ID: 1183583241

View in Genome Browser
Species Human (GRCh38)
Location 22:38737933-38737955
Sequence GCTTCCTGGAAAAGGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183583241_1183583247 3 Left 1183583241 22:38737933-38737955 CCTGGTGTCCTTTTCCAGGAAGC 0: 1
1: 0
2: 4
3: 29
4: 233
Right 1183583247 22:38737959-38737981 CCTCATGCTGCCCTTCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 261
1183583241_1183583244 -1 Left 1183583241 22:38737933-38737955 CCTGGTGTCCTTTTCCAGGAAGC 0: 1
1: 0
2: 4
3: 29
4: 233
Right 1183583244 22:38737955-38737977 CTTCCCTCATGCTGCCCTTCTGG 0: 1
1: 1
2: 1
3: 29
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183583241 Original CRISPR GCTTCCTGGAAAAGGACACC AGG (reversed) Intronic
900102176 1:966573-966595 GCTTTCTGGAGAAGGAGGCCCGG - Exonic
900300600 1:1974920-1974942 GCGGCCTGGAAAGAGACACCTGG + Intronic
902382820 1:16060562-16060584 GCTTCCTGGAAGAGGGGACCTGG + Intronic
902874523 1:19332861-19332883 CCTTCCTGGACAAGGGCAACTGG - Intergenic
902911100 1:19597520-19597542 GCCTTCTGGAGAAGGTCACCTGG + Intronic
903184291 1:21620509-21620531 GCTTCAGGGAAGAGGACACTGGG + Intronic
903193661 1:21669804-21669826 GCTTCCTGGCAGAGGCCACGCGG + Intergenic
904035607 1:27557078-27557100 CCTCCCTGGAACAGGGCACCTGG + Intronic
905015365 1:34774571-34774593 GCTTCCTGGAGGAGGGCAGCTGG + Intronic
905213552 1:36390992-36391014 GCTTGCTGGAAAAGGCTATCAGG - Intergenic
905593710 1:39187571-39187593 GCTTCCTGAGAAAGGATACAAGG + Intronic
905887222 1:41497826-41497848 GCTTCCTGCAAAGGGCCCCCAGG - Intergenic
907858967 1:58332348-58332370 GCTGCCTGAAGAAGGAAACCTGG - Intronic
908162450 1:61423867-61423889 GCTTCTGGGAAAAGGACACAGGG - Intronic
908315436 1:62927833-62927855 GCTCCCTAGGAAAGGACACAAGG - Intergenic
911277684 1:95881301-95881323 GCTTCCTAGACAAGTCCACCTGG + Intergenic
912002775 1:104856073-104856095 GATTCCAGGAAAAGACCACCTGG - Intergenic
912550236 1:110480681-110480703 GCTTCCAGCCACAGGACACCTGG + Intergenic
912553183 1:110497618-110497640 GCTTCCTGGCAAAGGGCAGTGGG + Intergenic
915478051 1:156165410-156165432 GATTCCTGGAAAAGGATACATGG + Intronic
915650007 1:157302806-157302828 GCTTCCTGGAAAAGGCCATCTGG + Intergenic
918521555 1:185420534-185420556 GGTTTCTGGAAAAGGACTGCAGG + Intergenic
918607675 1:186448511-186448533 GCTGTCTGGTAAAGGTCACCAGG - Intronic
920061386 1:203229247-203229269 GCTTCTTGGATAAGGCCAACAGG + Intronic
920092598 1:203465017-203465039 GCCTCCTGGAATGGGACAGCTGG + Intergenic
920277027 1:204814027-204814049 CTTTCCTGGGAAAGGACAACTGG + Intergenic
921959503 1:221020053-221020075 ACTTCTTGGAGAAGGACACCTGG - Intergenic
922115852 1:222613655-222613677 GATGCCAGGAAAAGAACACCAGG - Intergenic
923539505 1:234877894-234877916 GGTGCCGGGAAAAGGACAGCAGG - Intergenic
924268480 1:242306927-242306949 GCTTCCTGGAGAAGGAATCAAGG + Intronic
1063934439 10:11062681-11062703 GGTTTCTGGAGATGGACACCTGG + Intronic
1064392069 10:14950846-14950868 CCTCCCTGGAAAAGCAGACCTGG - Intronic
1064437291 10:15322297-15322319 GCATTCTGGAAAAGAAAACCTGG - Intronic
1064742309 10:18446175-18446197 GCTTCATCCAAAAGGACCCCTGG - Intronic
1067303529 10:45036462-45036484 GCTGCCTGGAAAAGCCCACTGGG + Intergenic
1067458252 10:46439037-46439059 TCTTCCTGGATGATGACACCAGG - Intergenic
1067628946 10:47945597-47945619 TCTTCCTGGATGATGACACCAGG + Intergenic
1069357429 10:67603176-67603198 ACTTCCTGGAAAAGATGACCTGG + Intronic
1069878145 10:71575668-71575690 GCTCCCTGGAGAAGCACAGCAGG + Intronic
1069990991 10:72315989-72316011 GCTTCCTGGGAAAGGAACACAGG - Intergenic
1070228876 10:74542289-74542311 GTTTCCAGGAAAAGGAATCCAGG - Intronic
1070586749 10:77772405-77772427 GCTTCCTGGGAAGGGAACCCAGG - Intergenic
1070669053 10:78365298-78365320 GCTACCTGGAACAGAACACACGG - Intergenic
1071105943 10:82095065-82095087 GCTTCCAGGAAAAGGAGCCAAGG - Intronic
1075388688 10:122076464-122076486 GCCTTCTGGAAAAGGAAAGCCGG - Intronic
1075687401 10:124373906-124373928 GTGTCCTGGAAAAGAAAACCTGG - Intergenic
1075917719 10:126183504-126183526 CCTTCCTGGAAAAGCAGAACAGG + Intronic
1076272521 10:129166493-129166515 GCTTCCTGCACAAGGATGCCAGG + Intergenic
1078714445 11:13826612-13826634 GCTTCCTGGAAAGGACCCCCAGG + Intergenic
1080049507 11:27844899-27844921 GCTTCCTGAAAAAGGACATATGG + Intergenic
1081699537 11:45144428-45144450 GCTTCCTGGCAAAGGAAGCCAGG + Intronic
1081875751 11:46407390-46407412 GCTTCCTGGAAAAGGCCTAATGG + Intronic
1084492558 11:69486700-69486722 CCTTCCTGGAAGATGACCCCTGG - Intergenic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1084969032 11:72759616-72759638 GCTTCCTGGAGGAGGAGACTGGG - Intronic
1085314556 11:75536530-75536552 GCTTCCTGGAGGAGGAGACACGG - Intergenic
1087737462 11:101851219-101851241 CCTCCCTGGAAAATGACACATGG + Intronic
1088888776 11:114028646-114028668 GCTTCCTAGAAAGGGACTCAAGG - Intergenic
1089213364 11:116821014-116821036 GCTTCCTGGAGAAGGACCTGAGG - Exonic
1090199120 11:124841711-124841733 TCTTGCTGGAAAAGGACTCAAGG - Intergenic
1095318502 12:40796405-40796427 GCTTCCTAGAAAAGCAAACTTGG + Intronic
1100550048 12:95638839-95638861 GCTTAATGTAAAAGGACCCCAGG + Intergenic
1100721042 12:97358451-97358473 GCCTCCTGGAAGAGGAACCCAGG + Intergenic
1101082381 12:101201812-101201834 GCTTCCTGGAGATGGGCTCCAGG + Intronic
1101194277 12:102366784-102366806 GCTAGCTGGAAAAGGAAACAAGG - Intergenic
1101237076 12:102800521-102800543 GCTTCCTAGAGCAGGAAACCAGG + Intergenic
1101751092 12:107582876-107582898 GCTTCCTGCAAAAGGAGAGCAGG - Intronic
1102536015 12:113582081-113582103 GCTTCTTGGGAAAGGAAAGCAGG - Intergenic
1104483941 12:129133127-129133149 GCTGCCTGGGAAAGGACAGCAGG - Intronic
1104572021 12:129933965-129933987 GCTTCCTGGAAGAGGAAGCAAGG + Intergenic
1104585345 12:130044283-130044305 GCTTCCTGGAAGAGGAAGCAAGG - Intergenic
1104793117 12:131496432-131496454 GCGTCCTGGCAGAAGACACCAGG - Intergenic
1106763754 13:32893433-32893455 GCATCCTGGAAGAGGAAGCCAGG + Intergenic
1109195967 13:59377653-59377675 TCTCCCTGGAATAGAACACCTGG + Intergenic
1113073334 13:106443848-106443870 GTCTCCTGGAAAAGCACACGGGG - Intergenic
1113615838 13:111680220-111680242 CCTTCCCTGAAAAGGACACAGGG + Intergenic
1113621306 13:111765113-111765135 CCTTCCCTGAAAAGGACACAGGG + Intergenic
1113777621 13:112957281-112957303 GCGTCCTCTAAAAGGAAACCAGG - Intronic
1115912114 14:38268568-38268590 TCTACCTGGAAAAGAGCACCTGG - Intergenic
1121605584 14:95237641-95237663 GCTTCTTGGGAAATGACACCTGG - Intronic
1122280235 14:100617875-100617897 GCTTCCTGGGCAAGAACTCCTGG + Intergenic
1122721173 14:103723461-103723483 GCTTCCTGGACTTGGAAACCAGG - Intronic
1122793907 14:104196174-104196196 GCTTCTTGGGAAAAGAGACCTGG + Intergenic
1127930989 15:63597457-63597479 CCTTCCTAGACAAGGACAGCAGG + Exonic
1128667719 15:69550777-69550799 GCTTCCTGGAAGAGGTATCCTGG + Intergenic
1129481637 15:75831127-75831149 TATTCCTGGAAAAGGATACCAGG - Intergenic
1131183809 15:90258312-90258334 GCCTCCTTGAATAGGACACCTGG + Intronic
1132596180 16:751354-751376 ACTTCCTGGAAGAGGTGACCGGG + Intronic
1132691336 16:1183116-1183138 ACTTCCTGGAAACCGCCACCTGG - Intronic
1133309900 16:4838320-4838342 GCTTGGTGGAAAAGGACCACTGG + Intronic
1137389084 16:48066624-48066646 GCTTCCAGGAAGAGGAGGCCTGG + Intergenic
1138188695 16:54996920-54996942 GCTTCCTGGCAAAGGGAACAAGG + Intergenic
1138798012 16:59993390-59993412 GCCTCCTGGAAACAGACTCCAGG - Intergenic
1139924694 16:70479661-70479683 GCTTCATGGGAAAGGGCAACAGG - Exonic
1139924961 16:70480988-70481010 GCTGCCTGGATGAGCACACCTGG - Exonic
1140454615 16:75097854-75097876 GCTTCCTGGAAAAGCAGAAATGG + Intronic
1140457546 16:75113913-75113935 GCTCCCTGGAAGAGGCCCCCTGG - Intronic
1141832837 16:86519316-86519338 GCTTCCAGCATCAGGACACCTGG + Intergenic
1142065011 16:88057353-88057375 GCTGCCTGCGAAAGGAAACCTGG + Intronic
1142791777 17:2272285-2272307 GCTTCCTGGAAAAGTTAACTGGG - Intronic
1143372744 17:6450423-6450445 GCTTCCTGGAAAAAACCCCCGGG + Exonic
1145968325 17:28937630-28937652 TCTTCCCGGTAAAGGACACCTGG + Intronic
1147304557 17:39554281-39554303 CCTTTCTGGAAACAGACACCTGG + Intronic
1147887046 17:43691177-43691199 GCTTCCTGGAGAAGGAGACCTGG + Intergenic
1149336929 17:55644970-55644992 ACTTCCTGGAATAGCAAACCAGG - Intergenic
1149968190 17:61189226-61189248 GCTTTCTGTAGAAGTACACCTGG + Intronic
1150215637 17:63467400-63467422 GCTTCGTGGAAGAGTACACCAGG - Intergenic
1150439417 17:65179257-65179279 GCTCCCTGGAGAGGGTCACCGGG + Intronic
1151632401 17:75319739-75319761 GCTTCCTGAGAAAGCCCACCTGG - Exonic
1151993285 17:77592196-77592218 GCTGCTTGCAAAAGGACAACAGG - Intergenic
1153766626 18:8380860-8380882 GCTTCCTGGCACAGCTCACCGGG + Intronic
1153972781 18:10241568-10241590 GCTCCCTGGCAGAGCACACCTGG + Intergenic
1157781106 18:50440009-50440031 GGTTCCAGGAAAAGGACTCTGGG - Intergenic
1159473887 18:68892156-68892178 ACTTCCTGGAAAGGGACAGGAGG - Intronic
1160030218 18:75250615-75250637 GCTTCCTGGAAACTGAGCCCGGG + Intronic
1161458835 19:4384313-4384335 GCTTCCTGGCCAAGGCCCCCAGG + Intronic
1161463531 19:4413716-4413738 GCTCCCTGCAAAGGGACAGCAGG - Intronic
1162199544 19:9010514-9010536 CCTTCCTGGCAAAGGTCAGCTGG + Intergenic
1162551855 19:11362347-11362369 GCTCCCTGGAAAAGCCCACTGGG + Intronic
1162936989 19:13986315-13986337 GCTTCCTGGAGACAGCCACCTGG - Intronic
1163083572 19:14962211-14962233 GCTTCCTGGAAAATGTCACTCGG - Exonic
1163260304 19:16185606-16185628 TCTTCCTGGAAAAAGACATGAGG - Exonic
1163729909 19:18942901-18942923 GCTTCCTGGAGGAGGAGACAGGG - Intergenic
1163827358 19:19531062-19531084 GCTTCCTGGAGGAGGAGGCCTGG - Intronic
1165092274 19:33393435-33393457 ACATCCCGGAAAAGGACACCTGG + Intronic
1165844400 19:38808995-38809017 GCTTCCTGGAGGAGGCCCCCAGG - Intronic
1166415877 19:42594731-42594753 ACTTCCTGGGAAAGGACAGGAGG - Intronic
1166479056 19:43154067-43154089 ACTTCCTGTAAGAGGAAACCAGG + Intronic
1166645803 19:44530783-44530805 GCTTCCTGGAAGAGGGGACATGG + Intergenic
1166920299 19:46224680-46224702 GCTTCCTGGAGGAGGGCACCAGG - Intergenic
1167096239 19:47376340-47376362 GCTTCCTGGAGGAGGGAACCTGG + Intronic
1167924023 19:52809112-52809134 TCTTGCTGGAAAAGGACACTTGG + Intronic
1168217904 19:54939829-54939851 GCTTCCTGGAGGAGGACAGGAGG - Exonic
1168224214 19:54982771-54982793 GCTTCCTGGAGGAGGACAGGAGG + Exonic
1168635534 19:57993522-57993544 GCTTCCTGCAAGAGGACTCTGGG + Intronic
925817450 2:7767466-7767488 GCGTCCTCGAACGGGACACCTGG - Intergenic
927092979 2:19726634-19726656 ACATCCTGGGAAAAGACACCTGG + Intergenic
929091154 2:38218500-38218522 GCTCCCTGGGAAAGGCCCCCAGG - Intergenic
930159142 2:48135766-48135788 GCTTCTTGAGAAAGGACACTTGG - Intergenic
930390253 2:50751867-50751889 GTTTTCTGGAATAGGAGACCTGG - Intronic
931078872 2:58746491-58746513 GCTTCCTGGACAACTGCACCTGG - Intergenic
931690474 2:64831223-64831245 GCTTCCTGGAAAACAGCACAAGG - Intergenic
932541048 2:72653027-72653049 GCTTTCTGGAAAATGGCAACAGG - Intronic
932682689 2:73839780-73839802 GCTTTAAGGAAAAGGACACATGG - Intronic
935858959 2:107306320-107306342 CCTTTATGGAAAAGGACACAAGG - Intergenic
935863852 2:107363628-107363650 GCTGCCTGGAAATGGGCACAAGG - Intergenic
936230031 2:110692511-110692533 CCTTACAGGAAAAGGAAACCTGG + Intergenic
937807323 2:126161298-126161320 TCTTCCTGGGACAGGGCACCTGG + Intergenic
939872199 2:147538151-147538173 GCTCCCTGGAATAGGATTCCTGG - Intergenic
942280573 2:174359201-174359223 GCAGCCTGGAAAAGGACAGAAGG + Intronic
946504504 2:220284431-220284453 GCATCCTGTGAAAGGATACCAGG - Intergenic
946978282 2:225177573-225177595 CCATCTTGGAAGAGGACACCAGG - Intergenic
948574534 2:238941193-238941215 GCTTCCTGGAAGAGGAGTCTTGG - Intergenic
948681251 2:239636193-239636215 GCATGCTGGAAAATGACAGCTGG - Intergenic
1169226897 20:3862489-3862511 GCTTCCTTGAACAGGAGACAAGG + Intronic
1169287496 20:4321818-4321840 GCTTCCTGGGAAACGGCATCTGG - Intergenic
1169446991 20:5680518-5680540 GGTTCCTGGGAAGGGACACATGG + Intergenic
1171209080 20:23303181-23303203 ACTCCCTGGAGAAGGACAACAGG - Intergenic
1176909765 21:14550383-14550405 ACTTCCTGGAGCAGGTCACCAGG - Intronic
1177445694 21:21192861-21192883 GTTTCCTGGACCAGAACACCAGG + Intronic
1177558400 21:22719571-22719593 GCTTCCTTGAACTGGTCACCTGG + Intergenic
1178433130 21:32534168-32534190 GCTTTCATGAAAAGGAAACCCGG + Intergenic
1180598144 22:16993242-16993264 GCTTACTGGAAAGTCACACCTGG - Intronic
1181099070 22:20526926-20526948 GCTTCCTGAGAAGGGACTCCTGG + Intronic
1183055386 22:35302002-35302024 GCTTTCTGGAAAAGCTCACCTGG + Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183583241 22:38737933-38737955 GCTTCCTGGAAAAGGACACCAGG - Intronic
950004453 3:9682814-9682836 GCTTCCTGGACAGCCACACCAGG + Intronic
950487603 3:13282472-13282494 GTTCCCTGGAAAAGGGCTCCAGG - Intergenic
951780622 3:26359186-26359208 GTTGCCTGGAAAAGGATACAAGG + Intergenic
952301338 3:32106781-32106803 GCTTCCTGGAAGCGGAGCCCCGG - Intronic
952427321 3:33188737-33188759 GATTATTGGAAAAGGACTCCAGG + Intronic
952943171 3:38458574-38458596 GCTTTCTGGAAAGAGAGACCAGG - Intronic
953048197 3:39314777-39314799 ACTTCCTACAAAAGGACACCTGG - Intergenic
953532845 3:43753656-43753678 GCTTGATGGACAAGGACACAGGG + Intergenic
955917370 3:63920124-63920146 GCTTACTGGAAAGTAACACCTGG + Intronic
956075794 3:65503902-65503924 GCTTCCAGGAAAAGGATACATGG - Intronic
957742615 3:84291442-84291464 ACTTCTTGGAACAGGACACTTGG - Intergenic
959670574 3:108972658-108972680 AGTTCCTGGGAAAGAACACCTGG + Intronic
960875991 3:122295811-122295833 GCTGCCTGGAAAAGAACCCCAGG - Intergenic
961594640 3:128006746-128006768 CCTTCCTTGAAGAGGACGCCAGG + Intergenic
962153671 3:132920714-132920736 ACTGCTTGAAAAAGGACACCAGG - Intergenic
962485872 3:135841697-135841719 GCTTTCTGGAAAAGTACATTTGG - Intergenic
964379811 3:156086920-156086942 GCTTCTAGGAAAAGGACTGCAGG + Intronic
967294078 3:187948548-187948570 GCCTCCTGGATCAGGAGACCTGG - Intergenic
967966855 3:194967750-194967772 TCTTCCTAGAAACGGTCACCTGG - Intergenic
972704085 4:41524133-41524155 GCTTCAAGGAAAAGGACAAGGGG - Intronic
974726453 4:65805320-65805342 GCTTTCTGGGAAAGGACACGTGG + Intergenic
976025485 4:80682931-80682953 GCTTCATGGAAAAAGACCTCAGG - Intronic
976813230 4:89119332-89119354 GATGCCTGGAACAGGACACCAGG - Intergenic
980589677 4:134869315-134869337 AATTACTGGGAAAGGACACCTGG + Intergenic
984288765 4:177766528-177766550 ACTTCCTTGGAAAGGACATCAGG + Intronic
986143939 5:5058905-5058927 GCTGCCTGGAAAATCACTCCAGG - Intergenic
987960977 5:24808381-24808403 GCTGCCTGAAAAAGGAAAACAGG + Intergenic
988021491 5:25627453-25627475 TCTTCCTGGAACAGAGCACCTGG + Intergenic
990343582 5:54849369-54849391 CTTTCCTGGAAAAGGACTCTTGG + Intergenic
990417456 5:55599755-55599777 TCTTCCTTGAAAAGGACGCATGG + Intergenic
994260915 5:97657557-97657579 CTTTCCTGGAAAGGGAAACCAGG + Intergenic
995860881 5:116639254-116639276 GCTTCGAGGCAAAGGAGACCCGG - Intergenic
999520566 5:152346672-152346694 GCTTTCTGGAACAGGACTGCTGG + Intergenic
999537353 5:152531831-152531853 GATGCCTGGAAAAGGATGCCTGG - Intergenic
999760738 5:154699049-154699071 TCTGCCTGGAAAAGGGCCCCTGG + Intergenic
999813309 5:155149694-155149716 GTTCTCTGGGAAAGGACACCAGG + Intergenic
1002160376 5:177311262-177311284 GCTTCCTGGAGCGGGACACCTGG + Intronic
1002574249 5:180162467-180162489 GCTGCCTGTGAAAGGCCACCTGG - Intronic
1004150972 6:13119838-13119860 GATTCCTGGAAAATGACACAGGG - Intronic
1004493992 6:16146060-16146082 GCTTCTGGGGAAAGGACACAGGG - Intronic
1007155938 6:39743777-39743799 GCTTCCAGGAAAAGGGTAGCTGG - Intergenic
1011403374 6:86989189-86989211 GCTTCAGGGAGAAGGACATCTGG - Intronic
1013434780 6:110092164-110092186 GCTTTCTGGATATTGACACCAGG + Intergenic
1015528392 6:134195762-134195784 GCTTCCTGGAAATAGACATATGG - Intronic
1018520406 6:164642866-164642888 GGTTCCTGGAGCAGAACACCAGG - Intergenic
1018994496 6:168700903-168700925 GCATCCAGGAACAGCACACCTGG + Intergenic
1021841629 7:24725992-24726014 GATGGCTGGAAAAGGAGACCAGG + Intronic
1024954016 7:54896793-54896815 ACTTCCTGGGAAAGGATGCCTGG + Intergenic
1026874677 7:73872336-73872358 GATTCCTGGGAAGGGACAGCAGG - Intergenic
1028122528 7:87072235-87072257 TCTTCCAGGCAAAGTACACCTGG + Intergenic
1028774702 7:94663861-94663883 TCTTCATGGAAAAGAGCACCAGG + Exonic
1030041455 7:105454127-105454149 GCTTCCAGGAGAAGGAAAGCGGG - Intronic
1030489263 7:110211575-110211597 ACTTCTTAGAAGAGGACACCTGG - Intergenic
1032013366 7:128360754-128360776 GCTTCCTGGAGGAGAACGCCAGG + Intronic
1033712483 7:143962535-143962557 GCTTCCTATAAAAGGACCCTTGG + Intergenic
1034256242 7:149726047-149726069 GCATCCTGGAAAAGGTGAGCTGG + Exonic
1035842573 8:2828332-2828354 GGTTCATGGAAAATGACACCAGG - Intergenic
1036111173 8:5904674-5904696 GCTTTATGGACAAGGTCACCTGG + Intergenic
1036209170 8:6828253-6828275 GCTTCCTGGAAGAGGAGGACAGG + Intronic
1036386034 8:8282809-8282831 GCTTCCTGGAACAGAAGCCCAGG + Intergenic
1036541370 8:9715435-9715457 GCTGTATGGAAAAGGCCACCTGG + Intronic
1038459177 8:27702258-27702280 GCTTCCTGGAGATGGAGCCCTGG - Intergenic
1038540102 8:28385095-28385117 CCTTTCTAGAAAAGTACACCTGG - Intronic
1039525850 8:38215615-38215637 GCTTCCTGGAAAAGGGTGCATGG + Intergenic
1039841664 8:41297883-41297905 GCTTCCTGGGAAGGGGCATCGGG - Intronic
1041272974 8:56126600-56126622 GCTTCCTGAAAAAGAATACATGG + Intergenic
1042051333 8:64711411-64711433 GCTTCCTGGGAAGGGACAAATGG + Intronic
1042069077 8:64910945-64910967 GTAACCTGGAAAAGGTCACCTGG + Intergenic
1043363707 8:79505884-79505906 GCTCCCTGTGAAAGGACAACAGG + Intergenic
1044035643 8:87299837-87299859 GTTCACTGCAAAAGGACACCTGG - Intronic
1044800865 8:95953767-95953789 GTTTCCTGCAAATGGACAGCTGG + Intergenic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1047073737 8:121376608-121376630 GCTGCCTGCAAAAGGACTCCTGG + Intergenic
1048521590 8:135160368-135160390 GATTCCTAGAAATGGTCACCTGG + Intergenic
1048953875 8:139518044-139518066 GGTTTCTGGAAAAGGATCCCAGG + Intergenic
1049195952 8:141315667-141315689 GTTTCCTGGAGGAGGACACATGG - Intergenic
1049404298 8:142444805-142444827 GCTTCCTGGAAAAGGAGGCCGGG + Intergenic
1049429140 8:142551105-142551127 GCTTCCCGGAAGAGGGGACCTGG + Intergenic
1049478644 8:142809537-142809559 GCTTCCTGGAGAAGGCCAGGTGG + Intergenic
1049781202 8:144429769-144429791 CCTTCCTGGAAAAGGCGGCCTGG + Intronic
1050584337 9:7094685-7094707 GCTTCCTCTGAAAGGTCACCCGG + Intergenic
1056326305 9:85481687-85481709 GTTTCCTGAGAAAGGACACATGG - Intergenic
1057188689 9:93073632-93073654 GCCTCCTGGATTTGGACACCAGG + Intronic
1059177762 9:112182987-112183009 CCTTCCTGGACATGGACACGTGG - Intergenic
1060117005 9:120949848-120949870 GCTTTCTGTAGAAGGACACTGGG - Intergenic
1061137128 9:128741409-128741431 GCTTCCTGGAGAAGGGCAGTGGG - Intronic
1061589113 9:131587531-131587553 GCTTGCTGGAAGTGGCCACCTGG - Intronic
1061929502 9:133825167-133825189 CCTTCATCGACAAGGACACCTGG - Intronic
1186213429 X:7273935-7273957 ACTTCCTGGAAAAGGGGAACAGG + Intronic
1186443914 X:9609468-9609490 GCTTCCTGGAGAAGGTCAAGTGG - Intronic
1187223837 X:17356410-17356432 GCTTCCTGGTAGAGGACAGAGGG + Intergenic
1187701577 X:21968529-21968551 GCTTCCTGGAAATGGAATCTGGG - Intronic
1192966692 X:76184326-76184348 GCTACCTGGAAAAGGCCATCAGG - Intergenic
1194208467 X:91039786-91039808 TCTTCCTGGGACAGAACACCTGG - Intergenic
1195942648 X:110178469-110178491 TCTTCCTGAAAAAGAACACATGG - Intronic
1198332346 X:135633311-135633333 GTTTCCTTGAAAAGCACTCCTGG + Intergenic
1198541457 X:137644372-137644394 GCTTCCTGGTAGAGGACACCAGG + Intergenic
1198820475 X:140642370-140642392 CCTTCATGAAAAATGACACCTGG + Intergenic
1200881328 Y:8215233-8215255 GCTTCCTGGTAGAGGACAACTGG - Intergenic
1201967786 Y:19757037-19757059 GCTTACTGTTAATGGACACCTGG + Intergenic