ID: 1183582420

View in Genome Browser
Species Human (GRCh38)
Location 22:38733847-38733869
Sequence TTGAATGTACAGATGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183582412_1183582420 17 Left 1183582412 22:38733807-38733829 CCGGCAGTGTGAGGGCTGTGCTG 0: 1
1: 0
2: 5
3: 39
4: 328
Right 1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG 0: 1
1: 0
2: 3
3: 25
4: 196
1183582410_1183582420 25 Left 1183582410 22:38733799-38733821 CCATGGAGCCGGCAGTGTGAGGG No data
Right 1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG 0: 1
1: 0
2: 3
3: 25
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183582420 Original CRISPR TTGAATGTACAGATGGGCAG AGG Intronic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
901464190 1:9410468-9410490 TTGAATGTGGAGTTGGGAAGAGG + Intergenic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
903907841 1:26697975-26697997 TTGAAAGCACAGATGGGGGGCGG - Intronic
907569787 1:55472668-55472690 TAAAATGGTCAGATGGGCAGGGG - Intergenic
908750681 1:67420048-67420070 ATGAAGGTGCTGATGGGCAGTGG - Exonic
908847824 1:68342882-68342904 ATGAAGGTGCAGATGGGGAGTGG + Intergenic
909736284 1:78966613-78966635 TGGAATGGACAGATGAGCAGGGG + Intronic
910165134 1:84319680-84319702 TAGAATGTACAGATAGAAAGAGG + Intronic
911803747 1:102178452-102178474 TGGAATTTACAGATAAGCAGAGG - Intergenic
912424089 1:109571050-109571072 TTTAATATACAGATTGGCACTGG + Intronic
912658072 1:111505392-111505414 TAGAATTCCCAGATGGGCAGAGG - Intronic
913098617 1:115542609-115542631 TGGAATGGACAGAAGGGTAGGGG + Intergenic
913109986 1:115648960-115648982 TTGAATCTGCAGATCAGCAGAGG + Intronic
915085643 1:153386828-153386850 TTGAGTGCACAGTTGGGCAGGGG - Intergenic
916861174 1:168807016-168807038 TTGAAAGTACAGAGGGTCAGTGG - Intergenic
919007334 1:191914006-191914028 TTGCAAGTACAGATAGGAAGAGG + Intergenic
919677963 1:200405601-200405623 TTGAAGCTACTGATTGGCAGTGG - Exonic
920175069 1:204095585-204095607 TTTAATCTGCAGATGGACAGAGG - Intronic
922665016 1:227461128-227461150 TAGAAAGTAGAGAAGGGCAGGGG + Intergenic
923880941 1:238103642-238103664 CTGAATTTACAGATGTGAAGGGG + Intergenic
1062921745 10:1285458-1285480 ATGAATGCACAAATGGGCACCGG + Intronic
1063661703 10:8038641-8038663 TTGAATGTTCATCTGGGCATGGG + Intergenic
1067656978 10:48201251-48201273 TTTAATGCACAGATGGGCTCTGG - Exonic
1068076257 10:52258918-52258940 TTAAATGAACAGATGGGGAAAGG + Intronic
1068653468 10:59549823-59549845 ATGAATGATCTGATGGGCAGGGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069302170 10:66921600-66921622 TTAAATGTATATATGGGGAGTGG - Intronic
1069500378 10:68947691-68947713 ATGTATGTACAGGTGGGAAGAGG + Intergenic
1069914050 10:71776293-71776315 AAGAATGGACAGATGGGCAGGGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075223625 10:120605314-120605336 TTTAATGTACAGCTGGGCACTGG + Intergenic
1076623125 10:131805817-131805839 GGGAACGTACAGATGGGCACAGG + Intergenic
1077419368 11:2443421-2443443 GTGAAGGTGCAGAAGGGCAGCGG - Intergenic
1078362878 11:10683111-10683133 TTTAATAAACAGATTGGCAGTGG + Intronic
1079826809 11:25206361-25206383 ATGAATGTACAGATAGGCATAGG + Intergenic
1080831423 11:35896573-35896595 TTGAATGTATATATGAGGAGGGG + Intergenic
1081020856 11:37946894-37946916 CTTCATGTACAGAGGGGCAGGGG + Intergenic
1081074650 11:38655641-38655663 TTAACTGTACAGAAGGGCAGTGG - Intergenic
1082013996 11:47470767-47470789 GGGAATGTACACCTGGGCAGAGG - Exonic
1083959688 11:66007671-66007693 TTGAACCTTCAGTTGGGCAGAGG - Intergenic
1085831384 11:79904960-79904982 CTGAATTTAGAGATGGGGAGAGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088738121 11:112745423-112745445 AGGAATTTACTGATGGGCAGCGG + Intergenic
1088983581 11:114886345-114886367 TTGTGTGTAAAGATGGACAGAGG - Intergenic
1091706665 12:2698266-2698288 TTGAAAGGACAGAAGGGAAGAGG + Intergenic
1091842397 12:3630437-3630459 TTCTCTGTACAGATGTGCAGTGG + Intronic
1092516015 12:9213654-9213676 TTGAATTAAAAGATGGGCAAAGG - Intergenic
1095304688 12:40625825-40625847 TCTAATGAACAGATTGGCAGTGG - Intergenic
1096784650 12:54010022-54010044 TTGACTTTAGAGATGGGGAGTGG - Intronic
1097242278 12:57583690-57583712 TGGCATATACAGATGGGAAGAGG - Intronic
1097261339 12:57721936-57721958 TTGAAAGGACAGGTGGGTAGGGG - Intergenic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1099776276 12:87135525-87135547 TTGAATGAAAAGTTGGTCAGTGG + Intergenic
1101097114 12:101353962-101353984 TTGAATGCACAGTTAGGCTGGGG + Intronic
1101752688 12:107595623-107595645 TTGATAGCACAGAGGGGCAGTGG + Intronic
1104220548 12:126780441-126780463 TTGAATGTACAGAGGTGCCTTGG + Intergenic
1105061143 12:133152044-133152066 TGGAATGTAAAGACTGGCAGTGG - Intronic
1105238116 13:18580520-18580542 TTCAAAGTACAGATGTGCTGAGG - Intergenic
1106048070 13:26164096-26164118 TTGAATATACAGGTTGACAGTGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1108736842 13:53293148-53293170 TTGAAGGTACAGAGAGGCTGAGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112978554 13:105352323-105352345 TTGTATTTACAAATAGGCAGTGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1119466449 14:74862608-74862630 TAGACTTTCCAGATGGGCAGAGG + Intronic
1121751338 14:96359900-96359922 TTTAATATACAAATGGGCACTGG + Intronic
1122011436 14:98752480-98752502 TTGAAAGCACCGATGGGCACAGG + Intergenic
1122127368 14:99586559-99586581 GTAAATGTGCAGATGGGAAGCGG - Intronic
1122857596 14:104567309-104567331 CTGGGGGTACAGATGGGCAGGGG + Intronic
1125036463 15:35130238-35130260 TTTAATGTAAAGATGAGCTGAGG - Intergenic
1125983404 15:44025264-44025286 TGGAATGTAGACATGGGAAGAGG + Intronic
1127301126 15:57654927-57654949 TTAAATGTGCAGATTGGCAAGGG + Intronic
1127686817 15:61354009-61354031 ATGAAGTTACAGATGGGAAGAGG + Intergenic
1129181895 15:73882926-73882948 TTGAATGCAAACAAGGGCAGAGG + Intronic
1129557921 15:76532709-76532731 TAGCATGCACAGATAGGCAGAGG + Intronic
1129622487 15:77161018-77161040 TTATATGTACACATGTGCAGCGG - Intronic
1130146315 15:81276441-81276463 TTGAATGCCCACATGGGCAGAGG + Intronic
1133575612 16:7086358-7086380 TACAATGTACAGAAGGGGAGAGG - Intronic
1134420797 16:14086984-14087006 TTGATTGGAAAGTTGGGCAGAGG + Intronic
1135856807 16:26019194-26019216 ATGAATGTCCAGGGGGGCAGTGG + Intronic
1138173927 16:54878625-54878647 TTGACTGTAGATATGGGAAGTGG - Intergenic
1138505529 16:57476521-57476543 GGGGATGTACAGGTGGGCAGGGG - Intronic
1138648171 16:58440214-58440236 TTTCATGTCCAGATGGGGAGTGG + Intergenic
1139364141 16:66423317-66423339 TTGAATGGATAGATGAGGAGTGG + Intergenic
1144703368 17:17352511-17352533 TCCAATGAACAGATGGGCTGGGG + Intergenic
1145019345 17:19417364-19417386 TGGAATGCACAGATGGGAAGAGG + Intergenic
1146428023 17:32762428-32762450 GTGAAAGTACAAATGGGGAGAGG - Intronic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1149496181 17:57119180-57119202 TTGGATGTCCTGATTGGCAGTGG + Intronic
1152051766 17:77984643-77984665 TTGAGGGTACAGGTGGGCTGAGG - Intergenic
1152212654 17:79010519-79010541 CTGAAGGTGCAGATGGGCAGGGG - Intergenic
1152463220 17:80452015-80452037 TTGGAGGTACAGACTGGCAGAGG - Intergenic
1152963125 18:92342-92364 TTAAATGTAAAGATTGGCCGGGG + Intergenic
1157366984 18:47074255-47074277 TTGAATGTACCCACGAGCAGTGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158401110 18:57122234-57122256 TTGATTGCAGAGATGGGCAGTGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1162784446 19:13025418-13025440 TGGAAAGTACTGATGGGGAGCGG + Exonic
1163166303 19:15500364-15500386 TTTTTTGTAGAGATGGGCAGGGG - Intergenic
925239303 2:2309020-2309042 TAGAATGTACTGAAGGACAGGGG - Intronic
925667922 2:6281511-6281533 GTGAATGTAGAGATGGGGAAGGG - Intergenic
925723696 2:6852914-6852936 TTGAAAGTACAAATGAGGAGGGG - Intronic
927011294 2:18907349-18907371 TTGAATGTGTAGATGAACAGGGG + Intergenic
929343178 2:40847916-40847938 TTGACTGGACACAAGGGCAGTGG - Intergenic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939156653 2:138533016-138533038 TTGATGGTACAGATGGGCAGGGG - Intronic
940006347 2:149012407-149012429 TTGAACATGCAGATGGGAAGAGG + Intronic
948090512 2:235290320-235290342 TTGAATCTACAGATCAGCAGAGG - Intergenic
948921838 2:241069528-241069550 CTGAGTGCACAGGTGGGCAGGGG - Intronic
1169028059 20:2386369-2386391 GTGAGTGTAGAGTTGGGCAGGGG + Intronic
1170698902 20:18685457-18685479 GTGAATGTGCAGGGGGGCAGAGG + Intronic
1171035549 20:21709931-21709953 TGGAAAAAACAGATGGGCAGTGG - Intronic
1172620338 20:36314210-36314232 TTGGATGCATAGATGGGCAGAGG - Intronic
1173386490 20:42593071-42593093 GTGAATGCACAGAAAGGCAGAGG + Intronic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176782099 21:13208797-13208819 TTCAAAGTACAGATGTGCTGAGG - Intergenic
1177202768 21:17976340-17976362 TTGAATGTACAGACAAGGAGTGG + Intronic
1178600702 21:33992097-33992119 TTCCATGTCCAGGTGGGCAGAGG + Intergenic
1179043888 21:37828729-37828751 TTGAGTGAGCAGATGGTCAGAGG - Intronic
1179541138 21:42083873-42083895 CTGGAAGGACAGATGGGCAGAGG + Intronic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1183125507 22:35776518-35776540 TTAAGTGTACAGATGGGGACAGG + Intronic
1183512322 22:38243456-38243478 CTGAAGGAACAGGTGGGCAGAGG + Intronic
1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG + Intronic
1184447226 22:44555902-44555924 GGGAAGGTACAGATGGGCAGAGG + Intergenic
1184631199 22:45781306-45781328 CTGACAGTACAGCTGGGCAGGGG - Intronic
1185076636 22:48686745-48686767 TTGAATGGATAGATGGGTAGGGG + Intronic
949939181 3:9141261-9141283 GTGAATGCACACATGGCCAGAGG - Intronic
950893345 3:16425243-16425265 TTGTATGTACATGTGGGAAGAGG + Intronic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954781401 3:53064538-53064560 ATGAAGGTGCTGATGGGCAGTGG - Intronic
955590191 3:60526629-60526651 TTGAATGTAGGGTGGGGCAGGGG - Intronic
960754350 3:120993864-120993886 TTGAATGTACAGATGGCTTTGGG + Intronic
961382880 3:126507375-126507397 TTGAATGGATGGATAGGCAGAGG + Intronic
962240806 3:133749349-133749371 TGACATGTACAGATGGGCAGGGG - Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
965183865 3:165438078-165438100 ATTAATGTACAGATGTGCATGGG - Intergenic
965608881 3:170524254-170524276 TTGAATGTAAAGCTGGAAAGAGG + Intronic
966227299 3:177611577-177611599 TGGAATGAACAGCTGGGAAGAGG + Intergenic
966349322 3:179013776-179013798 ATTAATGTACATATGGGCATGGG - Intergenic
967393251 3:188978123-188978145 TCCAATTTACAGATGGGAAGAGG + Intronic
967933270 3:194706004-194706026 TGGAATGTGGAGATGGGCAGTGG + Intergenic
969192826 4:5536008-5536030 CTGTAGGTAGAGATGGGCAGAGG - Intergenic
974148255 4:57972721-57972743 TTGAATATACACATGGGCTGTGG + Intergenic
974525849 4:63049379-63049401 ATGCAAGGACAGATGGGCAGTGG - Intergenic
975372703 4:73607058-73607080 TTGAATGTAAAGATAACCAGTGG - Intronic
975812179 4:78181135-78181157 ATGAAGGTGCTGATGGGCAGTGG - Intronic
976169467 4:82288015-82288037 ATGAATGAACAGATGTGAAGCGG - Intergenic
976867712 4:89750570-89750592 TTATATGTGCAGATGTGCAGTGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982231179 4:153209539-153209561 TTGAAGGCACAGGTGGACAGTGG - Intronic
984042945 4:174759513-174759535 TTGAATATAAAGATGAGCACTGG - Intronic
985781375 5:1873670-1873692 TAGAAGGGACAGATGGGGAGAGG - Intergenic
985837191 5:2280239-2280261 ATGAATGGACAGATGGGTGGTGG + Intergenic
986083995 5:4424522-4424544 TTGAAAAAACAGATGTGCAGAGG - Intergenic
989321493 5:40139934-40139956 ATGAATGTACAGATGAGTAGAGG + Intergenic
991522870 5:67519718-67519740 TTGCATTTACAGATAGGCTGTGG + Intergenic
993708842 5:91202071-91202093 TTGACTGTATAGGTGGTCAGTGG + Intergenic
994294874 5:98079108-98079130 ATTAATGAACAGATTGGCAGTGG - Intergenic
995036326 5:107538507-107538529 ATGAATGTACAGACAGGAAGTGG + Intronic
995857103 5:116605044-116605066 GTGAAAGTACAGATGCACAGGGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997093261 5:130881652-130881674 TTTAATGTACATATGTCCAGTGG - Intergenic
997728969 5:136150642-136150664 TGGAAGACACAGATGGGCAGAGG + Intronic
1001736102 5:174003623-174003645 TTTAATGTGAAGATGGACAGAGG + Intronic
1001902841 5:175445340-175445362 TTAAAAGAACAGGTGGGCAGCGG - Intergenic
1008237590 6:49069075-49069097 TTCAATGTACACATGAACAGGGG + Intergenic
1008887139 6:56443969-56443991 TTTAATGGACATATGAGCAGTGG + Intergenic
1009866665 6:69406558-69406580 TTGTATGTACCTATGGGCAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014044530 6:116869869-116869891 TAGAATGTACAGAGGCACAGCGG - Intergenic
1015612521 6:135040097-135040119 TTGCATGTACAGAAAGGAAGGGG + Intronic
1015730425 6:136341307-136341329 TTGACAGTAGAGATGGGCACGGG + Intergenic
1016211898 6:141546954-141546976 TGGAAGGGACAGAAGGGCAGAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017650120 6:156572992-156573014 TTGAATGCAGAGTTGGGAAGGGG + Intergenic
1018345794 6:162898003-162898025 GTGAATGTAGACATGGACAGGGG - Intronic
1018885120 6:167928689-167928711 ATGGATGCACAAATGGGCAGAGG - Intronic
1019499204 7:1355939-1355961 GTGACTGTCCAGCTGGGCAGGGG - Intergenic
1022450058 7:30505638-30505660 TTGAATGAACATAAGGGCATAGG + Intronic
1023109589 7:36795896-36795918 GTGACTTTACAGATGGGCAGGGG + Intergenic
1028689343 7:93634003-93634025 ATGAAGGTATAGATGTGCAGAGG - Intronic
1029331338 7:99858627-99858649 ATGCATGTATAGATGGGCATTGG - Intronic
1031408753 7:121417487-121417509 TTGAATCTACAGATAAGCTGGGG + Intergenic
1034777038 7:153837619-153837641 TTGAATGTATAGAGGGTCACTGG + Intergenic
1036160983 8:6388345-6388367 TTGAGTGTCTAGATGGCCAGAGG - Intergenic
1040884117 8:52240924-52240946 TTGAGTGTACAGCTGATCAGTGG - Intronic
1041243418 8:55868937-55868959 ATGAATGTAAAGGTGGGCAAGGG + Intergenic
1043505954 8:80902903-80902925 TTCAATTTAAAGATGGGCAAAGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046763229 8:118042799-118042821 TTGAATGTATAGGTGGGCAGAGG - Intronic
1048472960 8:134719737-134719759 GTGAATGTGCAGAGGGGAAGAGG + Intergenic
1053391258 9:37738185-37738207 ATGAATGTGGAGATGGGAAGAGG + Intronic
1054856809 9:69909223-69909245 TAGAATGTAGAGATGGGGAGTGG + Intergenic
1057543141 9:95994637-95994659 TGGAGTATACAGATGAGCAGGGG + Intronic
1059008269 9:110428003-110428025 TTGAATCTGCTTATGGGCAGTGG + Intronic
1060778238 9:126392408-126392430 CTGAATGCGCAGAAGGGCAGGGG - Intronic
1062383337 9:136298252-136298274 GTGAATGCACAGAGTGGCAGCGG + Intronic
1062735020 9:138131781-138131803 TTAAATGTAAAGATTGGCCGGGG - Intergenic
1186381742 X:9067938-9067960 TTTAATGTGAAGATGGGCATAGG - Intronic
1187420913 X:19132988-19133010 TTGAGTGTACAGATGGGCAAAGG - Intergenic
1189148353 X:38678540-38678562 TTGAATGTAAACATGGCCTGTGG + Intronic
1189608371 X:42704325-42704347 TTCAATGCATAGAAGGGCAGCGG - Intergenic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1189910289 X:45804376-45804398 ATGGATGGACAGAGGGGCAGGGG - Intergenic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1192160726 X:68784777-68784799 ATGAAGGTGCTGATGGGCAGTGG + Intergenic
1192750896 X:73990054-73990076 TTGAAGGTACAGATAAGCTGGGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193374034 X:80736469-80736491 TTTATAGTTCAGATGGGCAGAGG + Intronic
1195352832 X:104010898-104010920 TTTGATGTGAAGATGGGCAGAGG - Intergenic
1195880498 X:109587882-109587904 TTAAATGTAAAAATGGGCATAGG + Intergenic
1197393601 X:125898451-125898473 TGGAAGGGACAGATGTGCAGGGG + Intergenic
1197690154 X:129490902-129490924 TTTAATGTAAATATGTGCAGGGG - Intronic
1199311450 X:146325618-146325640 CTGAAAGTAGAGGTGGGCAGGGG + Intergenic