ID: 1183585799

View in Genome Browser
Species Human (GRCh38)
Location 22:38752329-38752351
Sequence GTGCTCATACACATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183585795_1183585799 13 Left 1183585795 22:38752293-38752315 CCGGCTCACAGTCGGTGGGAGAA 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 107
1183585793_1183585799 15 Left 1183585793 22:38752291-38752313 CCCCGGCTCACAGTCGGTGGGAG 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 107
1183585794_1183585799 14 Left 1183585794 22:38752292-38752314 CCCGGCTCACAGTCGGTGGGAGA 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG 0: 1
1: 0
2: 2
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183585799 Original CRISPR GTGCTCATACACATGGAGCA AGG Intronic
900879537 1:5370796-5370818 GTGCTCACACACATTGAGGGTGG - Intergenic
901257673 1:7845308-7845330 GTGCTCAGACACATTGGCCAAGG - Intronic
902037874 1:13470721-13470743 GTGCTCTTCCCCAGGGAGCAAGG - Intergenic
902618500 1:17636978-17637000 GTGATGATACAGATGGAGTAAGG - Intronic
904387506 1:30153282-30153304 GTGCTTTTACTCATGGAGAAAGG - Intergenic
905372051 1:37487570-37487592 GTACTGCTACCCATGGAGCAGGG + Intergenic
906071828 1:43022358-43022380 ATGCACAGACCCATGGAGCATGG + Intergenic
911519713 1:98914095-98914117 TTTCTCATATAAATGGAGCATGG + Intronic
913207069 1:116548967-116548989 TTGCTGAGAGACATGGAGCAAGG - Intronic
914221412 1:145685398-145685420 GTGCTAATGCACATGGTGAATGG - Intronic
914473978 1:148008265-148008287 GTGCTAATGCACATGGTGAATGG - Intergenic
916213602 1:162377693-162377715 ATACACATACACATGGGGCAGGG - Intronic
920342451 1:205284162-205284184 GAGGTCAGACACATGCAGCAGGG - Intergenic
924332446 1:242953576-242953598 GTGCTCCTACCCGTGGATCATGG - Intergenic
1065512033 10:26488917-26488939 GTGTACATACACATGGGACAAGG - Intronic
1068778915 10:60898551-60898573 AAGCTCATACTCATGGAGGATGG + Intronic
1071206874 10:83290223-83290245 GTGGCCATACAAAAGGAGCAGGG - Intergenic
1076875950 10:133215605-133215627 GTGCTCATCCTCATGAAGCCTGG - Intronic
1080573455 11:33577685-33577707 GTGGTAATACACACGGAGAATGG + Intronic
1082738643 11:56885490-56885512 GTGTTCATACACACAGAGCCAGG + Intergenic
1083186434 11:61020417-61020439 GTGCACACACACATGCAGCCTGG - Intergenic
1085981880 11:81735152-81735174 GTGCTCACACACATTGAGGGTGG + Intergenic
1088425083 11:109693586-109693608 GTGCTCACACACATTGTCCAAGG + Intergenic
1098267905 12:68741353-68741375 TTGCTTATACACATGGAAAATGG - Intronic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1101353478 12:103955339-103955361 GTGCAAATACAAATGGAGCCAGG + Intronic
1102655197 12:114477053-114477075 GTGCTCAAAAACATGGGGCAAGG - Intergenic
1102986070 12:117279746-117279768 GTGCTCAGCCAAGTGGAGCAGGG + Intronic
1110352860 13:74530022-74530044 GGGCTCATGCACAAGGAGCCAGG - Intergenic
1112535549 13:100251228-100251250 GTGCTCTTACACATAGATCCAGG + Intronic
1113604323 13:111594754-111594776 GTGTTCAAACACAAGGTGCATGG - Intronic
1115957268 14:38795229-38795251 GTGCACTCACACATGGAGGAAGG - Intergenic
1119503099 14:75147689-75147711 GTGATCCTAGACATGAAGCATGG - Exonic
1128462177 15:67878852-67878874 GTGCTCAAACCCAAGGAGCGGGG + Intergenic
1134335946 16:13299823-13299845 GTGCCCATGCACACGTAGCAGGG - Intergenic
1137402999 16:48168482-48168504 ATGCTCACACACATGTATCATGG - Intronic
1139734117 16:68972748-68972770 GTGCTAAGACAAATGAAGCAGGG + Intronic
1140018601 16:71214611-71214633 GTGCTCACACATATGCAGCCTGG + Intronic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1148150081 17:45391691-45391713 ATGCTCAGAGACAGGGAGCAGGG + Intergenic
1156624147 18:38888184-38888206 TTGCCCATAAACATGCAGCATGG - Intergenic
1159095143 18:63893615-63893637 GTCCTCACACACATGTAGTAAGG - Intronic
1159750831 18:72300744-72300766 GTTCTCTTACAAATGGAGCATGG - Intergenic
1161068573 19:2249723-2249745 GTGGTCCTACACCTGGAGGAAGG + Exonic
1162125497 19:8497684-8497706 TTGCTCTTACACCAGGAGCATGG + Intronic
1166874704 19:45890504-45890526 GTGCTCACATCCCTGGAGCAGGG + Exonic
1167910011 19:52693998-52694020 GTGCCCATACAAGTGTAGCATGG + Intergenic
927213707 2:20653958-20653980 GGGCACATCCACATGGAGCAGGG + Intergenic
928206848 2:29290558-29290580 GTGCTCCTAAAGATGAAGCAGGG + Intronic
935195491 2:100812530-100812552 GTACTCATGTCCATGGAGCAGGG + Intergenic
937918802 2:127115518-127115540 GTACTCATACCGATGGAGCCAGG - Intergenic
940301089 2:152176960-152176982 GAGCTCATACACATTCAGAAAGG + Intergenic
942820581 2:180109320-180109342 GGGCTCATAGTCATGGAGCTAGG - Intergenic
942820741 2:180111105-180111127 GGGCTCATAGTCATGGAGCTAGG - Intergenic
943913210 2:193594073-193594095 GTGCTGAGACACCTGGAGCTGGG - Intergenic
944080798 2:195786444-195786466 GTACTCATACACATGCAGCATGG - Intronic
948047757 2:234956858-234956880 CTGCTCATAAAAATGGGGCAAGG - Intronic
1168749925 20:275254-275276 GTTCTCATTCACATGGTGCCTGG + Intronic
1171777829 20:29387373-29387395 GTGCTGAGACATATGGAGCTGGG + Intergenic
1176896907 21:14390460-14390482 GTACACATACACATAGAGTATGG + Intergenic
1179172025 21:38980485-38980507 GTGCCCAGACACATGGACAATGG - Intergenic
1182091380 22:27597253-27597275 GTGCTGACACACACAGAGCAGGG - Intergenic
1182198756 22:28547241-28547263 GCACACATACACATGGAACATGG + Intronic
1182885804 22:33773112-33773134 GTGGTCATTCCCATGGAGCAGGG - Intronic
1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG + Intronic
1184831728 22:46993041-46993063 GTGCTCTTCCACCTGGACCAGGG - Intronic
1184854856 22:47141064-47141086 GGCCTCATAAACATGGAGGACGG + Intronic
949231736 3:1757705-1757727 GTGTGCCTACACATGGAGCTGGG - Intergenic
952536081 3:34310406-34310428 GTGTACAGACACATGGAGCCAGG - Intergenic
953187815 3:40654642-40654664 GTGCTCAACAACATGGAGAAGGG + Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954712332 3:52511380-52511402 GTGCTCCTGCACTTGGAGCCTGG - Intronic
955823611 3:62922207-62922229 GTGCCCATCCAGATTGAGCATGG - Intergenic
955961795 3:64348301-64348323 TGGCTCAAACACAGGGAGCAGGG + Intronic
964245338 3:154645600-154645622 GTGATCAGAAAAATGGAGCATGG + Intergenic
965165235 3:165188605-165188627 GTACTCATACACATGACCCACGG + Exonic
969592126 4:8127889-8127911 CTGCCCCTACACATGGAGGAAGG - Intronic
971342847 4:25786626-25786648 GAGCTCATACACAGAGAGGAAGG - Intronic
976894809 4:90096723-90096745 ATGCCCATCCACATGGAGGAGGG + Intergenic
977803108 4:101262617-101262639 GTGCTCAAACACATGAAGTTAGG + Intronic
979072932 4:116233666-116233688 GTGCTCAGACTCATGGAACAGGG + Intergenic
980123916 4:128755156-128755178 GTGCCCATCCACATGGAGCAGGG - Intergenic
982166082 4:152614666-152614688 GTGCTCAGACACAGGAAGAAGGG - Intergenic
983238024 4:165201894-165201916 GTTCTCATACATATGCAGCCTGG + Intronic
988631966 5:32941144-32941166 GTGCTGGGACACATGGAACATGG + Intergenic
988930874 5:36034584-36034606 CTTCTCATCCACATGGAGCTGGG + Intergenic
989174177 5:38505004-38505026 GTGTTAATGCACATGGACCATGG + Intronic
992346519 5:75884155-75884177 ATGCTCACACCCAGGGAGCATGG - Intergenic
996024787 5:118632679-118632701 GTGATCTTCCCCATGGAGCAAGG + Intergenic
996119012 5:119650066-119650088 GTACGCATACATATGGAGAAAGG - Intergenic
998250720 5:140550419-140550441 TTGCAGATACACAGGGAGCAGGG + Exonic
999124096 5:149233832-149233854 GAGCTCAGACACATGGAGGTGGG - Intronic
999429359 5:151512520-151512542 GTGGTCATTCACATGGCGCTGGG + Exonic
1000845171 5:166270571-166270593 GTGCTTATAGGCATGGATCAAGG + Intergenic
1001533972 5:172485578-172485600 GTGCCCAGAAGCATGGAGCAGGG + Intergenic
1004005253 6:11632169-11632191 GTGCTTATAAACATGGAGGCTGG + Intergenic
1006047125 6:31307822-31307844 CTGCTCAGACACCTGGAGCATGG - Intronic
1017257675 6:152352328-152352350 TTGCTCAAAGACATGGAGAAAGG - Exonic
1018468905 6:164079536-164079558 GTCCTCACACACATGCAGGAGGG - Intergenic
1019725290 7:2598731-2598753 GTGCTCAGACACCTGGGGCCTGG - Intronic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1023266005 7:38406609-38406631 GTGCCCATTCACATTGAGGAGGG - Intronic
1027434575 7:78151410-78151432 GTGCTCACACAGATGGATGACGG + Intronic
1032619782 7:133517421-133517443 GAGCTAATACACATGGAGCGGGG - Intronic
1032710231 7:134454776-134454798 GTGCTGATAATCCTGGAGCAAGG + Intronic
1033511540 7:142064668-142064690 ATGCTCATTGACATGGAGCCAGG + Intronic
1036979858 8:13458307-13458329 GTGCTCTTATTTATGGAGCAAGG - Intronic
1044363173 8:91311783-91311805 GTGGTAATCCACATGTAGCAGGG + Intronic
1044399464 8:91753789-91753811 GGGGTCATGCACATGGAGAAAGG - Intergenic
1044719544 8:95132834-95132856 GTGCTCATCCACGTGCAGCTTGG + Intergenic
1045327692 8:101128827-101128849 GAGCTCATGGACATGGAGCAAGG + Intergenic
1047632455 8:126723064-126723086 ATGTTCATACACATGGGTCATGG - Intergenic
1049872967 8:144995249-144995271 GTGATCCTAGACATGAAGCATGG + Intergenic
1059765890 9:117383804-117383826 GAGCTGATACAAATGGAGCCGGG + Intronic
1060784791 9:126442633-126442655 GTGCAAAGACACAAGGAGCAGGG - Intronic
1062245693 9:135565008-135565030 GTGCTCAGAAACATGGGGAAGGG - Intronic
1186288222 X:8068718-8068740 GTGCTCATCCACATTGAGGGTGG - Intergenic
1191660221 X:63641823-63641845 GTGCCCATCCAGATTGAGCATGG - Intronic
1201229771 Y:11852830-11852852 GTGCTCTTACCCATGGATCATGG - Intergenic