ID: 1183585925

View in Genome Browser
Species Human (GRCh38)
Location 22:38752848-38752870
Sequence CTCCAGCCGCTGCACAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 236}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183585925_1183585933 12 Left 1183585925 22:38752848-38752870 CCTGCACTGTGCAGCGGCTGGAG 0: 1
1: 0
2: 1
3: 24
4: 236
Right 1183585933 22:38752883-38752905 TGGGGCTCACTTCGTGACTCTGG No data
1183585925_1183585929 -6 Left 1183585925 22:38752848-38752870 CCTGCACTGTGCAGCGGCTGGAG 0: 1
1: 0
2: 1
3: 24
4: 236
Right 1183585929 22:38752865-38752887 CTGGAGTCACGCCCGGCCTGGGG 0: 1
1: 0
2: 1
3: 4
4: 130
1183585925_1183585927 -8 Left 1183585925 22:38752848-38752870 CCTGCACTGTGCAGCGGCTGGAG 0: 1
1: 0
2: 1
3: 24
4: 236
Right 1183585927 22:38752863-38752885 GGCTGGAGTCACGCCCGGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 175
1183585925_1183585928 -7 Left 1183585925 22:38752848-38752870 CCTGCACTGTGCAGCGGCTGGAG 0: 1
1: 0
2: 1
3: 24
4: 236
Right 1183585928 22:38752864-38752886 GCTGGAGTCACGCCCGGCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 114
1183585925_1183585935 26 Left 1183585925 22:38752848-38752870 CCTGCACTGTGCAGCGGCTGGAG 0: 1
1: 0
2: 1
3: 24
4: 236
Right 1183585935 22:38752897-38752919 TGACTCTGGAGCCTCTTCCAGGG 0: 1
1: 1
2: 3
3: 15
4: 200
1183585925_1183585934 25 Left 1183585925 22:38752848-38752870 CCTGCACTGTGCAGCGGCTGGAG 0: 1
1: 0
2: 1
3: 24
4: 236
Right 1183585934 22:38752896-38752918 GTGACTCTGGAGCCTCTTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183585925 Original CRISPR CTCCAGCCGCTGCACAGTGC AGG (reversed) Intronic
900132415 1:1092681-1092703 CTCCAGTCTCTGCACAGGGACGG + Intronic
900563021 1:3317399-3317421 CAGCAGCCGCTGCACGATGCTGG + Intronic
902203444 1:14850991-14851013 CTCCAGGCCCTGCACAGTGCTGG + Intronic
902721938 1:18309669-18309691 CTCTAGCCGCTGCTGAGGGCCGG + Intronic
902735485 1:18397981-18398003 CTCCAGCCTGTGCTCTGTGCGGG - Intergenic
902870789 1:19312445-19312467 CTCCGGCCGCTGGACTGTCCCGG + Exonic
903062921 1:20682869-20682891 CTCCAACAGCTGCAGACTGCCGG + Exonic
903215068 1:21839250-21839272 CTCCAGGCGCTGCAGGGTCCTGG - Intronic
903867821 1:26411457-26411479 CCTCAGCTGCTGCACGGTGCGGG + Exonic
904033941 1:27549299-27549321 CTCCAGCCGCTTCAGACTGCCGG - Exonic
904306084 1:29591200-29591222 CTCCATCCATTGCACAGGGCTGG + Intergenic
904541166 1:31234306-31234328 CTGCAGCTGCTCCAGAGTGCAGG + Intronic
904618208 1:31761082-31761104 CTCCAGCTGCTGCAAAGTTCCGG - Intronic
905227083 1:36486073-36486095 CTCTAGCCTCAGTACAGTGCCGG + Intergenic
907371085 1:54004173-54004195 CTCCACCCGCGGCCCGGTGCGGG - Intergenic
912084005 1:105976753-105976775 ATCCAGCTGCTACACAGAGCAGG - Intergenic
912979557 1:114358291-114358313 TTCCAGCCATTACACAGTGCAGG - Intergenic
913086042 1:115437910-115437932 CTCCAGACACTGAGCAGTGCAGG + Intergenic
919162647 1:193851275-193851297 CTTAAGCCACTACACAGTGCAGG + Intergenic
922584347 1:226722429-226722451 CTCCCGCCTCTGCAGACTGCTGG - Intronic
923088720 1:230722078-230722100 GTCCAGAGGCTGCACAGAGCAGG - Intergenic
1063035223 10:2280224-2280246 CTCCTGCCCCTGCACTCTGCTGG + Intergenic
1063570958 10:7214027-7214049 CTCCATCTTCTGCACAGTCCTGG - Intronic
1067567655 10:47350211-47350233 GTCCAGCAGCGGCACCGTGCGGG - Exonic
1067748015 10:48951022-48951044 CCACAGTCTCTGCACAGTGCAGG - Intronic
1068805801 10:61192727-61192749 CTCCAGAGGCTGCACACAGCAGG + Intergenic
1069957433 10:72060653-72060675 CTCCAGCCCCGGCTCAGTTCAGG - Exonic
1070623784 10:78034116-78034138 CTCCAGCGCCTGGGCAGTGCAGG + Intronic
1074291036 10:112138180-112138202 CTCCAGTGGCTGCAGAGTGAGGG - Intergenic
1074719308 10:116250827-116250849 CTCCTTCCGCTGCCCTGTGCAGG - Intronic
1076221854 10:128740078-128740100 CTCCAGCCCCTGCAGAGTTCAGG + Intergenic
1076680669 10:132169710-132169732 CCACAGCCGCTGCCCACTGCAGG - Intronic
1076888465 10:133273098-133273120 GTCCAGCCCCTGTCCAGTGCTGG + Intronic
1077284451 11:1759528-1759550 CTCCATCCACTGCAAACTGCTGG - Exonic
1077448180 11:2612960-2612982 CACCAGTGGCTGCACACTGCAGG - Intronic
1081575468 11:44316387-44316409 CTCCAGGCGCTGCAAAGAGCAGG + Intergenic
1081717002 11:45257542-45257564 CTCCCTCCCCTACACAGTGCAGG - Intronic
1081869975 11:46378991-46379013 CTCCAGGAGCTGCACCGAGCTGG + Exonic
1082759951 11:57117675-57117697 CTCCAGCCTCAGCACACTGAAGG - Intergenic
1083679463 11:64344505-64344527 CTCCTCCAGCTGCACAGAGCTGG - Exonic
1083679657 11:64345251-64345273 CTCCAGCCCCAGCTCAGTGCTGG - Intronic
1083767690 11:64849724-64849746 CTGCAGCCGCTGCAGAGCGTGGG - Intergenic
1085404333 11:76252963-76252985 CTCCAGCTGCTGCACGTTTCAGG - Intergenic
1085472319 11:76766369-76766391 CTCCAGCCACTGCATGTTGCTGG + Intergenic
1087672895 11:101128096-101128118 TTCCAGCAGCTGCCGAGTGCGGG + Exonic
1088716168 11:112551642-112551664 CTGCAGTGGCTGCTCAGTGCAGG + Intergenic
1088922860 11:114274059-114274081 CTCCTACCCCTGCTCAGTGCTGG + Intronic
1089128503 11:116193867-116193889 CTCCAGCTCCTGCAAAGTTCCGG + Intergenic
1091108289 11:132943118-132943140 CTCCGGCAGCCGCACAGTCCTGG + Exonic
1091375608 12:22939-22961 CTCCAGTCTCTGCACACTCCCGG + Intergenic
1091446175 12:545443-545465 CTCCAGCTGCTGGCCAGTGTGGG + Exonic
1092117945 12:6022765-6022787 CTCCACACACTGCACAGGGCAGG + Exonic
1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG + Intronic
1094390931 12:29949704-29949726 CTTGAGCCCCTGCTCAGTGCTGG + Intergenic
1096614458 12:52823914-52823936 CTGCAGCCTCTGGATAGTGCGGG + Exonic
1097548525 12:61036310-61036332 CTCCAGATGCTCCACTGTGCTGG - Intergenic
1098288903 12:68935892-68935914 CTCCAGCCACAGCACCCTGCAGG - Intronic
1102259333 12:111434911-111434933 CTCCAGCCACGGCACAGCACCGG - Intronic
1103088362 12:118079578-118079600 CTCCATCAGCTCCCCAGTGCTGG - Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103365132 12:120376624-120376646 CTCCAGCCCTAGCACAGTGATGG - Intergenic
1103726740 12:123000963-123000985 GACCAGCTTCTGCACAGTGCTGG - Intronic
1104920832 12:132289883-132289905 CTCCACCATCTGCACAGTCCTGG - Intronic
1105514299 13:21076414-21076436 CTGCAGTCGTCGCACAGTGCAGG + Intergenic
1105890680 13:24680552-24680574 CGCCAGCCGCTGCACCGGGGAGG - Exonic
1107334719 13:39342441-39342463 CTCCAGCTTCTACAAAGTGCTGG - Intergenic
1107787567 13:43970842-43970864 CTCCAGGAGCTGCACCGAGCTGG + Intergenic
1109534143 13:63693987-63694009 ATCCTGCCGCTGCACTGTGGGGG - Intergenic
1111298586 13:86316820-86316842 ATACAGCCCCTGCAAAGTGCTGG + Intergenic
1112022122 13:95380647-95380669 CCCCAGCCTCTGCAGAGTACGGG + Intergenic
1112565724 13:100550098-100550120 CTACAGCCCCTGCACAGAGTGGG + Intronic
1117253664 14:53957051-53957073 CCCCAGCCGCTTCCCAGAGCTGG - Intronic
1119780236 14:77272261-77272283 CTCAAGCCCCAGCCCAGTGCTGG + Intergenic
1119821050 14:77616534-77616556 CTGCTGCCGCCGCACGGTGCGGG - Exonic
1121278742 14:92685447-92685469 CTCCAGCCCCTGCAGGGTGCTGG - Intronic
1121515820 14:94549117-94549139 CTCCTGCAGCTACACAGTGTGGG - Intergenic
1122068345 14:99189236-99189258 CTCCAGCCGCTGCTGGCTGCCGG + Intronic
1126917122 15:53478105-53478127 CTCCAGCCTGAGCACAGAGCCGG + Intergenic
1128788008 15:70412520-70412542 CTCCAGGCTCTGCACATTGGAGG + Intergenic
1129223345 15:74148450-74148472 CTTCAGCCCCTACAGAGTGCTGG + Intergenic
1129605284 15:77021936-77021958 CCCCAGAAGCTGCACAGGGCAGG + Intronic
1130632492 15:85582780-85582802 TTCAAGACCCTGCACAGTGCAGG + Intronic
1130910349 15:88266371-88266393 CTTCAGGGGCTGGACAGTGCAGG + Intergenic
1132382094 15:101373147-101373169 CTCCAGCCGCTGCATAAAGAAGG + Intronic
1132646258 16:1000624-1000646 CCACAGCCACTGCACAGAGCCGG - Intergenic
1134225372 16:12385905-12385927 CACCAGCTCCTGCACAGTGGTGG + Intronic
1134297409 16:12959274-12959296 GTCCAGCCTCTGCAGGGTGCTGG + Intronic
1136276027 16:29179992-29180014 CTCCACACGGTGCCCAGTGCAGG + Intergenic
1137410984 16:48227932-48227954 CCCCAGCCCCTGGACAATGCTGG - Exonic
1139402187 16:66691667-66691689 CTCCAGCCTGGGCACAGAGCAGG + Intronic
1139525602 16:67514081-67514103 CTTCAGCCCCTGCAAAGTGCTGG - Intergenic
1141689346 16:85587624-85587646 CTCCAGCCTCTGCTCAGTGATGG - Intergenic
1141892139 16:86933422-86933444 CTCCACCCCCTCCTCAGTGCTGG - Intergenic
1142983191 17:3683166-3683188 CTCCACCCACAGCACAGGGCAGG + Intronic
1144747446 17:17625278-17625300 CTCCAGCAGCTCCACGGAGCAGG + Intergenic
1145165845 17:20612894-20612916 CACCTGCCGCAGCACAGGGCGGG - Intergenic
1146624127 17:34423165-34423187 CTCCAGCCCCTGCACTGAGGTGG + Intergenic
1150119157 17:62585182-62585204 TTCCTGCCTCTGGACAGTGCTGG + Intronic
1150271908 17:63872315-63872337 TTCCAGCCTCTGCAAAGTGAAGG + Exonic
1150273273 17:63880510-63880532 TTCCAGCCTCTGCAAAGTGAAGG + Exonic
1150275456 17:63895211-63895233 TTCCAGCCTCTGCAAAGTGAAGG + Exonic
1150278881 17:63917498-63917520 TTCCAGCCTCTGCAAAGTGAAGG + Exonic
1150388520 17:64778237-64778259 CCCCAGCCGCGAAACAGTGCAGG - Intergenic
1151657978 17:75504464-75504486 CTCCAGCCACTGCCCTCTGCTGG - Exonic
1151727861 17:75894951-75894973 CTCCAGCAGCTGCCCGGGGCGGG + Intronic
1151829030 17:76538760-76538782 CTGCAGCGGCTGCTCAGTCCTGG + Intronic
1151956495 17:77382795-77382817 CTCCTCCCTCTGCACAGTACTGG - Intronic
1152664110 17:81557525-81557547 GTCCAGCCTCTGCCCAGTGGTGG + Exonic
1152803475 17:82343037-82343059 CTCCAGCCACTGCGTGGTGCGGG - Intergenic
1153485348 18:5592580-5592602 CTCCCTCCTCTGCACAGTCCTGG - Intronic
1153920362 18:9783384-9783406 GTCCAACCCCTCCACAGTGCAGG - Intronic
1154942900 18:21132485-21132507 CTCCACCTGCGGCCCAGTGCGGG - Intergenic
1156470336 18:37373774-37373796 CCCCATCCTCTGCACATTGCTGG - Intronic
1157323916 18:46655723-46655745 ATTCAGCCCCTGCACAGTCCTGG - Intronic
1159352921 18:67298945-67298967 CTGCAGCTGCCTCACAGTGCTGG - Intergenic
1160850970 19:1192265-1192287 CTCCTGGCCCTGCACAGTGCTGG + Intronic
1161156548 19:2734798-2734820 CTCCAGCCGGTGGTCAGTGAGGG - Intronic
1161989770 19:7678098-7678120 CTCCAGTCCCAGCCCAGTGCAGG + Exonic
1162481110 19:10927708-10927730 CTGCAGGAGCTGCACATTGCGGG + Exonic
1163830994 19:19547106-19547128 CTCCTGGCGCTCCACAGGGCCGG + Intergenic
1164578116 19:29417887-29417909 CTCCAGCCGCTGACCAGCACAGG + Intergenic
1164761561 19:30732100-30732122 CTCAAGCAGCTACTCAGTGCTGG - Intergenic
1164936641 19:32220029-32220051 CACCAGCCGGTGCAGAGTGCAGG - Intergenic
1166140104 19:40800834-40800856 CTGCGGCCGCTGCAGAGTGAAGG + Exonic
1167387086 19:49170218-49170240 CTCCAGCCTGTGCACAGAGCAGG - Intronic
1202647125 1_KI270706v1_random:152870-152892 CTGCAGCAGCTGCACAGGGGTGG - Intergenic
925158068 2:1662332-1662354 CAGCAGCCTCTGCACAGGGCAGG + Intronic
926375505 2:12223694-12223716 CTCCTGCAGCTGCACAGAGCAGG - Intergenic
927277411 2:21273647-21273669 CTTGAGCCTCTGCACAGAGCAGG + Intergenic
927640264 2:24841412-24841434 CTCCAGCCCCTCCTCAGTGAGGG + Intronic
928176868 2:29039959-29039981 CTCCAGCCCCTGGTCAGTACTGG + Intronic
929818773 2:45257244-45257266 CTCCAGCCTCACCACAGAGCTGG + Intergenic
933551699 2:83785913-83785935 CTCCAACCTGGGCACAGTGCGGG - Intergenic
934576010 2:95402137-95402159 CTCCATCCCCTGCAGAGGGCAGG - Intergenic
934638188 2:96009994-96010016 CTCCATCCCCTGCAGAGGGCAGG - Intergenic
934795463 2:97095416-97095438 CTCCATCCCCTGCAGAGGGCAGG + Intergenic
935797945 2:106663754-106663776 GTCCAGAGGCTGCACAGAGCAGG - Intergenic
937915631 2:127097448-127097470 CTCCACCTGCTGCACAGCCCAGG - Intronic
938748364 2:134303630-134303652 CTTCAGCTGCTGCTCACTGCAGG - Intronic
938912563 2:135898793-135898815 CTCCAGCTTCTACACAGAGCTGG - Intergenic
941772903 2:169362676-169362698 CTCCCCGCGCTGCAAAGTGCAGG - Exonic
942045925 2:172099364-172099386 CTCAAGCCGCTGCCCAGGCCGGG - Intergenic
943992264 2:194711722-194711744 CTCCAGCCTTTCCAAAGTGCTGG - Intergenic
944872842 2:203931660-203931682 TTCCAGCCTCTGCAGAGTTCAGG - Intergenic
945714644 2:213343168-213343190 TTCCAGAGGTTGCACAGTGCTGG + Intronic
947711225 2:232317305-232317327 TCCCAGCCCCTGCACAGTGTTGG + Intronic
948183370 2:236000564-236000586 GCCCAGCCTCTGCACAGAGCAGG - Intronic
948730533 2:239961080-239961102 CTCCAGCTGCATCACAGTGATGG - Exonic
1169214497 20:3785506-3785528 CTCCAGCGGATGCACGGTGCCGG + Exonic
1170443237 20:16399451-16399473 CTCAAGCCCCAGCACAGGGCTGG + Intronic
1171126206 20:22603923-22603945 CTGGTGCCGCTGCAGAGTGCCGG - Intergenic
1171333536 20:24362159-24362181 ATCCAGCTGGTGCACAGGGCAGG + Intergenic
1171533252 20:25865933-25865955 ATCCAGCCGCTGCGCAGCGGTGG - Intronic
1173468480 20:43303359-43303381 CTTCAGTCTCTGCACAGAGCAGG + Intergenic
1175905661 20:62378185-62378207 CTCCAGCCGGGCCACAGAGCTGG + Intergenic
1175922545 20:62456918-62456940 CTCGAGCTCCTGCACAGTCCTGG + Intergenic
1176604746 21:8819904-8819926 CTGCAGCAGCTGCACAGGGGCGG + Intergenic
1177779878 21:25610805-25610827 CTTCAGCCACTCTACAGTGCTGG - Intergenic
1177818326 21:26002610-26002632 CTCCAGAGCCTGCACTGTGCCGG + Intronic
1178244412 21:30936808-30936830 CTCCATCCTCTGCTCTGTGCTGG - Intergenic
1178532224 21:33385391-33385413 CTCCAGGCACTCCACAGGGCAGG - Intergenic
1179131213 21:38638903-38638925 CTCCAGGCTCTGCAGAGTGAGGG + Intronic
1179823590 21:43951580-43951602 CTCCTGCCCCTGCACAGAGCAGG + Intronic
1180044875 21:45300762-45300784 CGGCAGGCGCTGCACAGCGCTGG + Intergenic
1180347036 22:11711509-11711531 CTGCAGCAGCTGCACAGGGGCGG + Intergenic
1180383467 22:12162732-12162754 CTGCAGCAGCTGCACAGGGGCGG - Intergenic
1180569380 22:16701179-16701201 CTCCACACACTGCACAGGGCAGG + Intergenic
1183585925 22:38752848-38752870 CTCCAGCCGCTGCACAGTGCAGG - Intronic
1184859463 22:47165042-47165064 CTCCAGCCTCTCCACAGGGCAGG + Intronic
950422083 3:12905208-12905230 CTCCAGGCTCTGCCCAGGGCTGG - Intronic
951845051 3:27076480-27076502 CCTCAGCCCCTGCAAAGTGCTGG + Intergenic
952918244 3:38266001-38266023 CCCAAGCCACTGCACAGTGGTGG - Exonic
953610694 3:44445168-44445190 CTCTAGCCCCTGCACACTGCAGG - Exonic
962655713 3:137542376-137542398 CCCCATCCCCTGCACTGTGCTGG - Intergenic
964723563 3:159791538-159791560 CTCCAGCAGCTGCAGAAAGCTGG - Intronic
966945784 3:184776300-184776322 CCCCAGCCCCTGCACAGGGCTGG + Intergenic
968074560 3:195809400-195809422 CTCCAGCAGCTGCCCTGTGGGGG + Intronic
968186111 3:196634511-196634533 CTCCAGCCTCAGCACATGGCAGG - Intergenic
969056438 4:4405658-4405680 CTCCAGAGTCTGCACAGGGCAGG + Intronic
969306752 4:6330198-6330220 CTCCAGCCTCAGCAGAGGGCTGG - Intronic
971109481 4:23567712-23567734 CCTCAGCCTCTCCACAGTGCTGG + Intergenic
971386230 4:26142698-26142720 CTCCTGTGCCTGCACAGTGCAGG - Intergenic
973373379 4:49271033-49271055 CTGCAGCAGCTGCACAGGGGCGG - Intergenic
973387631 4:49524175-49524197 CTGCAGCAGCTGCACAGGGGCGG + Intergenic
980774568 4:137421433-137421455 CTCCACCAGCTGCCCACTGCGGG + Intergenic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
984858465 4:184216145-184216167 GTGAAGCCGCTGCACAGAGCTGG + Intronic
985477830 5:89856-89878 CTCCAGCTTCTGCACACTGGAGG + Intergenic
985520633 5:372585-372607 CCGCAGTCGCTGCACAGGGCTGG + Intronic
985694370 5:1331563-1331585 CTCCAGCGGCTGCACAGCTCAGG - Intronic
985865853 5:2513471-2513493 CTCCATCCTGTACACAGTGCAGG - Intergenic
986023583 5:3827752-3827774 CCCTGGCAGCTGCACAGTGCGGG - Intergenic
988978134 5:36535967-36535989 CTCCATCCGCTGGTCAGTGTGGG + Intergenic
997284978 5:132671519-132671541 CCTCAGCCCCTGCAAAGTGCTGG - Intergenic
997417710 5:133741718-133741740 CTCAGGCCACAGCACAGTGCGGG - Intergenic
998584659 5:143414368-143414390 CTCAAGCCTCTGCACTGGGCAGG + Intronic
1000254296 5:159523287-159523309 CTCCAGCCTCTGTCCAGTTCCGG + Intergenic
1000467694 5:161600395-161600417 CTCCAGTGGCTTCACAGTGGTGG - Intronic
1000561907 5:162799822-162799844 CTCCAGCCTCTGGAGACTGCTGG + Intergenic
1001722329 5:173866958-173866980 CTTCAGCCCCTGAACAGTGGTGG - Intergenic
1002004111 5:176217624-176217646 CTGCAGCCACTGGACAGTGCAGG - Intergenic
1002222263 5:177693016-177693038 CTGCAGCCACTGGACAGCGCAGG + Intergenic
1003668581 6:8134250-8134272 CTCCAGCCCTAGAACAGTGCTGG - Intergenic
1006610380 6:35291128-35291150 TTCCAGCCCCTGCCCAGGGCAGG + Intronic
1006796927 6:36737829-36737851 CTCCAGCCTCTGCACCATCCTGG + Intergenic
1006910348 6:37559388-37559410 CTTCATCCCCTGCACAGGGCAGG + Intergenic
1007309770 6:40936068-40936090 CTTCAGCAGCTGCCCTGTGCAGG - Intergenic
1011806713 6:91080348-91080370 CTCCAACCTCTCCACAGTTCTGG - Intergenic
1011879862 6:92011697-92011719 CTCCACCTGCAGCCCAGTGCGGG - Intergenic
1013147017 6:107403771-107403793 GTCCAGCAGCTGCACACAGCAGG + Intronic
1014883095 6:126746746-126746768 GTCCTGACGCTGCACAGAGCAGG + Intergenic
1014958637 6:127653803-127653825 CTCCAGCCCCTGCACAGGTCTGG - Intergenic
1015239579 6:131008177-131008199 GTCCAGAGGCTGCACAGAGCAGG - Intronic
1015320337 6:131865962-131865984 CTCCAGCCTGGGCACAGAGCGGG + Intronic
1019440700 7:1044784-1044806 CTCTGGCCGCTGCCCACTGCGGG + Intronic
1023079942 7:36517099-36517121 CACGAGGCGCTGCACAGGGCAGG + Intronic
1023150285 7:37195584-37195606 CTGCAACTGCTGCTCAGTGCAGG - Intronic
1023346053 7:39272311-39272333 CTCCAGCAGCTGAACTGTGATGG - Intronic
1024048444 7:45601173-45601195 CTCCACCAGCTGCACAGGGGCGG - Intronic
1024258407 7:47556732-47556754 CTTCAGGGGCTGCAAAGTGCGGG + Intronic
1025230851 7:57202479-57202501 CCGCAGGCGCTGCACAGAGCTGG - Intergenic
1025969253 7:66306963-66306985 CTTCAGCCTCCCCACAGTGCTGG + Intronic
1027501813 7:78961291-78961313 CTCGAGGGGCTGCACAGGGCAGG - Intronic
1028909077 7:96187772-96187794 CTACAAGTGCTGCACAGTGCTGG + Intronic
1029362944 7:100100555-100100577 TTCCAGCCGCTTCACAGCTCGGG + Intronic
1033663347 7:143418803-143418825 CCCCAGCCCCTGCACAGTCCTGG - Intergenic
1033953305 7:146812840-146812862 CTCCCGAGGCTGCACAGAGCAGG - Intronic
1034275872 7:149823653-149823675 CTGCAGGCGGGGCACAGTGCTGG + Intergenic
1034415470 7:150962227-150962249 CTCCAGCCTCTCCTCAGTCCTGG - Intronic
1034589363 7:152127020-152127042 CCCCTGCCGCTGCCTAGTGCTGG - Intergenic
1035394259 7:158525125-158525147 TCCCAGGCCCTGCACAGTGCTGG + Intronic
1036043961 8:5119253-5119275 CTCCAGCCTGTGCACAGAGAAGG - Intergenic
1036162790 8:6405788-6405810 CTCCAGCTGCTCCACCCTGCCGG - Intergenic
1036652427 8:10653963-10653985 CCCCAGCTGCTGCACAGTGAAGG - Intronic
1037916822 8:22777980-22778002 CACCAGCCCCTGCACAGAGGGGG + Intronic
1038251829 8:25912047-25912069 CTTCAGCTGCTGGACCGTGCAGG - Intronic
1040811659 8:51460889-51460911 CTCCAGCCCCTGCTGACTGCTGG + Intronic
1047760375 8:127949888-127949910 ATCCAGCCGCTGGGCAGGGCCGG - Intergenic
1048387994 8:133930987-133931009 CTCAAGGCTCTGCAAAGTGCAGG + Intergenic
1049035650 8:140074047-140074069 CTCCTGCCACTGCCCAATGCAGG + Intronic
1049438767 8:142599705-142599727 CGCCAGCCACTGCACAGGGCGGG + Intergenic
1049665942 8:143842625-143842647 CTCCAGCCCCTGCAGAGGTCAGG - Intergenic
1051419660 9:16877068-16877090 CTCCACCTGCAGCCCAGTGCGGG - Intergenic
1056578043 9:87870739-87870761 CCCCAGCCTCTGCACAGACCTGG - Intergenic
1056589218 9:87951989-87952011 CTCTAGCCCCTGCTCAATGCTGG - Intergenic
1057684802 9:97222150-97222172 CTGCAGCAGCTGCACAGGGGCGG - Intergenic
1058530242 9:105899440-105899462 CTCCAGCAACTGCACAGAACTGG - Intergenic
1060225406 9:121787092-121787114 CTCCTGCCGCTGCTGAGAGCTGG - Intergenic
1062197529 9:135282563-135282585 CTCCAGGCCCTGCACTGTGGGGG - Intergenic
1062680196 9:137775027-137775049 CACCAGGCGCTGGGCAGTGCAGG - Intronic
1203697086 Un_GL000214v1:109036-109058 CTGCAGCAGCTGCACAGGGGCGG - Intergenic
1203552123 Un_KI270743v1:171993-172015 CTGCAGCAGCTGCACAGGGGCGG + Intergenic
1186654796 X:11600998-11601020 TTCTAGCCTCTGCACAGTACAGG - Intronic
1193408853 X:81139645-81139667 CAGCAGAAGCTGCACAGTGCAGG + Intronic
1194045274 X:88993903-88993925 TTTCAGCCACTGCAGAGTGCAGG - Intergenic
1195460206 X:105115698-105115720 CTCCACCTGCGGCCCAGTGCGGG - Intronic
1195569841 X:106385763-106385785 CTCCAGCACCTGCCCAGTGAGGG + Intergenic
1196102193 X:111858324-111858346 CTCCAGGCTCTGGACAGTTCGGG - Intronic
1196893323 X:120310613-120310635 ATCCCGCCGCTGCAGAGGGCAGG + Intronic
1197018665 X:121659242-121659264 CTCCAGCCGCTGGCCAGCCCTGG + Intergenic
1198648705 X:138837723-138837745 GTAGAGCCGCTGCACTGTGCTGG + Intronic
1201153404 Y:11107566-11107588 CTGCAGCAGCTGCACAGGGGCGG + Intergenic