ID: 1183583743

View in Genome Browser
Species Human (GRCh38)
Location 22:38740273-38740295
Sequence CCGCACGGCCTGGATCTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183583733_1183583743 12 Left 1183583733 22:38740238-38740260 CCAGCAGGGCCCTGGTGGTTCCC 0: 1
1: 0
2: 4
3: 30
4: 260
Right 1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 104
1183583734_1183583743 3 Left 1183583734 22:38740247-38740269 CCCTGGTGGTTCCCACTCACGTC 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 104
1183583735_1183583743 2 Left 1183583735 22:38740248-38740270 CCTGGTGGTTCCCACTCACGTCG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 104
1183583736_1183583743 -8 Left 1183583736 22:38740258-38740280 CCCACTCACGTCGTCCCGCACGG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 104
1183583738_1183583743 -9 Left 1183583738 22:38740259-38740281 CCACTCACGTCGTCCCGCACGGC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183583743 Original CRISPR CCGCACGGCCTGGATCTGCT GGG Exonic
900100819 1:961227-961249 CCGCCCGCCCTGGAGCCGCTGGG - Intronic
903778779 1:25808965-25808987 CCGCTGGGCCTGGATCCGCTGGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906727554 1:48054996-48055018 GGGCAAGGCCTGGATCTGCAGGG + Intergenic
916695775 1:167234656-167234678 CATCACAGCCTGGAACTGCTGGG - Intronic
917116812 1:171611628-171611650 CCCCACTGCCTGGACCTGCAGGG + Intergenic
920858225 1:209681494-209681516 TCGGACTGCCTGGATTTGCTTGG + Intergenic
1067051972 10:43026788-43026810 CCCCACCGCCTGGGTCTGCCAGG + Intergenic
1070663112 10:78321877-78321899 CCCCAAGGGCTGGGTCTGCTTGG - Intergenic
1072200216 10:93151157-93151179 GCGCTCTGCCTGGACCTGCTCGG - Intergenic
1073336672 10:102714873-102714895 CCGCTCGGCCTGGCACTCCTAGG - Intronic
1076716352 10:132366188-132366210 GCCCACAGCCTGGATCAGCTGGG - Intronic
1077432269 11:2521798-2521820 CCACCCGGACTGGATTTGCTTGG + Intronic
1077495936 11:2886396-2886418 CCGCGCGGCCTGCTGCTGCTGGG + Intergenic
1077633717 11:3827680-3827702 GCGCACAGCGTGGATCTGCTTGG + Exonic
1077695362 11:4388357-4388379 CTGTAGGGCCTGGCTCTGCTGGG + Exonic
1081646186 11:44792345-44792367 ACGCACGGCCTGGAGCAGCCAGG + Intronic
1083988606 11:66233015-66233037 CAGCACGGCCTGGACCTCCACGG - Exonic
1085626719 11:78079549-78079571 CTGCGCGGCCGGGATCGGCTGGG - Intronic
1086261807 11:84948910-84948932 CTGCATGGCAGGGATCTGCTAGG - Intronic
1090227944 11:125082816-125082838 CCCCTGTGCCTGGATCTGCTGGG + Intronic
1095943332 12:47740104-47740126 CTGCCCGGCCTGGCTCTGCTAGG - Intronic
1101948607 12:109157044-109157066 CCCCACGTCCTGGACTTGCTGGG - Intronic
1106814692 13:33394512-33394534 TCTCTCTGCCTGGATCTGCTAGG + Intergenic
1110609756 13:77475471-77475493 GCGCACGGCCTGGGACTGATAGG - Intergenic
1112312202 13:98328786-98328808 ACGGACAGCCTGGATCTGCTGGG + Intronic
1114477472 14:23007067-23007089 CCGCACGGGCTGACTCAGCTAGG + Intronic
1114529649 14:23387909-23387931 CCACTCGGCCAGGATCTGCCCGG + Exonic
1114535014 14:23417304-23417326 CCACTCGGCCAGGATCTGCCCGG + Exonic
1114568491 14:23649401-23649423 CCGCAAGGCTTGGCTCAGCTTGG - Intergenic
1114690216 14:24574179-24574201 TCGCACTGCCTGGCTCTGCACGG + Intronic
1117361810 14:54982642-54982664 CCGCAGGGTCTGGATCTAATTGG + Intronic
1120304012 14:82745156-82745178 CAGAACTGCCTGTATCTGCTGGG + Intergenic
1125717057 15:41825354-41825376 CAGCAGGGCCTGTGTCTGCTCGG - Exonic
1130682611 15:86009889-86009911 CCACACAGCCTGGCCCTGCTTGG + Intergenic
1132588450 16:716118-716140 CCACACAGCCTGGGACTGCTGGG + Intronic
1133741625 16:8656154-8656176 CACCACGGCCTCGAACTGCTTGG + Intergenic
1135382723 16:22008087-22008109 CCGCCCGCCCCGGAACTGCTCGG - Intronic
1136066906 16:27765464-27765486 CCGCATGGCCTGGATATCCCAGG - Intronic
1136104365 16:28018958-28018980 CCCCACTGCCATGATCTGCTCGG + Intronic
1137582139 16:49639933-49639955 CTGCCCGGGCTGGCTCTGCTCGG - Intronic
1137595725 16:49722235-49722257 CCGGCCAGCCTGGGTCTGCTTGG - Intronic
1138280102 16:55766594-55766616 CCACATGGCATGGATCTTCTTGG + Intergenic
1138452550 16:57102360-57102382 CCCCACTGCCAGGATATGCTGGG + Intronic
1141144813 16:81521596-81521618 CCGCACAGACTCGACCTGCTAGG - Intronic
1142246592 16:88973052-88973074 CCGCAGGCCCTGTGTCTGCTGGG - Intronic
1143492552 17:7292856-7292878 CTGCCCGGCCTGGCTCTCCTGGG - Intronic
1144519103 17:15942620-15942642 CTGCACGCCCTGCAGCTGCTGGG - Intergenic
1145262650 17:21364086-21364108 CAGCAAGGCCTGCATCTGCAGGG - Intergenic
1145969651 17:28949669-28949691 CTGCCCGGCCGGGATCTCCTCGG - Intronic
1147175249 17:38651871-38651893 CCACACAGCCTGGAACTGCTGGG - Intergenic
1148481022 17:47959434-47959456 CCGCTTGGCCTGGCTCTCCTAGG + Intergenic
1148779992 17:50115959-50115981 TCGCAGGGCTTGGAGCTGCTGGG - Intronic
1151460242 17:74249967-74249989 CCCCGCGACCTGGATCTGCATGG - Exonic
1152258703 17:79255043-79255065 CCCCAGGGCCTGTATCTGCTTGG + Intronic
1152917958 17:83051746-83051768 CTGCATGGCCTGGCTCTCCTCGG + Exonic
1152924052 17:83079567-83079589 CCGCCCGGCCGGGCTCAGCTGGG - Intergenic
1153820967 18:8831168-8831190 CTACAGGGCCTGGATCTACTGGG - Intronic
1154172187 18:12060425-12060447 GCCCACGGCCGGGATCTGGTTGG + Intergenic
1154502738 18:15004701-15004723 CCCCACGGCCAGGGTGTGCTGGG - Intergenic
1161590667 19:5127819-5127841 CCCCAGGCCCTGGTTCTGCTCGG - Intronic
1161964689 19:7541517-7541539 ACGCAGGGGCTGGATCTCCTGGG - Exonic
1163304911 19:16471898-16471920 CCGCCCGGCCCGTACCTGCTGGG + Exonic
1163635612 19:18435941-18435963 CCGCAGGGCCTGCAGCTGCTGGG - Intronic
1163711716 19:18851064-18851086 CCCCAAGGCCAGGATCTTCTCGG - Intronic
1166225445 19:41392234-41392256 CCCCACTGACTGGACCTGCTAGG - Intronic
1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG + Exonic
1167979295 19:53259489-53259511 CTGCAGAGCCTGGATCTGCTGGG - Exonic
925057994 2:870182-870204 GTGCACAGCATGGATCTGCTGGG + Intergenic
927183705 2:20467285-20467307 CTGCACCACCAGGATCTGCTGGG - Intergenic
935155791 2:100482500-100482522 CCAGACAGCCTGCATCTGCTAGG - Intronic
938501905 2:131834869-131834891 CCCCACGGCCAGGGTGTGCTGGG - Intergenic
942376658 2:175344289-175344311 CCGCTTGGCCAGGATCTACTGGG - Intergenic
946904565 2:224403810-224403832 CAGCACAGCCTGGAACTCCTGGG - Intergenic
1172935491 20:38617135-38617157 CAGCTCAGCCTGGACCTGCTGGG - Intronic
1175210138 20:57348783-57348805 GCGCACGGCCTGGGACTGGTGGG + Intergenic
1175607067 20:60319711-60319733 CCACACAGCCTGGATCTGAAAGG - Intergenic
1180151231 21:45949088-45949110 AGGCACGGCCTGGACGTGCTGGG + Intergenic
1183335125 22:37241967-37241989 CGGCATTGCCTGGGTCTGCTGGG - Intronic
1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG + Exonic
955202242 3:56861671-56861693 CGGAAAGGCCTGGATCTGCTGGG + Intronic
956585833 3:70863630-70863652 CATCACAGCCTGGATCTCCTGGG - Intergenic
962603097 3:137010202-137010224 CCTCAGGGCCTGGATCTCATAGG + Exonic
963288467 3:143462295-143462317 CCCCACAGCCTTGATCTGCTGGG - Intronic
968549194 4:1213718-1213740 CCCCACGGCCCTGCTCTGCTCGG + Intronic
969321463 4:6415506-6415528 CCCCTCGGCCTGGATCAGCGTGG - Intronic
972126242 4:35769916-35769938 CCGCCCGGCCTGAATTTTCTAGG + Intergenic
985592702 5:773783-773805 CCCCAGGGCCAGGACCTGCTTGG + Intergenic
985686741 5:1285356-1285378 CATCTCGGCCTGGACCTGCTGGG - Intronic
989467121 5:41769651-41769673 CAGCATGGCCTTGATTTGCTGGG - Intronic
996698376 5:126423459-126423481 CGGCCCGGCCTGGATGCGCTGGG + Intronic
1002456605 5:179348794-179348816 CCTCACTGCCTCCATCTGCTTGG - Intergenic
1005913331 6:30329589-30329611 CTTGACGGCCTGGAGCTGCTTGG - Exonic
1011418482 6:87147784-87147806 CACTACAGCCTGGATCTGCTAGG - Intergenic
1011698295 6:89932753-89932775 ATGCAGGGCCTGGATCTGCTCGG + Exonic
1023385127 7:39648982-39649004 CAGCACAGCCTTGATCTCCTGGG - Intronic
1026001029 7:66558818-66558840 ACGCCAGGCCTGGATCTTCTGGG + Intergenic
1026319559 7:69256975-69256997 ACGCAGGGCTTGCATCTGCTTGG + Intergenic
1026840899 7:73669474-73669496 CCGCAGGGCCAGGTTCTCCTTGG - Exonic
1027735359 7:81925654-81925676 CCACACAGCCTTGACCTGCTGGG - Intergenic
1035131342 7:156656866-156656888 CCGCAGGGCCTGGCGCTGGTGGG + Intronic
1036224356 8:6945288-6945310 CCACACACCCTGGGTCTGCTGGG - Intergenic
1037628963 8:20635075-20635097 TCCCATGGCCTGGATCTGTTAGG + Intergenic
1039475150 8:37835699-37835721 CCTCCCGCCCTGGAGCTGCTGGG + Exonic
1042903071 8:73747109-73747131 CCGCAGAGCCTGCAGCTGCTGGG - Intronic
1048987891 8:139745072-139745094 CTGCATGGCCAGGACCTGCTGGG + Intronic
1049479765 8:142816329-142816351 TCTCACGGCCAGGCTCTGCTCGG - Intergenic
1052127802 9:24799500-24799522 CACCACAGCCTGGATATGCTGGG - Intergenic
1055350130 9:75378180-75378202 CCGCCTGGCCTGGGTGTGCTGGG + Intergenic
1056754315 9:89372625-89372647 CGGCAGGGCCTGGAGCAGCTGGG - Intronic
1058958146 9:109968285-109968307 GTGGAAGGCCTGGATCTGCTGGG + Intronic
1060923427 9:127438608-127438630 CCGCACGGACAGGCTCTGCCAGG - Intronic
1061620772 9:131809976-131809998 TCGCACCGCCTGGCTCTGCCTGG - Intergenic
1062425231 9:136503183-136503205 CTGCACGGCCTCGATCTTGTAGG + Exonic
1062497542 9:136838799-136838821 CCCCACGGCCAGGGTGTGCTGGG + Intronic
1200929905 Y:8687636-8687658 CCTCACTGCATGGCTCTGCTTGG - Intergenic