ID: 1183584656

View in Genome Browser
Species Human (GRCh38)
Location 22:38745936-38745958
Sequence CAGAGGCATCAGAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 329}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183584643_1183584656 24 Left 1183584643 22:38745889-38745911 CCCTGCCAGTGCTTGTGGCCTGT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 329
1183584644_1183584656 23 Left 1183584644 22:38745890-38745912 CCTGCCAGTGCTTGTGGCCTGTC 0: 1
1: 0
2: 2
3: 13
4: 183
Right 1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 329
1183584647_1183584656 6 Left 1183584647 22:38745907-38745929 CCTGTCCCACTCGTGGAGCTGTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 329
1183584648_1183584656 1 Left 1183584648 22:38745912-38745934 CCCACTCGTGGAGCTGTGCCCTT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 329
1183584649_1183584656 0 Left 1183584649 22:38745913-38745935 CCACTCGTGGAGCTGTGCCCTTC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 329
1183584641_1183584656 30 Left 1183584641 22:38745883-38745905 CCTGATCCCTGCCAGTGCTTGTG 0: 1
1: 0
2: 0
3: 26
4: 268
Right 1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 329
1183584645_1183584656 19 Left 1183584645 22:38745894-38745916 CCAGTGCTTGTGGCCTGTCCCAC 0: 1
1: 0
2: 1
3: 14
4: 167
Right 1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183584656 Original CRISPR CAGAGGCATCAGAGGGATGC AGG Intronic
900336360 1:2165936-2165958 CAGTGGCCGCAGGGGGATGCTGG - Intronic
900479402 1:2890833-2890855 CAGAGCCTTCAGAGGGAGCCTGG - Intergenic
900482592 1:2906404-2906426 CAGAGGCCCCTGAGGGATGCTGG - Intergenic
900946786 1:5835266-5835288 CTTAGGCATTAGAGGGCTGCTGG + Intergenic
901847468 1:11992634-11992656 GAGAGGCATCAGTGAGGTGCTGG + Exonic
902123179 1:14185088-14185110 CTGAGACATCAGAAGGATCCTGG + Intergenic
902181465 1:14692399-14692421 GAGAGCCATCAGAGGTTTGCAGG - Intronic
902683083 1:18057556-18057578 CAGAGGCATCTTAGCGAGGCTGG - Intergenic
904456336 1:30650403-30650425 GAGAGGCATCAGATGGAGCCAGG - Intergenic
904603104 1:31684294-31684316 CAGAGTGTTCAGAGGGGTGCAGG - Intronic
904745646 1:32709099-32709121 GAGAGGCACCAGAGGGCAGCAGG + Intergenic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
911011880 1:93289137-93289159 CAGAGGCAACTGAGGGTTTCTGG - Intergenic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
913216793 1:116627634-116627656 ACCAGGCAGCAGAGGGATGCGGG + Intronic
915294309 1:154909389-154909411 CAGAGAGCTCAGAGGGTTGCAGG + Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918309472 1:183275490-183275512 CAGAGGCAGCAGAAGGATTTGGG - Intronic
918577814 1:186084988-186085010 GAGAGGCATTAGAGAGAAGCAGG - Intronic
918952107 1:191152074-191152096 CAGACCCATCAGCAGGATGCAGG + Intergenic
919420589 1:197365474-197365496 CAGAGGCATCATAGGCAAGGGGG - Intronic
921119754 1:212126399-212126421 CAGAGGTAACAGAGGCATGCAGG + Intergenic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
921447310 1:215261871-215261893 CAGATGCTTCAGAGTGATGAGGG + Intergenic
921856348 1:219989641-219989663 AATGGGCATCAGAGGAATGCAGG + Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923261668 1:232273695-232273717 CAGAGCCTTCAGAGGGACGGTGG + Intergenic
923480329 1:234377640-234377662 CAGAAGGATCAGAGTGAAGCTGG - Intronic
923719682 1:236456251-236456273 CAGAGGAATCAGGGAGATGGAGG - Intronic
924939827 1:248805357-248805379 CGGAGGGAGCAGAGGGCTGCTGG - Intergenic
1063600258 10:7474583-7474605 CAGAGGCCTCAGGGCGCTGCTGG - Intergenic
1065695256 10:28373711-28373733 CAGAGGCTTCAGGGAGAGGCAGG - Intergenic
1066695276 10:38071873-38071895 TAGAAGCATCAGAGGGAACCTGG - Intergenic
1066997223 10:42575393-42575415 TAGAAGCATCAGAGGGAACCTGG + Intronic
1067235033 10:44439862-44439884 CAGAAACATCAGATGGAAGCTGG - Intergenic
1067536290 10:47112773-47112795 CACAGACCTCAGAGGGATCCAGG + Intergenic
1067753311 10:48985854-48985876 CAGAGGCAGCAGAGGTAGCCAGG + Intergenic
1068961433 10:62870432-62870454 AGGAGGCATGAGAGGGCTGCAGG + Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1070451295 10:76559865-76559887 CTGAGGCAACAGAGAGCTGCAGG - Intronic
1070542043 10:77422849-77422871 TACAGGCTTCAGAGGGAGGCTGG + Intronic
1071400211 10:85261418-85261440 CTAAGGCATCAGAGTGTTGCAGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1079505269 11:21146294-21146316 CAGAGGCATAAGTGGGATTAAGG + Intronic
1079600346 11:22304676-22304698 CAGAAGCATGAGGGGGATGCAGG - Intergenic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1080866312 11:36198571-36198593 CAGAGGCAGGAGTGGGATGGGGG - Intronic
1081656634 11:44861837-44861859 CAGATCCATCAGAGGCATGGGGG - Intronic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1083902775 11:65651680-65651702 CAGAGACGTCAGAGGTATCCTGG + Intergenic
1084189457 11:67492367-67492389 CAGAGGCACCTGAGGCAGGCTGG + Intronic
1084606179 11:70173491-70173513 CAGACGCAAAACAGGGATGCTGG - Intronic
1084929029 11:72538991-72539013 CTGAGGCTTCAGAGAAATGCTGG + Intergenic
1086462131 11:87016532-87016554 AAGAGGCAGTAGAGGGATGTTGG + Intergenic
1088710446 11:112503568-112503590 CAGAGTCATCGGAGGGTTCCTGG + Intergenic
1088846841 11:113675371-113675393 CAGTGGCATCAGAGGGGTCAGGG + Intergenic
1089177114 11:116557064-116557086 GAGAGGCATCAGAGTGTTGGGGG - Intergenic
1089396310 11:118138143-118138165 CAGAAAGCTCAGAGGGATGCAGG - Intronic
1089748358 11:120632760-120632782 CAGAAGCCTCTGGGGGATGCTGG - Intronic
1090433089 11:126663136-126663158 GAGAGGCAGGAGAGGGATGTGGG + Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091638024 12:2213068-2213090 CAGAGGCATCTGTGGGAGTCAGG - Intronic
1091660313 12:2378345-2378367 CAGAGGCCATAGAGGGGTGCTGG - Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1093746141 12:22742791-22742813 CACAGGCATCAGTGGGGGGCAGG - Intergenic
1096255708 12:50060814-50060836 CAGAGGCTCCAGAGCCATGCAGG + Intronic
1098307624 12:69117440-69117462 CAGAGGGCTCAGAGGAAGGCAGG - Intergenic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1099650194 12:85416861-85416883 CAGAGGGAGAAGAGAGATGCAGG + Intergenic
1100392873 12:94159361-94159383 CAGAGGCATTTGGGGGTTGCAGG + Intronic
1104312147 12:127663217-127663239 CAGTGCCCTCAGAGGGATGATGG - Intergenic
1104769140 12:131349851-131349873 CAGAAGCATCAGGGTGAAGCCGG + Intergenic
1104973800 12:132543076-132543098 CAGATGCCTCTGAGGGATGAGGG + Intronic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1107901352 13:45018044-45018066 TAGAGGTATGAGAGGTATGCTGG - Intronic
1110084783 13:71364388-71364410 CAGAGCCATCAGAGAGAGCCTGG - Intergenic
1112323685 13:98429362-98429384 CAGAGAGGTCAGAGGGATCCCGG + Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1113155454 13:107315274-107315296 CAGAGGGATAAGAGTGAAGCAGG - Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114538709 14:23439056-23439078 CAGAGGCCTCAGAAGCATACAGG + Intergenic
1114571816 14:23674673-23674695 CAGAGCCATCAGTGGAATGTTGG - Intergenic
1114663528 14:24366110-24366132 CAGAGTCATCAGGGGAATGAGGG + Intronic
1115990875 14:39148210-39148232 GAGAAGCAGAAGAGGGATGCTGG + Exonic
1117767911 14:59102017-59102039 CACAGGCATGAGATGGCTGCTGG + Intergenic
1121013930 14:90536928-90536950 CAGAGTCCTTAGAGGGAGGCAGG + Exonic
1121506911 14:94484533-94484555 CATGGGCCACAGAGGGATGCTGG - Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1126990895 15:54374392-54374414 GAGGGGCATGAGAGGGAGGCCGG - Intronic
1128338167 15:66801919-66801941 AAGAGGCAGCAGAGGGTTGAGGG + Intergenic
1128338610 15:66804289-66804311 GTGAGGCCTGAGAGGGATGCAGG + Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1130814031 15:87411687-87411709 AAGAGGCTTCTGAGCGATGCTGG - Intergenic
1132209242 15:100008076-100008098 AAGAGGCCTCAGGGGGAAGCAGG + Intronic
1132601585 16:775335-775357 CAGGGGCATCTCAGGGCTGCTGG - Intronic
1134225004 16:12382839-12382861 GAGAGGCACCAGAGAGAAGCAGG - Intronic
1134844553 16:17428937-17428959 CATAGGGATCAGGAGGATGCAGG + Intronic
1134888188 16:17813626-17813648 CAGAGGAATCAGAGGCATAGAGG + Intergenic
1135139368 16:19908433-19908455 CAGAGGCCTGACAGGGATGGAGG + Intergenic
1135287896 16:21209891-21209913 CAGAGGCTTCCCAGAGATGCTGG + Intronic
1135554448 16:23424451-23424473 AAGAGGCATCACAGTGAGGCAGG - Intronic
1136779573 16:32887716-32887738 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1136891043 16:33973802-33973824 CAGAGGCTCGAGAGGGATGTAGG - Intergenic
1138247063 16:55475639-55475661 CAGAGGCTTCAGAGGGAGCGTGG - Intronic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1139647600 16:68342795-68342817 CACAGCCTGCAGAGGGATGCTGG - Intronic
1141054938 16:80805030-80805052 CAGAGGCACCATGGGGATCCAGG + Intergenic
1141627574 16:85269321-85269343 CAGCAGCATCAGAGGCAGGCTGG + Intergenic
1141712757 16:85709617-85709639 CAGAGGTATCACAGAGAGGCAGG + Intronic
1141750941 16:85957448-85957470 CAGGGGCATCAGGAGAATGCAGG - Intergenic
1142359513 16:89619613-89619635 CAGAGGGAGCAGGGGGCTGCAGG - Intronic
1203081989 16_KI270728v1_random:1149804-1149826 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1142967941 17:3592556-3592578 CAGAGGCCTCAGAGGTGAGCAGG + Intronic
1144409870 17:14990542-14990564 CAGAGGCACCAGTGGGAGACTGG - Intergenic
1146457755 17:33020596-33020618 CAGTGGCATCTGATGGATACAGG - Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147665201 17:42142598-42142620 CAGAGGCATCCCAGGCATGGAGG - Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148208089 17:45792120-45792142 CACGGGCAGCTGAGGGATGCCGG - Intronic
1148774921 17:50089882-50089904 GAGAGGCTTCACAGAGATGCAGG - Intronic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150858567 17:68777016-68777038 CAGAGGCACGAGAGGCATCCTGG + Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151824030 17:76513573-76513595 CAGAGGCTTCAGAGGGAGTGTGG + Intergenic
1151849545 17:76682331-76682353 GAAAGGCATCAGAGGCATGGAGG + Intronic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1153556197 18:6316440-6316462 CAGAGGCATTAGTGCAATGCTGG + Intronic
1156045744 18:32875206-32875228 CACATGAATCAGAGGCATGCAGG - Intergenic
1156568310 18:38221690-38221712 CAGAGGCATTAGAGACATCCTGG - Intergenic
1156588454 18:38459214-38459236 GAGCGGCTTCAAAGGGATGCGGG + Intergenic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157056775 18:44238702-44238724 GAGTGGGATCAGAGGAATGCTGG + Intergenic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1159041444 18:63326663-63326685 CAGAGCCATCTGAGGGATGAAGG + Intergenic
1159706468 18:71695634-71695656 CAGGGGCATCTGAAGGATGTCGG - Intergenic
1160245885 18:77159060-77159082 CAGAGCCTTCAGAGGGAAGGCGG + Intergenic
1160515850 18:79478813-79478835 CAGCGGCATCAGAGAGAAGCTGG + Intronic
1160888007 19:1360959-1360981 CAGAGGCGTGGGAGGGAGGCGGG - Exonic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1162156469 19:8681432-8681454 CAGATGCATGTGGGGGATGCTGG + Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162672142 19:12266298-12266320 GAGAGCCATCAGGAGGATGCTGG - Intronic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163439559 19:17314808-17314830 GAGAGGCAGCAGAGGGCTACAGG + Intronic
1164403287 19:27918546-27918568 CAGAGGCACCAGAGGGCTCATGG + Intergenic
1164906616 19:31973465-31973487 CAGAGCCATCTGGAGGATGCTGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1166103141 19:40583211-40583233 CAGATGCATCAAAGGGAGGAAGG + Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166864967 19:45830307-45830329 GAGAGGCAGCAGGGGGATGGGGG - Intronic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167001910 19:46750494-46750516 CAGAGAGATAAGAAGGATGCAGG - Intronic
1167169802 19:47823545-47823567 CAGAGGCTGCAGAGAGAGGCTGG + Intronic
925161625 2:1688181-1688203 CAGAAGCAACAGAGGCATACTGG + Intronic
925858955 2:8156699-8156721 CAAAGGTGACAGAGGGATGCGGG + Intergenic
925871955 2:8279226-8279248 CAGAGGCAGCAGGGGACTGCAGG - Intergenic
927062203 2:19434161-19434183 CAGAGGCATGAGAGTGAGGGGGG - Intergenic
927145494 2:20162784-20162806 CAGAGGTGTCAGTGGGAAGCAGG + Intergenic
927584772 2:24292131-24292153 GAGAGGCATCTAAGGGATACAGG + Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
934152801 2:89164600-89164622 CAGAGGCCTCAGACAGATGCTGG - Intergenic
934214441 2:90017332-90017354 CAGAGGCCTCAGACAGATGCTGG + Intergenic
934993832 2:98939379-98939401 GAGAAGGATCAGAGGGATGGTGG - Intergenic
935219809 2:101002525-101002547 CGGAGGCATCTGAGGGGCGCAGG + Intronic
935293025 2:101625797-101625819 CAGAAGCATCAGAGAGGTGGTGG - Intergenic
937992342 2:127671681-127671703 CAGTGGCATAATAGGGATGGAGG - Intronic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940557401 2:155247939-155247961 AAGAGGCATCAGAGAAAAGCAGG + Intergenic
941646931 2:168050611-168050633 CAGAAGGAGCCGAGGGATGCAGG + Intronic
941857587 2:170246636-170246658 CAGAGGCTTCAGAGGGAGCATGG + Intronic
942242007 2:173971589-173971611 CAGAAGCATCAGAGGGGAGGAGG - Intergenic
942312977 2:174672704-174672726 CGGAGGCATCACAGACATGCTGG + Intronic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
944034929 2:195283123-195283145 TAGAGACATTAGAGGGAGGCTGG - Intergenic
944511806 2:200472868-200472890 CAGAGGCAGCAGGGAGCTGCAGG - Exonic
944536821 2:200718436-200718458 CAGAGGCGTCAGTGGAATGGGGG - Intergenic
945417105 2:209587430-209587452 CAAATCCCTCAGAGGGATGCAGG - Intronic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946202190 2:218076807-218076829 GGGAGGCAGCAGAGGGAGGCAGG - Intronic
947374574 2:229482615-229482637 AAGAATCATGAGAGGGATGCAGG + Intronic
1170923630 20:20702525-20702547 CAGAGGCATCTGAAGTGTGCAGG + Intronic
1170938094 20:20827023-20827045 GAGATGCCTCGGAGGGATGCAGG + Intergenic
1172839296 20:37892551-37892573 TAGGGGCTTCAGAGGGATGAGGG + Intergenic
1173406871 20:42773952-42773974 GAGAGGAGTCAGAGGCATGCTGG - Intronic
1173869493 20:46332568-46332590 CAGAGGCAGCAGCGGGACTCAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175224923 20:57439326-57439348 CAGAGGGGTCAGGGGGATGGGGG - Intergenic
1175270755 20:57732253-57732275 GGGAGGCATCAGAGGGACCCAGG - Intergenic
1175336393 20:58199052-58199074 CAGAGGCATCTGATTTATGCAGG + Intergenic
1175736155 20:61388688-61388710 CACAGACAGCAGGGGGATGCTGG + Intronic
1178470442 21:32887544-32887566 AAGAGGTATCTGAGGCATGCAGG - Intergenic
1179272273 21:39860719-39860741 CAGAGGCATCAGAGGGATCTGGG + Intergenic
1179461911 21:41541646-41541668 CAGAGGGAGCAGATGGATTCAGG + Intergenic
1179625679 21:42648221-42648243 CACAGGCATCAGGGGCCTGCTGG + Intergenic
1180740549 22:18050464-18050486 CAGAGGCCTCAGAGGAAGCCTGG + Intergenic
1180981862 22:19882170-19882192 CAGAGGCTTCCGAGGGAGCCTGG + Intronic
1181166613 22:20987411-20987433 GAAAGGCAGCACAGGGATGCAGG + Intronic
1182052174 22:27321715-27321737 CAGGGGCATCAGAGGTGAGCTGG + Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182354280 22:29715374-29715396 CAGAGGCAACAGACTGAGGCAGG + Intergenic
1182755810 22:32678025-32678047 GTGAGGCCTCAGAGGGAGGCAGG + Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184045178 22:41968860-41968882 CAGAGGCAGCCGAGGGCTGTGGG + Intergenic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
949610333 3:5697714-5697736 CAGAGGGAACAGAGGGAGTCAGG - Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952033710 3:29175046-29175068 CAGAGGCCTCAGCAGGATCCAGG + Intergenic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954369552 3:50163055-50163077 CTCAGGCATCAGGCGGATGCAGG - Intronic
954683570 3:52358771-52358793 GAGAGGGAGCAGAGGGGTGCAGG - Intronic
955331134 3:58048383-58048405 CACTGGCATCACCGGGATGCTGG - Intronic
957474201 3:80702995-80703017 CATTGGTATCAGAGTGATGCTGG + Intergenic
958140761 3:89559491-89559513 CAGAGTCACCTGAGGAATGCAGG - Intergenic
958711063 3:97717550-97717572 AAAAGGTATCAGAGGCATGCAGG - Intronic
962085203 3:132183992-132184014 CACAGGCACCATTGGGATGCTGG - Intronic
963941981 3:151104757-151104779 TAGAGGCTTCAGAGGGAGGATGG - Intronic
964443175 3:156732946-156732968 CAGACACATCACAGAGATGCTGG + Intergenic
964550209 3:157877261-157877283 CAGAGGTATCAGAGAAAAGCAGG + Intergenic
965664747 3:171081341-171081363 AAGAGACAACACAGGGATGCTGG - Intronic
966681609 3:182647275-182647297 TAGAGACATCATATGGATGCAGG + Intergenic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968545496 4:1195681-1195703 CAGGGGCATCCCAGGGCTGCTGG - Intronic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
969159112 4:5239655-5239677 CAGAGGCATGAGAGGGGTTGTGG + Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
970229851 4:13898448-13898470 TAGAGGTATCAGAGGGAGTCTGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971261218 4:25058587-25058609 CAGAGCCTTCAGAGGGATCACGG - Intergenic
974647756 4:64716488-64716510 CAGAGGCACCTCAGGGATCCTGG + Intergenic
976015093 4:80542891-80542913 CAGGGGCAGCAGGGGCATGCAGG - Intronic
976336540 4:83894388-83894410 CATAAGCATCAGAGTGATCCTGG - Intergenic
978027564 4:103896572-103896594 CAGAGGCACCAGTGTAATGCTGG + Intergenic
981772647 4:148328027-148328049 CAGAGGCAACAGAGGGCCCCAGG + Intronic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
986298854 5:6462399-6462421 CCCAGGCAACAGAGGGATCCTGG + Intronic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
989692165 5:44157828-44157850 CAGAGGAATCCCAGGGATTCAGG - Intergenic
989692276 5:44158687-44158709 CAGAGGAATCCCAGGGATTCAGG - Intergenic
989712088 5:44411447-44411469 AAAAGGCATCAGAGGGAAGCCGG - Intergenic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992496784 5:77301458-77301480 GGAAGGCATCAGAGGCATGCAGG + Intronic
992965614 5:81997000-81997022 CACTGGTGTCAGAGGGATGCTGG - Intronic
993060881 5:83037589-83037611 CAGAGTCATTAGAAGGAAGCAGG + Intergenic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
993507876 5:88733327-88733349 CAGAGGCTCTGGAGGGATGCAGG + Intronic
993684560 5:90922326-90922348 CAGAGGCCACAGAGAGATACTGG - Intronic
995150031 5:108832344-108832366 CAGATGCCACAGAGAGATGCAGG + Intronic
995606385 5:113860173-113860195 CAGAGACAATGGAGGGATGCTGG - Intergenic
996897105 5:128498016-128498038 GTGAGACATCAGAGGGAGGCAGG + Intronic
997799466 5:136845222-136845244 CAGAGGCTTCAGAGGGAGCATGG + Intergenic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1001253840 5:170168846-170168868 CTGGGGCTTCAGGGGGATGCTGG + Intergenic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001553388 5:172620275-172620297 CAGAGGAAGCAGAGGGATATTGG - Intergenic
1001586140 5:172834766-172834788 TAGAGGGAGGAGAGGGATGCTGG - Intronic
1001639782 5:173236190-173236212 CAGAGGCCTCAGAGAAATCCTGG - Intergenic
1001788296 5:174432688-174432710 GAGAGGGATCAGAGGGTTGGAGG + Intergenic
1001877872 5:175216779-175216801 TAAAGGGATCAGAGGGAAGCAGG + Intergenic
1002062857 5:176636627-176636649 CAGAGGCCTCAGAGTCCTGCAGG + Intronic
1003735091 6:8869179-8869201 CACAGGCATGAAAGGGATCCAGG - Intergenic
1004522970 6:16379747-16379769 CAGAGGCATCAGCAAGACGCTGG + Intronic
1004781026 6:18908927-18908949 TAGAGGGATTAGAGGGATACAGG - Intergenic
1005462509 6:26082669-26082691 CAGAGGCTACAGAGGGATCTTGG - Intergenic
1005847141 6:29790943-29790965 CTGAGGCATGAGAGGAATGGAGG + Intergenic
1008662056 6:53678454-53678476 GAGAGGCATAACAGGGATTCTGG + Intergenic
1010349438 6:74854793-74854815 CTGAGGGATCTGAAGGATGCAGG + Intergenic
1011238216 6:85241190-85241212 CTCAGGCACCACAGGGATGCAGG + Intergenic
1012289694 6:97437502-97437524 CTGAGGCATCTGAGGGAAGGGGG - Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013830083 6:114261418-114261440 TAGATGCATGAGAGGGAAGCTGG + Intronic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1015907036 6:138128196-138128218 CAGAGCCATCTGAGGGCTACGGG + Intergenic
1017105141 6:150880260-150880282 CAGAGGCTGGAGAGGGATGGGGG - Intronic
1018107566 6:160503583-160503605 CTGACCCATCAGAGGAATGCTGG - Intergenic
1018291261 6:162294106-162294128 GAGAGGCATCATTGGGAGGCAGG + Intronic
1018468955 6:164079824-164079846 CAAAGGCATCTGAGGGAGCCTGG - Intergenic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019971269 7:4542860-4542882 CTGAGGCCTCAGCGGGAGGCTGG + Intergenic
1021177930 7:17471910-17471932 CAGAGGCATCATTGTGATGATGG + Intergenic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1023820882 7:43979902-43979924 GAGAGGCAGCTGAGGGTTGCCGG + Intergenic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1024016898 7:45325491-45325513 CAGAGGCCTCAAAGGGAGCCTGG - Intergenic
1024088195 7:45914635-45914657 CAGAGCCCTCAGAAGGGTGCAGG - Intronic
1024915213 7:54491736-54491758 AAGAGGTATTAGAGGGATCCTGG + Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1028175674 7:87655568-87655590 GAGAGGGATCAGAGAGATGTTGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029749156 7:102533339-102533361 GAGAGGCAGCTGAGGGTTGCCGG + Intergenic
1029767099 7:102632443-102632465 GAGAGGCAGCTGAGGGTTGCCGG + Intronic
1032456102 7:132074704-132074726 CAGTGGCATGACAGGGAGGCCGG + Intergenic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033750874 7:144360207-144360229 CTGAGGCAGGAGAGGGATCCTGG - Intronic
1035704549 8:1665572-1665594 CAAAGGCAACAGAGAGACGCGGG - Intronic
1035876463 8:3195228-3195250 CATGCACATCAGAGGGATGCGGG + Intronic
1037438138 8:18886348-18886370 CCCAGTCATCAGAGAGATGCCGG - Intronic
1037454157 8:19047076-19047098 CAGAGGAATAAGAGGCCTGCTGG - Intronic
1037636320 8:20703863-20703885 CAGAGGAAGTAGAGAGATGCAGG + Intergenic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1039400071 8:37261844-37261866 CAGTGGCATCAGAGCCAAGCTGG + Intergenic
1040308204 8:46223196-46223218 GGGTGGCATCAGTGGGATGCAGG + Intergenic
1040532749 8:48278837-48278859 CAGTGCCATAACAGGGATGCAGG - Intergenic
1040791854 8:51240126-51240148 AAGAGGCATCAGAGGTCTCCTGG - Intergenic
1043974366 8:86568205-86568227 CAGAGGCAGCGGAAGGATTCTGG - Intronic
1045856362 8:106769784-106769806 CACAGGTACGAGAGGGATGCTGG - Exonic
1047279663 8:123434153-123434175 CAGAGGCAGGAGAGCAATGCAGG - Intronic
1047878452 8:129166691-129166713 AAGAGGGATGGGAGGGATGCAGG - Intergenic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1053012869 9:34645064-34645086 CTGAGGCTTCAGTGGAATGCAGG - Intronic
1053902226 9:42806433-42806455 CAGAGCCATGTGAAGGATGCCGG + Intergenic
1054532751 9:66199087-66199109 CAGAGCCATGTGAAGGATGCCGG - Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055489747 9:76792480-76792502 GAGAGGAATGAGAGGGCTGCAGG + Intronic
1056282511 9:85055689-85055711 CAGAGGCATCAGAAGGGTTCAGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1056804528 9:89718374-89718396 CAGAGCCATCAGAGTGATCCTGG + Intergenic
1058307253 9:103459485-103459507 CAGATGCATCCAAAGGATGCAGG + Intergenic
1058754424 9:108071192-108071214 CAGAAGCATCAGCAGGCTGCAGG - Intergenic
1059651627 9:116320845-116320867 TAGAGGCATAAGAGGGAAGCAGG + Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061045158 9:128160779-128160801 CCGAGGCACCTGAGGGAGGCAGG + Intronic
1061910043 9:133717560-133717582 CAGATGCATTAGAGGGCTGGTGG + Intronic
1062730000 9:138103430-138103452 CTGGGGCCTCAGAGGGCTGCTGG + Intronic
1186342878 X:8662109-8662131 CAGGGGCATCAGCCTGATGCAGG - Intronic
1187961537 X:24570844-24570866 CAAAGGCCTTAGAGGGATGTTGG + Intronic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1189316862 X:40062710-40062732 CACAGGCCCCAGAGGGAAGCCGG + Intronic
1190582644 X:51903604-51903626 CTGAGGCATCATGGAGATGCAGG - Intergenic
1192553202 X:72069975-72069997 CAGAGGCTACACAGGGTTGCCGG - Intergenic
1194193045 X:90860431-90860453 CAAAGGCATGAGAGGTAAGCAGG - Intergenic
1194901715 X:99520238-99520260 CATAGGCAGCAGAGGGTAGCAGG - Intergenic
1198038104 X:132821537-132821559 AAGAGGCATCTGAGTGATCCCGG + Intronic
1198946751 X:142024633-142024655 TAGAGGAATCAGAGGAATACAGG + Intergenic
1199436411 X:147818239-147818261 CAGAGGCTTCAGAAGGACTCAGG - Intergenic
1200539663 Y:4442881-4442903 CAAAGGCATGAGAGGTAAGCAGG - Intergenic
1200907921 Y:8503825-8503847 CATAGGCATCAGGATGATGCTGG + Intergenic
1202043532 Y:20713028-20713050 CAGATGCATCAGAAGGAAGCTGG - Intergenic