ID: 1183587126

View in Genome Browser
Species Human (GRCh38)
Location 22:38759321-38759343
Sequence CAGGAGTAGGAGAGGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183587126_1183587135 7 Left 1183587126 22:38759321-38759343 CCCCAAGGCCTCTCCTACTCCTG 0: 1
1: 0
2: 2
3: 38
4: 326
Right 1183587135 22:38759351-38759373 ACTCAGGCTGTGCCTCAGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 338
1183587126_1183587131 -9 Left 1183587126 22:38759321-38759343 CCCCAAGGCCTCTCCTACTCCTG 0: 1
1: 0
2: 2
3: 38
4: 326
Right 1183587131 22:38759335-38759357 CTACTCCTGAGCCCTTACTCAGG 0: 1
1: 0
2: 2
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183587126 Original CRISPR CAGGAGTAGGAGAGGCCTTG GGG (reversed) Intronic
900129485 1:1081379-1081401 CTGGGGCAGGACAGGCCTTGAGG - Intergenic
900467149 1:2831345-2831367 AAAGAGTAGCAGAGGCCATGAGG - Intergenic
900554003 1:3270751-3270773 CAGGAGGAGGACAGTCCTGGAGG + Intronic
901457174 1:9369698-9369720 AAGGAGAAGGAGAGTCCTGGAGG + Intergenic
901647762 1:10725841-10725863 CAGGTGTAAGAGAGTCATTGAGG + Intronic
901859662 1:12066190-12066212 CAGGAGTCAGGGAGTCCTTGGGG + Intronic
901859672 1:12066250-12066272 CAGAAGTGGGAGAAGGCTTGAGG - Intronic
902481937 1:16716744-16716766 CAGGGGTAGGGGAGGCTTTGGGG + Intergenic
904920770 1:34006324-34006346 CAGGTGTAGGTGGGGTCTTGGGG - Intronic
907129957 1:52087861-52087883 CAAGAGTAGGAGAGTGGTTGAGG - Exonic
907335968 1:53699860-53699882 TAGGATTAGGTGAGGCCATGAGG - Intronic
909767109 1:79369979-79370001 GAGGAGTTGGAGAGGACTTATGG + Intergenic
912459253 1:109820119-109820141 GAGGAGTAGGTGAGGCTTTGGGG + Intergenic
913274972 1:117128079-117128101 GAGGAGTAGGAGGTGCCTTCAGG + Intergenic
913548700 1:119895871-119895893 CAAAACTGGGAGAGGCCTTGAGG + Exonic
915115473 1:153596281-153596303 GAGAAGTAGGCAAGGCCTTGGGG - Intergenic
915125105 1:153658552-153658574 CCGTAGGAGTAGAGGCCTTGTGG - Intergenic
919501390 1:198341846-198341868 GAGGAGTAGGAGAGCGCTGGGGG + Intergenic
921217485 1:212950408-212950430 CAGGAGTAGGGGGAGCCTGGCGG - Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
923018209 1:230143097-230143119 CAGGAGTACCAGAAGCCTAGAGG - Intronic
923724650 1:236495578-236495600 CGGGAGTGGGAGGGGCCTCGAGG - Intergenic
924883312 1:248187060-248187082 CGGGAGTAGGACTGGCCTTTAGG - Intergenic
1062879983 10:970294-970316 CAGCAGTAGGAGAGTGCTTTTGG + Intergenic
1063685967 10:8237539-8237561 CAGGATTGAGAGAGGACTTGTGG + Intergenic
1063907326 10:10794739-10794761 GAAGAGTAGGATGGGCCTTGTGG - Intergenic
1066264227 10:33759865-33759887 CTAGAGTGGGAGATGCCTTGTGG + Intergenic
1068854781 10:61786299-61786321 CAGGAGGAGCAGTGGCCTTGAGG - Intergenic
1071974924 10:90945858-90945880 CTGGAGGATGAAAGGCCTTGTGG + Intergenic
1072246307 10:93547234-93547256 CTGCAGTAGGTGAGGCCATGGGG - Intergenic
1074668380 10:115758225-115758247 TTGGAGGAGGAGAGGCCTTTTGG + Intronic
1074761543 10:116670331-116670353 CGGGAGGAGGCGAGGCCTGGGGG + Intergenic
1074813666 10:117128823-117128845 AAGGAGGAGGAGAGCCCTTCAGG - Intronic
1074913072 10:117929436-117929458 GAGGAGTGGGAGAAGCCTTTTGG - Intergenic
1075709247 10:124521908-124521930 CAGGAGTCTGAGAGGCCGAGAGG + Intronic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1076469683 10:130709856-130709878 CAGGAGGCAGACAGGCCTTGGGG + Intergenic
1076939166 10:133590388-133590410 CAGGAGAGGGCCAGGCCTTGGGG - Intergenic
1077301047 11:1847143-1847165 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
1077896643 11:6458000-6458022 GAGGAGGAGGAGAGGCATTGGGG - Intronic
1080408588 11:32001939-32001961 CACGAGCAGGAGAGGCTTTCTGG + Intronic
1080946179 11:36978109-36978131 CAGGAGGAGGAGAAGAGTTGCGG + Intergenic
1084761369 11:71273561-71273583 CAGGAGTAAGTGAGGACTGGTGG - Intergenic
1085177789 11:74506104-74506126 AAGGGGTAGGGGAGGCATTGTGG - Intronic
1085445740 11:76599473-76599495 CAGGAGTCAGAGAGACCTGGAGG + Intergenic
1086376004 11:86201351-86201373 AAGCAGTGGGAGAGGCCTGGAGG + Intergenic
1086432275 11:86747424-86747446 CAGTTGTAGGAGAGACCCTGGGG + Intergenic
1087220565 11:95542341-95542363 CCAGAGGAGAAGAGGCCTTGAGG + Intergenic
1087282680 11:96229406-96229428 CAGGGGTGTGAAAGGCCTTGGGG - Intronic
1089061862 11:115632269-115632291 GAGGAATGGGAGAGGGCTTGGGG + Intergenic
1089067402 11:115672363-115672385 CTGCAGAAGGAGAGGGCTTGGGG + Intergenic
1089182188 11:116590639-116590661 AAGGAGTAAGAGAGGTCATGGGG - Intergenic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1089782667 11:120884534-120884556 CAGGAGAGGGAGAGGCTGTGGGG - Intronic
1089803374 11:121058141-121058163 CAGAGGTAGGAGAGGCTATGGGG + Intronic
1090341972 11:126031868-126031890 AAGGAGGAAGAGAAGCCTTGAGG - Intronic
1090648043 11:128781886-128781908 CAAGAGTAGGAGATGACATGAGG - Intronic
1090960610 11:131553165-131553187 AAGGGGCAGGAGAGGCCATGAGG + Intronic
1090982571 11:131736348-131736370 CAGCAGTAGAAGAAGCCTGGAGG - Intronic
1091224361 11:133948805-133948827 CAGGAGGAACAGAGGCCTAGGGG + Intronic
1093306544 12:17527733-17527755 CAAGAGTAGTGGAGGCTTTGTGG + Intergenic
1093787744 12:23212337-23212359 ATAGAGTAGGAGAGGCCTTGTGG + Intergenic
1093867602 12:24247467-24247489 CAGGAATAGGAGAGAACTTGGGG + Intergenic
1094120525 12:26969385-26969407 AATGAGAAGGGGAGGCCTTGAGG + Intergenic
1094145764 12:27226840-27226862 CAGGAATAGGACAGGCCATGGGG + Intergenic
1097715715 12:62963628-62963650 TAGGACTGGGGGAGGCCTTGAGG + Intergenic
1099847367 12:88044781-88044803 CAGGAAGAGGAGAGGGCATGGGG + Intronic
1104783842 12:131437447-131437469 CAGGAGGAGGAGGGGCCTGTGGG - Intergenic
1105460860 13:20585206-20585228 CAGAAGTGGGAGTGGTCTTGTGG - Intronic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1107631752 13:42350136-42350158 CAGAAGGAGGAGAGTCATTGAGG - Intergenic
1107885809 13:44873391-44873413 CAGGAGAGGGAGAGGCCTGTAGG - Intergenic
1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG + Intergenic
1109003723 13:56840952-56840974 GAGGAGAAGGAGCTGCCTTGAGG + Intergenic
1109202418 13:59445621-59445643 CAGAAGTAAGAGAGGTGTTGAGG + Intergenic
1110716785 13:78714848-78714870 CTGGTGTGGGAGAGGCTTTGTGG + Intergenic
1112212031 13:97387503-97387525 CAGGGGAAGGCGAGGCCCTGGGG - Intronic
1113661274 13:112107854-112107876 CGGGTGCAGGAGAGGCCTTGGGG - Intergenic
1113707034 13:112441711-112441733 CAGGAATAGCAGAGGCCTCCTGG - Intergenic
1113868946 13:113546362-113546384 CCGGGGTAGGAGGGGCCGTGGGG + Intronic
1118686020 14:68292028-68292050 CAGGAGGTGGAGAGGCAGTGGGG - Intronic
1119599646 14:75966926-75966948 CAGGTGTAGGAGAGGTCATGGGG + Intronic
1119614713 14:76091504-76091526 CAGGAGCAGGAAAAGCCTTCAGG - Intergenic
1120298550 14:82676701-82676723 CTGCAGGAGGAGAGGCCATGTGG + Intergenic
1120855069 14:89205270-89205292 CATGAGGAGGTGAGGCCTTTGGG + Intronic
1121739551 14:96241782-96241804 CAGGAGTGGAGGAGGCCTGGGGG + Exonic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122783294 14:104152807-104152829 ATGGAGTAGGAGGGCCCTTGTGG + Intronic
1122798161 14:104216698-104216720 CTAGACTGGGAGAGGCCTTGGGG - Intergenic
1122860658 14:104580988-104581010 CAGGAGCAGGAGCTGCCTGGTGG - Intronic
1122965639 14:105123938-105123960 CTGGAGGATGAGAGGCATTGTGG + Intergenic
1122976905 14:105174518-105174540 CCGGAGGTGGGGAGGCCTTGGGG - Intronic
1123692505 15:22850309-22850331 CAGAAGTAAGAGAGGCCTCTAGG + Intronic
1124373279 15:29115403-29115425 CAGGAGGAGGAGGGGCCAGGCGG + Intronic
1124873980 15:33573367-33573389 CAGGAGGAGGGGTGGCCTTCTGG + Intronic
1125205675 15:37151368-37151390 CAGAAGTAAGAGAGGCCAGGTGG + Intergenic
1125460942 15:39906279-39906301 CAGTAGTAGGAGTGGGGTTGTGG - Intronic
1125609351 15:40960301-40960323 CAGGTGTTGGCGAGGCCTGGAGG + Intergenic
1128475668 15:67995095-67995117 GAGGAGAAGGAGATGCTTTGGGG + Intergenic
1128735962 15:70054218-70054240 CAGGAGTTGGAGAGGGCTCTGGG - Intronic
1128856477 15:71021769-71021791 CTGGAGTATGAGAGACCATGTGG - Intronic
1128960033 15:71993061-71993083 AAGGAGTAGGCCAGGCCTGGTGG + Intronic
1128994743 15:72288269-72288291 CAGAGGTGGGAGAGGCCTAGGGG + Intronic
1129028589 15:72602794-72602816 GGGGAGAAGGAGAGTCCTTGAGG - Exonic
1129451049 15:75651581-75651603 CAGGAGTTGGATAGGCCATGTGG - Intronic
1129774697 15:78228849-78228871 CAGGAGTAGGAGTTGGCTAGGGG - Intronic
1130053356 15:80502460-80502482 CAGGAGGAGGAGAGACCCAGAGG + Intronic
1130783367 15:87069130-87069152 CAGTTGTATCAGAGGCCTTGAGG + Intergenic
1131215401 15:90530989-90531011 CAGGAGTGGGGCTGGCCTTGAGG + Intronic
1131849318 15:96522061-96522083 CAGGAGTTTGAGAGCACTTGAGG + Intergenic
1132065219 15:98725481-98725503 CAGGAGTTGGAGAAGCACTGTGG - Intronic
1132582887 16:693612-693634 AAGGAGGAGGAGAGGCCGCGTGG + Exonic
1134107116 16:11493087-11493109 CAGGAGCAGGTGAGGCCCAGAGG + Intronic
1136394862 16:29987310-29987332 CAGGAGTAGGAAAAGACTGGAGG - Exonic
1137606155 16:49788072-49788094 CAGGACTAGGACAGGCCTTGGGG - Intronic
1139172443 16:64648122-64648144 GAGGAGTATGACAAGCCTTGAGG - Intergenic
1139653345 16:68373552-68373574 CAGGAGGAGGAGAGGGTGTGGGG - Intronic
1141161416 16:81631325-81631347 CAGGAGGAGGATGGGCCTTTTGG + Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1141749084 16:85946377-85946399 CAGGAGGAGGAGGAGCTTTGGGG - Intergenic
1142742835 17:1940959-1940981 CTGCAGCAAGAGAGGCCTTGCGG + Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1146366774 17:32234963-32234985 CAGTATTAGGTGAGGCCTTTTGG - Intronic
1146661169 17:34666012-34666034 CAGGAGGAGGTGGGGCCTGGAGG + Intergenic
1146708925 17:35023887-35023909 CAGGAACAGGATAGGGCTTGAGG + Intronic
1146943629 17:36860025-36860047 GAGGAGTACCAGAGGCCTTCTGG - Intergenic
1147157086 17:38549390-38549412 CAGGAGAGGGACAGGGCTTGGGG - Intronic
1148748986 17:49934105-49934127 CTGGGGCAGGAGAGGCCTTGGGG - Intergenic
1150309384 17:64115398-64115420 CAGGAGTTTTACAGGCCTTGGGG - Intronic
1151247422 17:72805537-72805559 CAGGAGTGCGGGAGGCCTGGTGG + Intronic
1151524908 17:74658401-74658423 CAGGAGGAGGAGACGCCAAGGGG - Intergenic
1152261656 17:79270469-79270491 CAGGAGAAGGGGAGGCATGGTGG - Intronic
1152311865 17:79556364-79556386 CAGGAGGAGGAGTGCCCGTGTGG + Intergenic
1152336865 17:79703652-79703674 CAGGAGCAGGAGAGACGTCGAGG + Intergenic
1152371915 17:79893490-79893512 CTGGAGTGGGAGAGGTCTGGGGG + Intergenic
1152486945 17:80600721-80600743 CAGTAATCGGACAGGCCTTGGGG + Intronic
1154071593 18:11157377-11157399 CAGGAGTAAGAAAGGGCATGAGG + Intergenic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1156733431 18:40223723-40223745 CAGGAGTCAGAGAGGTCTTGAGG + Intergenic
1157599496 18:48885411-48885433 CAGGAGGAGAAGAGGCATGGCGG + Intergenic
1162806154 19:13138917-13138939 CTGGGGTAGGCGAGGCCGTGGGG + Exonic
1165075136 19:33276240-33276262 CAGGGGGTGGAGAGGCCATGAGG - Intergenic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165461825 19:35948449-35948471 CTGGAGGAGGGGAGGCCTGGCGG + Intergenic
1165687825 19:37837484-37837506 TAGGAATAGAAGAGGCCTTGGGG + Intergenic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1167154392 19:47729482-47729504 CTGGATCAGGACAGGCCTTGGGG + Intronic
1167322375 19:48805271-48805293 CAGGAGGAGGAGCGGCTTTGTGG - Intronic
1167676356 19:50888385-50888407 CAGGAAGAGGAGAAGCCTTGGGG - Intergenic
1167726835 19:51220496-51220518 CAGAAGGAGGCGAGGCCATGTGG - Intergenic
924971162 2:128198-128220 CAGGGGCAGCAGAGGCCCTGGGG + Intergenic
925032015 2:658011-658033 CAGCACTAGGAGCTGCCTTGGGG + Intergenic
925039163 2:716813-716835 GAGGAGGAGGGGAGGCCTTGGGG + Intergenic
925687135 2:6483964-6483986 CAGGGTTAGGAAAGGCCTTCTGG + Intergenic
925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG + Intergenic
926055839 2:9773471-9773493 CAGGAGCTGGAGGGGGCTTGGGG - Intergenic
926456853 2:13077178-13077200 ATGGAGTAGGAGAGACGTTGAGG + Intergenic
926719319 2:15947619-15947641 CAGGTGCAGGAGAGACCCTGGGG + Intergenic
926871213 2:17419871-17419893 CAGGAGTAGCAGTGGCCTGGAGG - Intergenic
928624423 2:33125168-33125190 CAAGTGTAGGAGAGGCATTGGGG + Intronic
929179169 2:39015604-39015626 CGGGAGTAGGTCAGGCCTAGGGG - Intronic
929572277 2:43030141-43030163 CAGGAGTTGCAAAGGCCCTGAGG - Intergenic
929874649 2:45786559-45786581 CAGGAACAGGACAGGCCTTAGGG + Intronic
929955364 2:46454143-46454165 CATGTTTAGGAGAGTCCTTGAGG - Intronic
930158314 2:48127730-48127752 CAGGAGGAGGAGGAGGCTTGAGG + Intergenic
930422865 2:51176383-51176405 AAGCAGCAGGAGAAGCCTTGTGG + Intergenic
930696555 2:54417226-54417248 CAGAAGTAGGAGGGGCCAGGAGG + Intergenic
931214208 2:60226280-60226302 CAGGGTTAGGAGAGCCCTAGAGG - Intergenic
931653215 2:64487528-64487550 CATCGGTAGGAGAGGCCTTCTGG - Intergenic
931998805 2:67864598-67864620 AAGATATAGGAGAGGCCTTGGGG - Intergenic
932445145 2:71776149-71776171 CATGAGGAGCAGAGGCCATGAGG - Intergenic
934815577 2:97323468-97323490 CAGGGGAGGGAGAGGCCCTGGGG + Intergenic
934822118 2:97385015-97385037 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
935702184 2:105822257-105822279 CAGGAGCAGCAGAGGCCCTCGGG - Intronic
935929765 2:108111814-108111836 CAGGAGCAAGACAGGCCTGGTGG + Intergenic
936720998 2:115253156-115253178 CAGGAGCAGGAGAGGGAGTGGGG + Intronic
936946094 2:117932434-117932456 CAGCATTGGGATAGGCCTTGGGG - Intronic
937856927 2:126678887-126678909 CAGGAGCAGCAGAGCCCGTGTGG - Intronic
938316607 2:130333660-130333682 CAGGAGAAGGAGAGGACACGTGG + Intergenic
938342858 2:130547054-130547076 TTAGAGCAGGAGAGGCCTTGGGG - Intronic
938346975 2:130573668-130573690 TTAGAGCAGGAGAGGCCTTGGGG + Intronic
938453976 2:131445950-131445972 GAGGAGAAGGCGAGGCCTAGGGG + Intergenic
940226864 2:151409860-151409882 CGGGAGTAGGTTAGGCCTGGCGG - Intergenic
945403669 2:209420784-209420806 AAGGAGTAGGTGAGCCTTTGAGG - Intergenic
946448173 2:219757562-219757584 CAGGAGTAGCAGAGGGCTGTGGG - Intergenic
948207509 2:236170004-236170026 GAGGAGGAGGAGAGGGCTGGCGG - Intergenic
948742008 2:240054337-240054359 CAGGAGCAAGAGAGGCAGTGAGG - Intergenic
1169117900 20:3078000-3078022 CAGGAGGATGAGAGACCATGTGG + Intergenic
1169528317 20:6454916-6454938 CAGGAGGAGGCCAGGCGTTGTGG - Intergenic
1170601397 20:17844053-17844075 CAGGAGTAGGAGGAGCCATGAGG - Intergenic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1172286701 20:33745779-33745801 CAGCAGATGCAGAGGCCTTGAGG + Intronic
1173015346 20:39220448-39220470 CAGGAGTAGGGGCAGGCTTGTGG - Intergenic
1173146010 20:40524898-40524920 CTGGAGTGTGAGTGGCCTTGAGG - Intergenic
1173576086 20:44113679-44113701 CAGGGCCAGGAGAGGCCTCGGGG - Intronic
1173837284 20:46134356-46134378 CAGGAGTTGAAGAGCCCCTGGGG + Intergenic
1174454576 20:50640193-50640215 CTGGAGTGGCAGAGGCCCTGTGG - Intronic
1174472221 20:50769528-50769550 CTGGAGTGGCAGAGGCCCTGTGG + Intergenic
1174555022 20:51388369-51388391 CAGGAGAAGGAATGGCTTTGTGG - Exonic
1175777583 20:61662970-61662992 GGGGAGGAGGAGAGGCCCTGAGG - Intronic
1175930591 20:62492056-62492078 CAGCAGTAGCGGAGGCCTGGAGG + Intergenic
1175972222 20:62692299-62692321 CAGGCATAGGAGGGGCCTTGTGG - Intergenic
1176048327 20:63103852-63103874 CAGGAGTGTGAGGGGCCTGGGGG - Intergenic
1176064434 20:63187387-63187409 CAGGAGCAGGCGAGGGCATGGGG - Intergenic
1176213038 20:63934531-63934553 GAGGCGTAGGAGCGGCCCTGCGG + Exonic
1176862335 21:14017586-14017608 CAGGAGTGGGAGAGGCCAAAGGG + Intergenic
1177157926 21:17517412-17517434 CAAGAGTAGGAGAGTGGTTGAGG + Intronic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1177677798 21:24324668-24324690 CAGCAGTAGCAGAGGCTTTTAGG - Intergenic
1179030971 21:37719111-37719133 CAGGAGGAGGAGAGGGTGTGGGG + Intronic
1179536332 21:42055224-42055246 GAGGATTAGGAGTGGCCTTTGGG + Intergenic
1179540438 21:42079990-42080012 CAGGAGTTGCAGAAGCCTCGTGG - Intronic
1179936117 21:44604210-44604232 GAGGAGTGGGGAAGGCCTTGTGG + Intronic
1180127568 21:45802682-45802704 CATGGGGAGGAGAGGCCCTGAGG + Intronic
1180815002 22:18783815-18783837 CAAGAGCAGGAGAGTCCCTGGGG - Intergenic
1181093275 22:20488865-20488887 AAGGAGTAGGGGAGGCTCTGAGG + Intronic
1181130303 22:20727297-20727319 GAGAAGTAGGAGAGGCCTGTGGG + Exonic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1181201190 22:21218152-21218174 CAAGAGCAGGAGAGTCCCTGGGG - Intronic
1181688248 22:24543700-24543722 CAGGAGGAGCAGGGGCTTTGGGG + Intronic
1181700552 22:24618815-24618837 CAAGAGCAGGAGAGTCCCTGGGG + Intronic
1182409053 22:30166783-30166805 AAGGAGCAAGAGAGGCTTTGTGG + Intronic
1182576309 22:31275395-31275417 CAGGGGTGAGAGAAGCCTTGAGG + Intronic
1183382525 22:37497290-37497312 CAGAAGATGGAGAGGCCTGGGGG - Intronic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1183593274 22:38794054-38794076 CAGGAGCAGGTGAGGCCCCGGGG - Exonic
1183701058 22:39451289-39451311 CAGTAGCAGTAAAGGCCTTGAGG + Intergenic
1183708634 22:39489762-39489784 CAGTTGTAGGTGTGGCCTTGAGG + Exonic
1183948740 22:41340961-41340983 CAGGAGTAGGAGAGGATGTGTGG + Intronic
1184136002 22:42550220-42550242 CTGGAGTAACAGAGGCATTGAGG - Intergenic
1184259901 22:43308749-43308771 GAGGAGTAGGAGGGGCCCTCGGG - Intronic
1203225723 22_KI270731v1_random:77279-77301 CAAGAGCAGGAGAGTCCCTGGGG + Intergenic
1203265105 22_KI270734v1_random:9505-9527 CAAGAGCAGGAGAGTCCCTGGGG - Intergenic
949204318 3:1420188-1420210 CAGGAATGGTAGAGGACTTGGGG - Intergenic
950431661 3:12954421-12954443 CAGGGCTGGGAGAGGCCCTGGGG + Intronic
950796192 3:15512306-15512328 CAGCTGAAGGAGAGGCCTCGTGG - Intronic
952190171 3:31014698-31014720 CTGGAGCAGGAGAGGCCTTGTGG + Intergenic
952843326 3:37666555-37666577 CTGGAGGAGGAGAGACCATGCGG - Intronic
953034710 3:39201714-39201736 CAGGAGTCCCAGAGGCCATGTGG + Intergenic
953387134 3:42513057-42513079 CAGAAGCAGGGGAGGCCTGGTGG + Intronic
956158800 3:66326147-66326169 CAGGAGAAGGATAGGCTTTGGGG + Intronic
956800558 3:72754228-72754250 CAGGGGTAGGAGAGCCGCTGAGG + Intronic
961800334 3:129443244-129443266 CAGGAATTGGAGAGGCACTGTGG + Intronic
962528717 3:136258770-136258792 AAGGTGAAGGAGAGGCCCTGTGG + Intronic
963006196 3:140728221-140728243 CTGGAGCAGGTGAGGCTTTGGGG - Intergenic
966837298 3:184059057-184059079 GGGGAGTGGGGGAGGCCTTGGGG - Intronic
967992892 3:195144721-195144743 AAGGAGTAGTAGAATCCTTGAGG - Intronic
968514533 4:1010686-1010708 CAGGATGAGGGGAGGCCATGGGG + Intronic
968750871 4:2388306-2388328 CAGTATTAGGAGTGACCTTGAGG - Intronic
968891574 4:3372177-3372199 CTGGAGGAAGAGAGCCCTTGTGG + Intronic
968919423 4:3515030-3515052 CCGGGGCAGGACAGGCCTTGCGG + Intronic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
969410075 4:7022244-7022266 CAGGGGCTGGAGAGGCCATGGGG + Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
969985446 4:11204233-11204255 AAAGAGTAAGAGGGGCCTTGTGG - Intergenic
972504651 4:39709130-39709152 GAAGATTAGGAGAGTCCTTGCGG + Intronic
972684897 4:41342746-41342768 CATGAGGAGGTGAGGCCTTTGGG + Intergenic
973778124 4:54262352-54262374 CAGGAGTAGGCCAGGCCCAGTGG - Intronic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
983307338 4:166007865-166007887 CAGGTGTAGGAAAGGCCTTCTGG + Intronic
984140634 4:176001199-176001221 CAAGAGTAAAGGAGGCCTTGGGG - Intronic
985521485 5:375924-375946 CAGGAGTGGGAGTGTCCTTGGGG + Intronic
986063054 5:4209698-4209720 CAGAGTTAGGAGAGGCATTGTGG + Intergenic
986725771 5:10595198-10595220 CAGGTGGAGGAGCGGCCTGGGGG + Intronic
987148186 5:15012895-15012917 CAGGAGTAAGAGAGGAATTCTGG + Intergenic
990319641 5:54617179-54617201 CATGGAAAGGAGAGGCCTTGCGG - Intergenic
992527938 5:77630066-77630088 CAGGCGGAGGGGAGGCCTCGCGG + Exonic
994685200 5:102942239-102942261 CAGGAGTAGGAGATTATTTGGGG - Intronic
996235139 5:121118860-121118882 AAGGAGAAGGAGAGACCTGGTGG + Intergenic
997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG + Intergenic
998446258 5:142200641-142200663 CATGGGGAGGAGAGGCCTGGCGG + Intergenic
998451141 5:142235585-142235607 CAGGAGGAGGGGGGGCCTGGGGG - Intergenic
999072670 5:148763400-148763422 CAGGTCTCAGAGAGGCCTTGTGG + Intergenic
999076735 5:148803538-148803560 CAGGAGGAGGAGAAACCATGTGG + Intergenic
999076762 5:148803798-148803820 CAGGAGGAGGAGAAACCATGTGG + Intergenic
999327306 5:150651115-150651137 CAGGAGAAGGAGAGCCCTGTAGG + Exonic
1000089189 5:157915471-157915493 CAGGAGTTGGAGAGGAAATGGGG - Intergenic
1000459549 5:161497775-161497797 AAGGAGACAGAGAGGCCTTGGGG + Intronic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1001100956 5:168813959-168813981 CAGGAGGAAAAGAGGCATTGGGG - Intronic
1001209499 5:169796821-169796843 CAGGAGAAGGAGAGAGTTTGTGG + Intronic
1002049522 5:176562252-176562274 CTGGAGGAAGGGAGGCCTTGAGG + Intronic
1002070898 5:176678461-176678483 GAGGAGAGGGAGAGGCCTGGAGG + Intergenic
1002272822 5:178083864-178083886 CCTGAGTGGGAAAGGCCTTGAGG + Intergenic
1002410223 5:179068909-179068931 CATGCGCAGGAGAGGCCATGTGG - Intronic
1003157041 6:3605499-3605521 TAGGATTATGAGAGGCCTTGGGG - Intergenic
1003901389 6:10659024-10659046 CTAGAGGATGAGAGGCCTTGTGG - Intergenic
1005767720 6:29030108-29030130 CAGGAGCAGGAGATGACTTGAGG + Intergenic
1006589735 6:35145724-35145746 CAAGAGTAGGAGAAGGGTTGAGG + Intronic
1007241463 6:40429251-40429273 GAGGAGGAGGACAGGGCTTGGGG - Intronic
1008522318 6:52374034-52374056 CAGGAGTAAGAGAGGGAGTGGGG - Intronic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1014034857 6:116754580-116754602 CAGGAGTTGGAGATATCTTGAGG + Intronic
1014479710 6:121920853-121920875 CTGGGGTAGGAAAGGCCATGTGG - Intergenic
1014824317 6:126031592-126031614 CAGAAGCATGAGAGGCATTGTGG + Intronic
1015579155 6:134704588-134704610 CAGCAGGGGGAGAGGCCATGAGG + Intergenic
1015726603 6:136305929-136305951 CATGAGGTGGGGAGGCCTTGAGG + Intergenic
1017018124 6:150117498-150117520 CAAGAGTGGCAGAGGCCTTGGGG - Intergenic
1018048811 6:159989482-159989504 CAGGAGTTGTGGAGGCCCTGGGG - Intronic
1018163395 6:161069851-161069873 GAGGAGAAGCAGGGGCCTTGGGG + Intronic
1018735021 6:166681459-166681481 TAGGGGTAGGAGATGCCGTGTGG - Intronic
1019262405 7:88795-88817 CAGGAGGGGGAGCGGCCTTCGGG - Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1019521449 7:1462306-1462328 CAGGAGTTGTAAAGGCCCTGCGG + Intergenic
1021873690 7:25028963-25028985 CAGGTGGAAGAAAGGCCTTGGGG + Intergenic
1024577976 7:50780399-50780421 CAGAATGAGGGGAGGCCTTGAGG - Intronic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1026655478 7:72252743-72252765 CAGGAGTAGGAGTAGCATGGAGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029063739 7:97826825-97826847 AAGAAGTAGGAGAGCACTTGAGG + Intergenic
1029632624 7:101762634-101762656 CAGGAGCAGGGGATGACTTGTGG + Intergenic
1030309941 7:108059023-108059045 CAGCAGTACGACAGGCCTCGGGG - Intronic
1030435996 7:109521420-109521442 CAGGAGCAGGAGAAGACTTGAGG - Intergenic
1035654191 8:1293236-1293258 CAGGAGAGGGAGAGGGCATGTGG - Intergenic
1036600529 8:10256477-10256499 CTGGAGTGGGGGAGGCCTGGAGG + Intronic
1038578902 8:28729789-28729811 CAGGAGTTCGAGACGCCTGGGGG + Intronic
1038797512 8:30722933-30722955 CAGCAGTTGGAGAGGCCTAGGGG - Intronic
1040299898 8:46182505-46182527 CTGGGATAGGAGAGGCCTTTTGG + Intergenic
1041067289 8:54094274-54094296 GAGGAGGAGGAAAGGCCTGGTGG - Intronic
1041389806 8:57338384-57338406 CAGCCCTTGGAGAGGCCTTGGGG - Intergenic
1041566896 8:59288858-59288880 CAGCAGAAGGAGAGGCAATGTGG - Intergenic
1042864901 8:73348673-73348695 CAGGAATAGCAGAGTCCTAGGGG + Intergenic
1043992542 8:86773709-86773731 CAGGAGTGTGAATGGCCTTGAGG + Intergenic
1044318456 8:90776033-90776055 CTGGAGTAGGAAAGGCCAAGTGG - Intronic
1045320832 8:101080474-101080496 CTGGAGTAGGAGTGGCCTTCAGG + Intergenic
1045326731 8:101122856-101122878 TAGGAGTAGGTGAGGTCATGAGG - Intergenic
1045388851 8:101695217-101695239 CAGGAGTTGCAGAGGTGTTGCGG + Intronic
1045872217 8:106939867-106939889 CAGGGGTAGCAGTGACCTTGTGG - Intergenic
1046521855 8:115335187-115335209 CAGGACCAGGAAAGACCTTGGGG - Intergenic
1046525648 8:115379000-115379022 TAGGAGTAGGAGAGGTTTAGGGG - Intergenic
1047309937 8:123683487-123683509 CGGCAGCAGGAGAAGCCTTGGGG - Intronic
1048610515 8:136017143-136017165 AAGCTGTAGGAGAGGACTTGTGG + Intergenic
1049106977 8:140620141-140620163 CAGGAGGAAGAGGGGCCTTCAGG + Intronic
1049148528 8:141019636-141019658 CAGGAGCAGGAGCAGCCTGGTGG - Intergenic
1049399679 8:142419346-142419368 CAGGTGCAGCAGGGGCCTTGGGG + Intergenic
1049585943 8:143432438-143432460 CAGCCCCAGGAGAGGCCTTGGGG + Intergenic
1049593541 8:143473244-143473266 CAGGAGTGGGAGGGGGCGTGAGG - Intronic
1051094168 9:13446228-13446250 GAAGAGAAGTAGAGGCCTTGAGG - Intergenic
1053107690 9:35426212-35426234 CAGGAGGAGAAGAGGAATTGGGG - Intergenic
1053463895 9:38290967-38290989 CAGGAGTATGAGAGGCAGAGAGG + Intergenic
1055823773 9:80300340-80300362 CAGGAGGAGAAGAGGCATTCTGG + Intergenic
1061140908 9:128765942-128765964 CTGGAGACAGAGAGGCCTTGAGG + Intronic
1061178714 9:129011915-129011937 CAGGAGGTGGAGGGGCCCTGGGG + Intronic
1061388761 9:130305751-130305773 CAATAGTAGGGCAGGCCTTGGGG + Intronic
1061566631 9:131445037-131445059 CTTGAATGGGAGAGGCCTTGGGG - Intronic
1061880357 9:133565907-133565929 CAGCAGTGGGAACGGCCTTGGGG - Intronic
1062501567 9:136854153-136854175 CAGGAGTGGGAGAGCACTCGGGG - Intronic
1062621792 9:137426113-137426135 CAGGAGCAGGAGGGGCTGTGGGG + Intronic
1185645067 X:1610129-1610151 CAGGGGCAGGAGTGGCCTGGAGG - Intergenic
1186043859 X:5511999-5512021 AAGGAGTAGGAGAGCCTTCGTGG + Intergenic
1187013386 X:15302565-15302587 CAGGAGGAGGAGAGGCAGTGAGG + Intronic
1187762783 X:22606278-22606300 GAAGACTAGCAGAGGCCTTGGGG + Intergenic
1188707112 X:33348208-33348230 CAGGAGTAGGCCAGGCATGGTGG - Intergenic
1189212554 X:39296213-39296235 CAGGAGTGGGCTAGGCATTGTGG - Intergenic
1189411930 X:40780125-40780147 CCACAGTAGGAGAGGCCATGAGG - Intergenic
1190333530 X:49249717-49249739 GAGGAGCAGGTGAGGCCTGGGGG + Exonic
1191214031 X:57917109-57917131 CAGGTGAAGGAGAGGTCTTTAGG + Intergenic
1192795441 X:74421447-74421469 GAGGAGGAGGAGAGGGCTCGAGG + Exonic
1194280073 X:91940162-91940184 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1198314453 X:135452120-135452142 CAGAACTGGGAGAGGGCTTGAGG - Intergenic
1199300339 X:146205901-146205923 CTGAAATAGGAGTGGCCTTGAGG + Intergenic
1199351626 X:146809360-146809382 AATGAGTAGGTGTGGCCTTGGGG + Intergenic
1199352281 X:146815133-146815155 AATGAGTAGGTGTGGCCTTGGGG - Intergenic
1200597548 Y:5163663-5163685 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1200933999 Y:8722410-8722432 CAGGAGGAAGAGAGGCAGTGAGG - Intergenic
1201519472 Y:14857636-14857658 CAGTTGGAGGAGAGGCCTAGTGG + Intergenic