGAGAGG + Intronic
953197494 3:40748065-40748087 CTCCTTAAAGAGAGGCAGAGGGG - Intergenic
954301536 3:49703153-49703175 TTCACTCAGGAGAAGCAGAGAGG - Intronic
954871713 3:53772353-53772375 ATACTTCAGCAGAAGCAAGGTGG + Intronic
955824125 3:62926871-62926893 CTACCTCAGTAAAATCAGAGAGG + Intergenic
956023903 3:64961804-64961826 CTACTGCAGCAGAATCAGATTGG - Intergenic
956925123 3:73978372-73978394 CTTATTCAGGAAAAACAGAGAGG + Intergenic
958696639 3:97536606-97536628 TTCCTTCTGGAGAGGCAGAGTGG + Intronic
961828597 3:129611863-129611885 CTCCTCCAGAAGAGGCAGAGAGG - Intergenic
963644454 3:147896201-147896223 GTGCTTCAGGAGAGACAGAGGGG - Intergenic
965856370 3:173092914-173092936 CTACTTCAGAAAAAGAAGACAGG - Intronic
966434637 3:179869631-179869653 GTGCTTCAGGGGAGGCAGAGGGG - Intronic
967951246 3:194842528-194842550 CTATTGCAGTAGAAGCAAAGAGG + Intergenic
968195249 3:196701039-196701061 CCACGTCTAGAGAAGCAGAGAGG + Intronic
968262910 3:197339639-197339661 GCACTTCAGGAAAAGCAGAATGG - Intergenic
968845023 4:3036220-3036242 GGACCTCATGAGAAGCAGAGTGG - Intronic
970090701 4:12404284-12404306 CTACTTTAGTTGTAGCAGAGAGG - Intergenic
972994360 4:44861702-44861724 CTACTTGAGGAGGAGCTGCGGGG + Intergenic
973261605 4:48170642-48170664 GTTCTTCAGGAGAAGCAATGAGG + Intronic
976081245 4:81357288-81357310 CCACAACAGGAGAAGCAGGGAGG + Intergenic
977918713 4:102621040-102621062 CTACTTCAGAAGACGCAGATAGG - Intergenic
978017468 4:103763089-103763111 CTATTTCAGAGTAAGCAGAGAGG + Intergenic
978544150 4:109852365-109852387 GTTCTTCAGGAGCAGGAGAGGGG + Intronic
979779016 4:124625802-124625824 CTGCTGCAGGAGATGAAGAGTGG + Intergenic
979789888 4:124765846-124765868 CTACTTTAGGAAAAGCAGAGAGG - Intergenic
980075208 4:128287491-128287513 CTTCTTCATGCGAGGCAGAGAGG + Exonic
982190581 4:152850849-152850871 ATAATTGTGGAGAAGCAGAGAGG + Intronic
984871162 4:184326420-184326442 CTACTTAAGGAGAAGAGAAGTGG - Intergenic
988392755 5:30657305-30657327 CTACTTGATGAGAAGCAGTGGGG + Intergenic
989114127 5:37935483-37935505 CTACTTCAGAAGAACCACTGGGG - Intergenic
989952361 5:50314942-50314964 CTACTTCTGAAGAAGCGTAGTGG - Intergenic
992238224 5:74734889-74734911 CTACTTTAGGAGAAAAAGTGTGG - Intronic
992664565 5:78994445-78994467 ATCCCTCAGGTGAAGCAGAGTGG - Intergenic
993635210 5:90334649-90334671 GTACTTCTGGAGAAGCCAAGGGG + Intergenic
996484115 5:124011210-124011232 CTCTTTCAGGAGATGCAGACAGG - Intergenic
996522416 5:124441901-124441923 GTGCTTCTGGAGGAGCAGAGGGG - Intergenic
996812351 5:127531339-127531361 CTACTACAAGGGAAGCAAAGTGG - Intronic
997340282 5:133139587-133139609 TGACTTCAGTAAAAGCAGAGAGG - Intergenic
997645147 5:135477035-135477057 CTTATTCAAGAGAAGGAGAGAGG - Intergenic
997702123 5:135909914-135909936 CTACTTCATAAGAAGCAGATTGG + Intergenic
998374830 5:141683270-141683292 CTGCCTCAGGGGAAGAAGAGGGG + Intergenic
998862392 5:146457463-146457485 AGACTTCAGGAGAAGCTGACTGG + Intronic
1000498796 5:162021468-162021490 CTACTTGAAGAGGAGAAGAGAGG + Intergenic
1007704737 6:43783788-43783810 CTACTCCAGCTGAAGCAAAGGGG - Intronic
1008355715 6:50550524-50550546 CAATTTCAGGAGAAGAAGTGAGG - Intergenic
1010790688 6:80061424-80061446 CAACTTTAGGAGAATCAAAGGGG - Intergenic
1012086727 6:94836169-94836191 TTATTTCAGGAGTTGCAGAGAGG - Intergenic
1012964402 6:105657689-105657711 CCACAGCAGGAGCAGCAGAGGGG - Intergenic
1013355376 6:109341609-109341631 GAACTTCAGGAGAAACAGAAAGG + Intergenic
1014322098 6:119942758-119942780 CTTGTTCTGGAGAAGCATAGAGG - Intergenic
1014422985 6:121267773-121267795 CCACTTGAGGAGGAGGAGAGAGG - Intronic
1015065467 6:129020790-129020812 GTGCTTGAGGAGAGGCAGAGGGG + Intronic
1015322393 6:131890777-131890799 CTCCTTTAAGAGAAGCAGAAAGG - Exonic
1015525744 6:134174683-134174705 CTGCTCCAGGAGACGCAAAGTGG - Intronic
1016935596 6:149447132-149447154 CTTTTCCAGGAGAAGCAGTGAGG - Intergenic
1017016934 6:150108658-150108680 CTACCTCATGAGAAGCATTGTGG + Intergenic
1018380032 6:163250408-163250430 CTAATTCTGCAGAAGCAGTGTGG - Intronic
1019294541 7:266902-266924 TTACTTCAGGACAAGCTGCGAGG - Intergenic
1019784206 7:2963957-2963979 CTTCTTCAGGCCAAGCACAGTGG - Intronic
1020397816 7:7736979-7737001 CAGCTTCTGGAGAAGCAGTGGGG - Intronic
1023124007 7:36936944-36936966 CTAATTGAGGTGAAGCAGTGTGG - Intronic
1023859151 7:44206771-44206793 CTCCTTGAGCAGAAGCACAGGGG - Intronic
1024215418 7:47244328-47244350 CTCATTCTGGAGAAGCTGAGAGG + Intergenic
1026111976 7:67465586-67465608 CCTCTTAAGGAGTAGCAGAGGGG - Intergenic
1026569981 7:71520929-71520951 CTACTACAGGTGAATCAGAAGGG - Intronic
1026843577 7:73684411-73684433 CAACTACTGGAGAGGCAGAGGGG - Intronic
1027186084 7:75971674-75971696 CCAGTGCAGGGGAAGCAGAGGGG + Intronic
1028894076 7:96021335-96021357 CTACTTCCTGAGAGGCAGGGAGG - Intronic
1029290411 7:99498345-99498367 CTACCTCTGGAGAAGGATAGAGG + Intronic
1030121707 7:106116468-106116490 CTAATTCAGGAGAAGGAGTCAGG - Intergenic
1030772001 7:113486671-113486693 CTATTTCAGCAGATGTAGAGAGG + Intergenic
1030842885 7:114377967-114377989 CTACTTAAGGAGAGGGAGAGAGG - Intronic
1032560394 7:132884888-132884910 CTCCTTCAGGAGAGGTAGATAGG - Intronic
1033432393 7:141300948-141300970 CTTATTCAGGAGAGGCAGACAGG - Intronic
1035739300 8:1914179-1914201 CTACTTCAGGAGGATCAGTCAGG - Intronic
1036394759 8:8360160-8360182 CTACTTCTGAAGAAGAATAGAGG - Intronic
1037054818 8:14426459-14426481 CCACTAGAGAAGAAGCAGAGAGG + Intronic
1037667832 8:20985877-20985899 ATACTACAGGAGAGGCAAAGCGG + Intergenic
1038873394 8:31520671-31520693 CTTCTTCAGGTGGAGGAGAGTGG - Intergenic
1042701240 8:71617292-71617314 TTACTTCAGGAGGGGCATAGAGG + Intergenic
1047097527 8:121640529-121640551 CATCTTCCGGAGCAGCAGAGGGG - Intronic
1047573133 8:126122761-126122783 CTGCTTCTGGAGAAGTGGAGGGG + Intergenic
1048572064 8:135664651-135664673 CTGCCTCAGGAGAGGAAGAGGGG - Intergenic
1048588873 8:135802570-135802592 AAACTTCAGGAGAAAGAGAGGGG + Intergenic
1051494273 9:17701368-17701390 CTGCTTCAGGAGGAGTAGTGAGG + Intronic
1053040673 9:34868151-34868173 CTACTTCTGGGGAAGCAGAGTGG + Intergenic
1055826866 9:80338115-80338137 CTAATTCAAGTAAAGCAGAGTGG + Intergenic
1056266558 9:84902413-84902435 ACACTTCAGGAGAAGGAGAGGGG + Intronic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1060540718 9:124428482-124428504 CTTCTTGGGGAGAAGCAAAGAGG + Intergenic
1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG + Intronic
1185597934 X:1319396-1319418 CTACTTCAGGAGACTGAGAGAGG - Intergenic
1186510944 X:10129386-10129408 CTGCTTCACGTGAAGCAGAAAGG - Intronic
1186748955 X:12601850-12601872 CAACTTCAGGAGAAGCAGCTTGG - Intronic
1187487486 X:19718460-19718482 ATACTTCAGGGGAGGCAGATTGG + Intronic
1187701855 X:21970431-21970453 CTCCTTCACCAGCAGCAGAGAGG - Intronic
1189280391 X:39816839-39816861 CTCCTCCAAGAGAAGCAGAGCGG - Intergenic
1194289684 X:92055063-92055085 CTATTCCAGGAAAGGCAGAGTGG + Intronic
1194474144 X:94336759-94336781 CTTCTTCAGGAGAATCATTGAGG - Intergenic
1195025660 X:100874552-100874574 TTACTTCAGGAGAAGTAGGGAGG + Intergenic
1196199765 X:112872247-112872269 CAACATCAGTAGAAGCAGATAGG + Intergenic
1197172366 X:123448530-123448552 CAGCTTAAGGAAAAGCAGAGAGG - Intronic
1197264059 X:124347313-124347335 CTACATCAGCAGATCCAGAGAGG - Intronic
1197756810 X:130001509-130001531 ATACTTGAGGACAACCAGAGAGG + Intronic
1197962475 X:132022448-132022470 CTACTCCAGGAGAGGGAGACAGG - Intergenic
1199068443 X:143447745-143447767 CTACTTTAGTTGAAACAGAGAGG - Intergenic
1199314759 X:146363717-146363739 TCACTTGAGGAGAAGAAGAGAGG - Intergenic
1200607197 Y:5279639-5279661 CTATTCCAGGAAAGGCAGAGTGG + Intronic