ID: 1183588307

View in Genome Browser
Species Human (GRCh38)
Location 22:38765896-38765918
Sequence CTGCTCTCATCCAGTGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183588303_1183588307 2 Left 1183588303 22:38765871-38765893 CCAATGAGCTGGGAGTCAGTAGC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1183588307 22:38765896-38765918 CTGCTCTCATCCAGTGCTCTAGG 0: 1
1: 0
2: 1
3: 20
4: 267
1183588302_1183588307 3 Left 1183588302 22:38765870-38765892 CCCAATGAGCTGGGAGTCAGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1183588307 22:38765896-38765918 CTGCTCTCATCCAGTGCTCTAGG 0: 1
1: 0
2: 1
3: 20
4: 267
1183588301_1183588307 6 Left 1183588301 22:38765867-38765889 CCACCCAATGAGCTGGGAGTCAG 0: 1
1: 0
2: 6
3: 312
4: 2493
Right 1183588307 22:38765896-38765918 CTGCTCTCATCCAGTGCTCTAGG 0: 1
1: 0
2: 1
3: 20
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183588307 Original CRISPR CTGCTCTCATCCAGTGCTCT AGG Intronic
900516156 1:3083188-3083210 CTGCGCTCATCCAGTGGTCTCGG - Intronic
900818488 1:4868639-4868661 CAGCTCTCACCCAGTGTTTTGGG + Intergenic
900950542 1:5856038-5856060 GCCCTCTCATCCAGTGCTCATGG - Intergenic
901092805 1:6653508-6653530 CAGCTCTCATCCTGAGCCCTGGG - Intronic
901505257 1:9681114-9681136 GTGCTCTCATCTCTTGCTCTGGG - Intronic
902194362 1:14787423-14787445 CTGCTCTCAGCTAGTGTACTTGG + Intronic
902727193 1:18344992-18345014 CTCCTCCCCTTCAGTGCTCTGGG - Intronic
903424953 1:23246585-23246607 CTGCTCTCTTCCTGTGATCCTGG + Intergenic
904866235 1:33581077-33581099 CAGCTCTAAAGCAGTGCTCTAGG + Intronic
905545318 1:38793260-38793282 CTGCTCTGACCCAGTGATTTTGG - Intergenic
905872508 1:41413142-41413164 CTCCTCTCCACCAGAGCTCTGGG - Intergenic
905883531 1:41479551-41479573 CTGCTCTCATGGGGAGCTCTTGG - Intronic
905969255 1:42128783-42128805 CAGCTCTGATCCACTGCTCTGGG - Intergenic
906034014 1:42739875-42739897 CTGCACTTGCCCAGTGCTCTGGG + Exonic
906281138 1:44554676-44554698 CTGCTCTGATGCAGGGCACTGGG - Intronic
909151664 1:72013372-72013394 ACAGTCTCATCCAGTGCTCTGGG + Intronic
909519423 1:76549805-76549827 CTTCTCTCATCCACTGCTTGTGG - Intronic
911165341 1:94719810-94719832 CTGCTCCCAACCAGTTCTTTAGG + Intergenic
911750470 1:101490925-101490947 CTTGTCTCATCCAGTTCTCAAGG + Intergenic
912459855 1:109823452-109823474 CTGCTCTCATCCAGTCATCAGGG + Intergenic
912472860 1:109917480-109917502 CTGCCCTCACTCAGTGCTCCAGG - Intronic
912781232 1:112550267-112550289 CTGCTCTCATCAAATGATTTGGG + Intronic
914344349 1:146785644-146785666 CTGCTCTGAACCAGTCCCCTTGG + Intergenic
915563599 1:156701636-156701658 CTGCTCTCTTTCATTGCTGTGGG - Intronic
915815811 1:158963341-158963363 CTGCTATCAGCCAGTGCAATTGG - Intronic
918179036 1:182070186-182070208 CAGCTCTGATTCAGTGCTCTTGG - Intergenic
918742236 1:188147150-188147172 CTGCCCTCATTCCTTGCTCTTGG + Intergenic
919099893 1:193082582-193082604 TTGCTCTCTTCCAATGATCTGGG + Exonic
921568428 1:216749223-216749245 CTGGTGCCATCCAGTGCGCTGGG + Intronic
923768334 1:236913724-236913746 CTGGTCTCATCTTGTCCTCTAGG - Intergenic
1062983184 10:1743058-1743080 CTGCTGTCACACAGTGCTCTGGG - Intergenic
1063620459 10:7642697-7642719 CTGCTCTCATCAGGGGCTTTTGG - Intronic
1064436187 10:15313143-15313165 GTGCTCCCATCCAGTGCCCTGGG - Intronic
1064705555 10:18069447-18069469 CTGTTCTCATTTAGTGCTGTGGG - Intergenic
1064952650 10:20871353-20871375 CTGCTATAAACCAGTGTTCTGGG + Intronic
1065946236 10:30607815-30607837 CTGCTCTCAGCCTGAGCCCTGGG + Intergenic
1067187616 10:44043847-44043869 CTGCTCTCACCCAGGGAGCTGGG + Intergenic
1067794089 10:49308142-49308164 CTGCTCACATCCAGTTCTGTGGG + Intronic
1067811670 10:49432418-49432440 CTCCTTTCCTTCAGTGCTCTAGG - Intergenic
1068583272 10:58766893-58766915 CTAATCTCCTCCAGTGTTCTCGG - Intronic
1068963515 10:62888930-62888952 CTGCTGTCCACCAGTGCTCCAGG - Intronic
1070664802 10:78335605-78335627 CTGCTCTCATGCAGTGTTTAGGG + Intergenic
1071151270 10:82637850-82637872 TTGCTATCATCGAATGCTCTGGG - Intronic
1072289630 10:93952235-93952257 CTGCTTTCATCCAGTGGAGTGGG + Intronic
1072614306 10:97039209-97039231 CTGACCTCTTCCTGTGCTCTGGG - Intronic
1076191027 10:128483566-128483588 CTACTGTCTTCAAGTGCTCTAGG - Intergenic
1076374977 10:129977523-129977545 CATCTCTGATCCAGTGCTCCAGG + Intergenic
1076380576 10:130022333-130022355 GTGCTCTCTCCCAGGGCTCTGGG - Intergenic
1076847623 10:133077064-133077086 CTGCTCTCAAGAATTGCTCTGGG - Intronic
1077156043 11:1092177-1092199 CTGTTCTCATCCCATCCTCTGGG + Intergenic
1081461014 11:43273074-43273096 ATACTCTCATCCAGGGCACTTGG + Intergenic
1082147010 11:48683032-48683054 CTGTTCTTATGCAGTGATCTTGG - Intergenic
1082895080 11:58181461-58181483 CTGCTCTCTTCCAGTGCCTTGGG - Exonic
1083708530 11:64532951-64532973 CTGCCCTCTTCCTGTACTCTTGG + Intergenic
1084374190 11:68764662-68764684 CTCCTCTCCTCCAGAGATCTTGG - Intronic
1084598315 11:70130379-70130401 CGGCTCTCATCTACTGCTCAAGG - Intronic
1087160479 11:94943434-94943456 CTGCTCCCAGCCAGTGATGTAGG + Intergenic
1088448222 11:109954883-109954905 CTGTTTTCATCTAGTGCTGTGGG - Intergenic
1088469120 11:110175550-110175572 CTGCTCTTGTCCAGAGGTCTGGG + Intronic
1089029942 11:115315452-115315474 CTGTTCTCATGCAGTTTTCTGGG - Intronic
1089567414 11:119379013-119379035 CAGCTCCCATCCAGTGCCCCTGG - Intronic
1089605731 11:119640231-119640253 CTGCTCTGATCCTGGGATCTGGG + Intronic
1089639016 11:119834796-119834818 CCTCTCTCATCCATTACTCTTGG - Intergenic
1090258276 11:125301116-125301138 CTGCTAACTTCCAGGGCTCTGGG + Intronic
1091282706 11:134391053-134391075 CTGCTCCCATCCAGTCTTTTTGG + Exonic
1092024166 12:5226948-5226970 ATACTCTCTACCAGTGCTCTGGG - Intergenic
1092869470 12:12793503-12793525 CTGTGCCCATCCAATGCTCTTGG + Intronic
1093573850 12:20701950-20701972 CTGCTCTGATCTTGTGTTCTTGG - Intronic
1094117507 12:26933346-26933368 CTGTTCTCATCCATTGTGCTAGG - Intronic
1095991574 12:48038014-48038036 CTCCTTTCATCCTCTGCTCTTGG - Intergenic
1096729998 12:53601766-53601788 CTGCTTTCGGCCAGTGTTCTTGG + Intronic
1096911441 12:54988636-54988658 CTGCTCAGAGCCACTGCTCTGGG + Intergenic
1098596261 12:72275119-72275141 CTGCTCACCTCCAGGGCCCTGGG - Intronic
1100571106 12:95843698-95843720 CTGCTGTTAACCAGTGCTTTGGG - Intergenic
1101642944 12:106601614-106601636 CTGTTCTCATCCAGTGCCTCAGG + Intronic
1102070887 12:110018331-110018353 CTTCTCTCCTCCAGTGCCCTTGG + Exonic
1102131758 12:110536475-110536497 CTGCTCTAAAACATTGCTCTGGG - Exonic
1102296555 12:111741370-111741392 CTGCTCTGCTCCAGTGACCTGGG + Intronic
1103611837 12:122128861-122128883 CTGCTCTCACCCTGTCCTCCTGG + Intronic
1105426422 13:20298533-20298555 CTGCCCTCTTCCTGTGGTCTGGG + Intergenic
1105716066 13:23066086-23066108 CTGCTTGCATCCCTTGCTCTGGG - Intergenic
1105938024 13:25119929-25119951 GTACTCTAAGCCAGTGCTCTGGG - Intergenic
1108080722 13:46732122-46732144 ATGCTCTCATCCACTGCTGCTGG - Intronic
1108426928 13:50312078-50312100 CTGCCCCCATCCAGTACTCAGGG + Intronic
1109873730 13:68370063-68370085 CTTCTCTCATCCATGGCTCTAGG + Intergenic
1112241329 13:97684492-97684514 CTGCTCTCTTCCTGTCCTCTCGG + Intergenic
1113801605 13:113089440-113089462 CTGCTCTCATCCAGTCCGTCCGG + Intronic
1114216594 14:20661885-20661907 CTGGTCCCATCCTATGCTCTGGG - Intergenic
1114553997 14:23551135-23551157 CTGCTATCTCCCAGGGCTCTCGG + Intronic
1114895996 14:26992061-26992083 CTCCTCAAATCCATTGCTCTGGG + Intergenic
1117528701 14:56637963-56637985 TTGCTCTGGTCCAGGGCTCTGGG - Intronic
1119769029 14:77208824-77208846 CTGCTCTCTGCCAGGGCTCGTGG - Intronic
1121569784 14:94939005-94939027 CTGGTCTAACCCAGTACTCTTGG + Intergenic
1125429247 15:39579841-39579863 CTGCTGTGATCCAGCGCTATCGG - Intergenic
1125686740 15:41568054-41568076 CTGCTCTCACCCACTGTGCTGGG - Intronic
1127807874 15:62537770-62537792 CTTCTCTGCTCCTGTGCTCTGGG + Intronic
1129891194 15:79073092-79073114 CTGATCTCATCCAGGGCCCAGGG - Intronic
1130840244 15:87693260-87693282 ATGCTCTCATGCATTGTTCTGGG - Intergenic
1131832862 15:96365510-96365532 CTGCTCTCCTCCAAAGCTCCAGG - Intergenic
1132110992 15:99102373-99102395 CTCCTCTTTTCCAGCGCTCTGGG + Intronic
1132247616 15:100309756-100309778 CTCCTCTCCTCCAGAACTCTGGG + Intronic
1132366578 15:101262133-101262155 CTCCCCACATCCAGTCCTCTTGG + Intergenic
1136026801 16:27473870-27473892 CAGCTTCCCTCCAGTGCTCTAGG - Intronic
1136614618 16:31390274-31390296 CTGCTGTAATCCAGTACTTTGGG + Intergenic
1139897894 16:70302851-70302873 AAGCTCTCATCCATTGCTGTTGG - Intronic
1139989648 16:70929705-70929727 CTGCTCTGAACCAGTCCCCTTGG - Intronic
1140985599 16:80155648-80155670 CTACTCACTTCCAGTGCTTTTGG + Intergenic
1141651746 16:85396569-85396591 CTGCTCTCCTCCATGGCTCCAGG - Intergenic
1141759131 16:86015740-86015762 CTGGTCTGATGCAGTGCTCATGG + Intergenic
1143567949 17:7736342-7736364 CTGTTCTCAGCCAGGGCTTTAGG - Intronic
1144672353 17:17140025-17140047 CTGCTCCCATCCTGTGATCCAGG + Intronic
1145098430 17:20052570-20052592 CTGCTCCCAGCCTGTGGTCTAGG - Intronic
1145960826 17:28885715-28885737 TTTCTCTCCTCCACTGCTCTGGG - Intronic
1146125539 17:30228509-30228531 CTGCTCTCAATCAGTGCTTGGGG + Intronic
1148392031 17:47279712-47279734 CTGCTCTCATCCAGTTTGCTGGG + Intronic
1149455065 17:56781121-56781143 GTGCTCTCAGCCACTGCACTGGG + Intergenic
1149754296 17:59174800-59174822 GTGCCCACACCCAGTGCTCTGGG + Intronic
1151409062 17:73909033-73909055 CTGCTCTCATTCAGCCATCTTGG - Intergenic
1152520787 17:80855475-80855497 ATGCTCTCAGCCGGTGCACTTGG - Exonic
1152864064 17:82711804-82711826 CTGGGCTCATTCAGTGCACTTGG + Intergenic
1154163354 18:11996202-11996224 TTGCTCTCCTGCTGTGCTCTGGG - Intronic
1155052147 18:22157852-22157874 CTTCTCTCACGCACTGCTCTAGG - Intergenic
1155566249 18:27137961-27137983 CTGCTCTCCTCTGGTCCTCTGGG + Intronic
1156511119 18:37637666-37637688 CTGCCCTCATCCACTGGGCTGGG - Intergenic
1157028789 18:43879519-43879541 CTGATCTCATACAAGGCTCTGGG - Intergenic
1158594439 18:58803937-58803959 CTGTTCTCATCCCATGGTCTAGG - Intergenic
1159379857 18:67643308-67643330 CAGCTCACATCCAGTGCTTCAGG + Intergenic
1159619711 18:70623221-70623243 ATGCTCTCATTCTGTGATCTGGG - Intergenic
1159962190 18:74564240-74564262 CTGCATGCATCCTGTGCTCTAGG + Intronic
1160622765 18:80182110-80182132 CTGCTCACCCACAGTGCTCTGGG + Intronic
1161010140 19:1955933-1955955 CTGTTCTGATACAGTGGTCTTGG - Intronic
1161705478 19:5818898-5818920 CTGCCCTCCACCAGAGCTCTAGG + Intergenic
1161940391 19:7399294-7399316 CTGCTGTCACCGAATGCTCTCGG - Intronic
1162306953 19:9880796-9880818 CTGCTGTCATGAAGTGCTTTGGG - Intronic
1166214118 19:41324713-41324735 CAGCTCTCATCCTGCACTCTTGG - Exonic
925262637 2:2541739-2541761 CCCCTCTCCTCCTGTGCTCTGGG - Intergenic
925652802 2:6109708-6109730 CTGCTTTCAAGCAGTCCTCTGGG + Intergenic
925739400 2:6992553-6992575 CTGCTCTCCTCCAGTTGCCTGGG - Intronic
925983995 2:9200418-9200440 ATGCAAGCATCCAGTGCTCTGGG + Intergenic
927885860 2:26718089-26718111 CTCCTCTCATCCCGAACTCTTGG + Intronic
929534324 2:42771040-42771062 CTGCTGGCCTGCAGTGCTCTAGG + Intronic
929923454 2:46190342-46190364 CTGTTCTCTTCCAGAGCGCTAGG - Intergenic
929966299 2:46539735-46539757 TTGCTTTGATGCAGTGCTCTTGG + Intronic
930106456 2:47644067-47644089 CTACCCTCATCCCATGCTCTTGG + Intergenic
930499285 2:52191574-52191596 CTATTTTCATCCAATGCTCTGGG + Intergenic
930558252 2:52927594-52927616 ATGCTCTCATACAATGTTCTGGG - Intergenic
930859300 2:56053252-56053274 CCCCTCTTACCCAGTGCTCTTGG + Intergenic
933263510 2:80155933-80155955 CTTCTGTTATCCATTGCTCTAGG + Intronic
933437292 2:82263548-82263570 CTGTTCTCATTTAGGGCTCTGGG + Intergenic
933864888 2:86507230-86507252 CTGCTCTCATATACTGCTGTTGG - Intronic
936539339 2:113337344-113337366 CTGCTGCCAACCAGAGCTCTTGG + Intergenic
937973099 2:127565229-127565251 CTGCTCGGATCCAGTGTTCCTGG - Exonic
938201107 2:129373829-129373851 GGGCTCTCCTCCAGTGCTCCTGG + Intergenic
938931471 2:136090024-136090046 CTGCTCTCCTGCAGTGCTGGAGG + Intergenic
939784301 2:146490447-146490469 CCGCTCTCATTCTGTTCTCTCGG - Intergenic
940407719 2:153324986-153325008 CTGCTCTCATACAATGATTTAGG + Intergenic
940763458 2:157764046-157764068 CTGTTATAATCCAGTGGTCTGGG - Intronic
941336807 2:164255503-164255525 CAGCTATCATCCAGTGCTTTAGG - Intergenic
941522915 2:166571066-166571088 CTACTCTCATCCAATGCTGATGG + Intergenic
941652848 2:168112225-168112247 CTGCTCTGAACCTGTCCTCTTGG - Intronic
941869530 2:170369519-170369541 CTGCTCTCATCCACTGGGCATGG - Intronic
945748926 2:213755786-213755808 CATATCTCATGCAGTGCTCTTGG - Intronic
946019389 2:216630515-216630537 CTGCTCATCTCCACTGCTCTTGG + Intergenic
946130981 2:217606723-217606745 CTGCTCTCATGCTCAGCTCTTGG - Intronic
947126399 2:226873487-226873509 CTGGGCTCATTCAGAGCTCTGGG - Intronic
948012082 2:234656933-234656955 CTGCTCTCTTCCTGTGGTCAGGG - Intergenic
948738972 2:240030566-240030588 CTGCTCTCTCCTGGTGCTCTGGG - Intergenic
1169826278 20:9772195-9772217 CTGCTCTCATCCATTACCTTTGG - Intronic
1170874014 20:20234138-20234160 CTGCTCTCAGGCAGTTCCCTAGG - Intronic
1173002736 20:39116343-39116365 TTGCTCACAGCCAGAGCTCTAGG + Intergenic
1173790815 20:45826792-45826814 CTGCTCAGATGCAGGGCTCTGGG - Intronic
1173957238 20:47043131-47043153 CTGCTGTCTTACAGAGCTCTGGG + Intronic
1174051869 20:47772561-47772583 CTGCTCTCCTCCAAGCCTCTGGG - Intronic
1174164694 20:48576553-48576575 CTGCTCTCATCCAGGCTCCTGGG + Intergenic
1174384134 20:50176612-50176634 CAGCTTTCATCCAGTTCTCAGGG - Intergenic
1175912860 20:62413031-62413053 CTCCTGTCAGCCAGTGCCCTGGG - Intronic
1175933702 20:62505456-62505478 CTGAGCTCACCCTGTGCTCTGGG - Intergenic
1176141351 20:63546478-63546500 CTGCCCTCACCCAGAGCTCCTGG + Intronic
1179409259 21:41149733-41149755 ATGCTCACATCGAGTGTTCTTGG + Intergenic
1179910660 21:44446072-44446094 CTTCTCTCACCCATTGCTGTGGG - Intergenic
1180934937 22:19619249-19619271 ATGCTTTCATCCAGGGCTCTGGG - Intergenic
1181308531 22:21930922-21930944 CTGCTCTCCCCCGGAGCTCTGGG + Intronic
1181460737 22:23084591-23084613 ATGTTCACATCCAGTGCTCAAGG - Intronic
1181633086 22:24161630-24161652 CTGCCCTCAGCCAGGCCTCTTGG + Intronic
1182692777 22:32175631-32175653 CTGTCCTCATCCAGTGCACCCGG + Intergenic
1182740705 22:32565150-32565172 CTGCACCCAAACAGTGCTCTCGG + Intronic
1182740708 22:32565174-32565196 CTGCACCCAAACAGTGCTCTCGG + Intronic
1183588307 22:38765896-38765918 CTGCTCTCATCCAGTGCTCTAGG + Intronic
1184114306 22:42413329-42413351 CAGCTCTGAGCCAGAGCTCTGGG + Intronic
1184596044 22:45514878-45514900 CTGCTCTCACCCACGGCTCCTGG - Intronic
1185023237 22:48392865-48392887 CTGCTCCTGTCCAGGGCTCTCGG + Intergenic
949407852 3:3733593-3733615 GTGCTCTCTCCCAGGGCTCTAGG + Intronic
950445731 3:13036645-13036667 CTGGGCTCATCCAGGGCTGTCGG - Intronic
950873531 3:16249698-16249720 CTGCTCCCTTCCAGTCGTCTGGG + Intergenic
950906508 3:16543897-16543919 TTCCTCTCATCCTGTGCTCATGG + Intergenic
952197020 3:31086333-31086355 CTGATCTCATCCCCAGCTCTGGG + Intergenic
954660802 3:52225862-52225884 CTGCTCTCTGCCTGAGCTCTGGG - Exonic
955592270 3:60550824-60550846 CTGCTCTCATGTAGTATTCTAGG + Intronic
956056044 3:65300205-65300227 CTGATCTCATCCATCGCACTAGG + Intergenic
957818274 3:85331948-85331970 CTGCTCTCCTCCACTGCTAAAGG - Intronic
958152747 3:89712388-89712410 CTGGTATCATGCAGTGCTCTAGG - Intergenic
961369027 3:126418541-126418563 CTGCTGGCATCCATCGCTCTGGG - Intronic
962279428 3:134039014-134039036 CTGCCCACCCCCAGTGCTCTTGG - Intronic
963289374 3:143472191-143472213 CTGCTCTGTTCCAGTGTTCATGG + Intronic
963926669 3:150958247-150958269 CTTCTGTCATCAAGTTCTCTTGG + Intronic
964057361 3:152477707-152477729 CTGCTCTCATGCACCCCTCTAGG + Intergenic
967747791 3:193079898-193079920 CTTATCCCATTCAGTGCTCTCGG - Intergenic
968897513 4:3413210-3413232 CTGCTCGCATCCAGTGGACAAGG + Intronic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
973911112 4:55581738-55581760 CTGCACTCCTGCACTGCTCTGGG - Intronic
976592205 4:86860297-86860319 CTGCTCTCATTAAGGCCTCTAGG - Intergenic
978006054 4:103618417-103618439 CTGTTCTCTTCCATTGGTCTAGG + Intronic
979129945 4:117031219-117031241 CTCCTCTCCTGCACTGCTCTGGG + Intergenic
979500167 4:121430991-121431013 CTACCCTCATCCTGTTCTCTAGG + Intergenic
980566533 4:134550208-134550230 CAGCTTTTATCCAGTGCTTTTGG - Intergenic
981033932 4:140151902-140151924 CTGCTACCTTCCATTGCTCTGGG + Intronic
982248416 4:153379443-153379465 ATCCTGTAATCCAGTGCTCTGGG + Intronic
985008035 4:185553961-185553983 CTTCTCTAATTCATTGCTCTTGG - Intergenic
985015209 4:185626761-185626783 CAGCTTTCACACAGTGCTCTAGG + Intronic
987403885 5:17505407-17505429 CTGCTCTGATCCAGTGGCTTAGG + Intergenic
988819969 5:34873433-34873455 CTGCTTCCATCCAGTGCCCCAGG + Intronic
990672582 5:58149606-58149628 CTGCTCTCAGCCAGCCCTTTGGG + Intergenic
991309602 5:65222271-65222293 CTGTTCTCACCCATTGATCTAGG - Intronic
992483271 5:77171911-77171933 CTCCCCTCATCCTGTGCCCTAGG - Intergenic
994456930 5:100021615-100021637 ATGCTCTCCTCCAGAGCTCTTGG - Intergenic
996003983 5:118399194-118399216 CTGCTCTCATGCAATAGTCTGGG + Intergenic
996177226 5:120373646-120373668 CTCCACTCATCCAGTGGTCTTGG - Intergenic
996638905 5:125729501-125729523 CTGTTCTCTTCCATTGGTCTAGG + Intergenic
999693286 5:154167177-154167199 TGCCTCTCAGCCAGTGCTCTTGG + Intronic
1000745728 5:165031134-165031156 CTGCTCTCTGCTACTGCTCTAGG + Intergenic
1004308335 6:14521482-14521504 CAGTTCTGATCCAGTACTCTAGG - Intergenic
1006987547 6:38186146-38186168 CAGTTCTCCTCCAGTGCTGTGGG - Intronic
1008501015 6:52183217-52183239 GTCCTCTCATTCAGTGTTCTAGG + Intergenic
1009498796 6:64384823-64384845 CTTCTCACATCCTGAGCTCTGGG + Intronic
1011664799 6:89623503-89623525 CTCCTGTCATCCTTTGCTCTGGG - Exonic
1013687372 6:112601146-112601168 CTGATCTCAGCCAGTGAACTTGG + Intergenic
1017939976 6:159043532-159043554 GTGCTAACAACCAGTGCTCTTGG - Intronic
1018030169 6:159835448-159835470 CTCCTCTCCTCCAGGCCTCTTGG - Intergenic
1018215052 6:161518509-161518531 CAGCTCTCACCCAGAGCCCTGGG - Intronic
1019087955 6:169499827-169499849 CTGCTCCCAGCCACTGCTTTGGG - Intronic
1019558946 7:1646472-1646494 CGCCTGTCATCCAGTGCTTTAGG - Intergenic
1019726229 7:2604245-2604267 CACCTGTCATCCAGTGCTTTGGG - Intronic
1020499261 7:8895140-8895162 CTGGTGTCATCCAATGCGCTTGG + Intergenic
1021576349 7:22109266-22109288 CAGATCTCTTCCAGTGTTCTGGG - Intergenic
1021939140 7:25662516-25662538 CTGCTCTCTGCAAGTGCTCCTGG - Intergenic
1023142724 7:37118322-37118344 CTGCACTGGACCAGTGCTCTGGG - Intronic
1023208065 7:37772630-37772652 CAGCTCCCTTCCTGTGCTCTGGG + Intronic
1024134157 7:46389621-46389643 CTCCTGTCAGCAAGTGCTCTGGG - Intergenic
1025242976 7:57293488-57293510 CTACTCTCCTCTAATGCTCTAGG + Intergenic
1025872446 7:65447604-65447626 TTGCTCTCTTCCAGTCCTGTGGG - Intergenic
1026089346 7:67286574-67286596 GTGCCCACACCCAGTGCTCTGGG - Intergenic
1028850448 7:95531776-95531798 CTCCTCTCAACATGTGCTCTTGG + Intronic
1032297789 7:130657925-130657947 CTGCTCTCATACAGTGATGGCGG + Intronic
1034220833 7:149444857-149444879 CTATTTTCTTCCAGTGCTCTGGG + Intronic
1034321862 7:150192333-150192355 CTGCACTCCAGCAGTGCTCTGGG - Intergenic
1036595537 8:10208628-10208650 CTTCTCTCTAGCAGTGCTCTGGG + Intronic
1037481205 8:19307632-19307654 CACCTGTAATCCAGTGCTCTGGG + Intergenic
1038048414 8:23786834-23786856 CTGCTTTATGCCAGTGCTCTGGG + Intergenic
1038096434 8:24317337-24317359 CTATTCTCATCCACTGGTCTAGG - Intronic
1042456292 8:69007826-69007848 CTGCTAACAACCAGTGCTCTTGG - Intergenic
1042529757 8:69802931-69802953 CTGTTCTCAGACAGTGCTGTGGG - Intronic
1043218597 8:77628523-77628545 CAGGTCTCATTCAGTGTTCTTGG + Intergenic
1044406565 8:91833566-91833588 CTGCTGTCATCCAGGCCTCCAGG + Intergenic
1047413986 8:124648869-124648891 CTGCACTCATCGAGTACTATGGG + Intronic
1048145624 8:131839560-131839582 CTTCTCTCATACACTGCTCTTGG + Intergenic
1048171501 8:132110998-132111020 CTGCTATAATCCTGAGCTCTGGG - Intronic
1048321468 8:133403782-133403804 CTGCTCACATCCCTTGTTCTTGG + Intergenic
1048723493 8:137355888-137355910 CTGGTCACATGCAGTGTTCTGGG - Intergenic
1049510935 8:143026348-143026370 CTGCTCACACCCTGAGCTCTGGG - Intergenic
1049741317 8:144242403-144242425 GTGCTCTGATCCTGTGCTATGGG + Exonic
1049750304 8:144279936-144279958 CAGCTCACATCCTGTGCTCTGGG - Intronic
1051689841 9:19699359-19699381 CCCCTCTCATCCACTGCTGTTGG + Intronic
1052135072 9:24899089-24899111 CTTCTCCCATCTACTGCTCTTGG - Intergenic
1054763937 9:69027080-69027102 CTACTTTCTTCCAGTGCTCAGGG - Intergenic
1055335413 9:75228749-75228771 CTGTTCTCATCCAGCTCTCAGGG + Intergenic
1057253225 9:93520837-93520859 ATGCTCTCAGCCAGTCCTCAGGG + Intronic
1057517921 9:95737414-95737436 CTGTTCTCATCCTCTGCTCATGG + Intergenic
1061392215 9:130323560-130323582 CTGCGCTGATTCATTGCTCTGGG - Intronic
1062289153 9:135786815-135786837 GTGCTCGCTTCCACTGCTCTGGG + Intronic
1062305291 9:135902883-135902905 AAGCTCCCATCCAGTGCCCTAGG + Intronic
1062699467 9:137891418-137891440 CTGCTGTGTTCCAGTGCCCTGGG + Intronic
1190493814 X:51008184-51008206 CTGCTGTCACCCTGTGATCTTGG - Intergenic
1192785410 X:74330158-74330180 GTCCTCTCATTCACTGCTCTCGG + Intergenic
1193674521 X:84433446-84433468 CTTCTCCCAGCGAGTGCTCTTGG + Intronic
1197375405 X:125676537-125676559 CTGGTCTCCTGCAGTGCCCTCGG + Intergenic
1198056777 X:133003605-133003627 CTGGTGTCATCCAGGGCCCTGGG - Intergenic
1198296708 X:135294250-135294272 CTGCTCTCCCTCAGTGCTCTTGG - Exonic
1199849642 X:151716203-151716225 CTGCTATCACCAGGTGCTCTTGG - Exonic
1200271962 X:154694246-154694268 CTACTATCAGCCAGTGTTCTGGG + Intronic