ID: 1183591140

View in Genome Browser
Species Human (GRCh38)
Location 22:38779944-38779966
Sequence AGATGTAACCTGGACAAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183591127_1183591140 26 Left 1183591127 22:38779895-38779917 CCTGGCTCTGCACTTAGTGCGGG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1183591140 22:38779944-38779966 AGATGTAACCTGGACAAGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 74
1183591132_1183591140 -6 Left 1183591132 22:38779927-38779949 CCAGTGCCACCTCCCTCAGATGT 0: 1
1: 0
2: 2
3: 17
4: 240
Right 1183591140 22:38779944-38779966 AGATGTAACCTGGACAAGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 74
1183591131_1183591140 0 Left 1183591131 22:38779921-38779943 CCTGGGCCAGTGCCACCTCCCTC 0: 1
1: 0
2: 4
3: 122
4: 977
Right 1183591140 22:38779944-38779966 AGATGTAACCTGGACAAGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183591140 Original CRISPR AGATGTAACCTGGACAAGCG GGG Intronic
906915464 1:50004654-50004676 AGATGTACCCTGGGCAAGAAGGG + Intronic
908590504 1:65627127-65627149 AGATGTTACATGGACAGGCTGGG - Intronic
915493993 1:156268033-156268055 AGAAGGAACCTTGACAAGGGTGG - Intronic
916541871 1:165764677-165764699 AGATGTAGCCAGGAGAAGGGAGG + Intronic
918396254 1:184116041-184116063 TCATGCAACCTGGCCAAGCGTGG - Intergenic
919821413 1:201475232-201475254 AGATATAACCTGTACAACAGAGG - Intergenic
923164772 1:231349584-231349606 GGATGTAACCTGTAAAAGCAAGG - Intronic
1078121632 11:8516599-8516621 AGATGGTACCTGGAAAATCGGGG + Intronic
1080082597 11:28238484-28238506 AGATGGCACCTGGAAAATCGGGG - Intronic
1080326990 11:31086751-31086773 AGATGTATCATGAACAAGTGGGG - Intronic
1082054590 11:47803025-47803047 AAATGTATCCTGGCCAAACGCGG + Intronic
1082837305 11:57660751-57660773 AGATGTAATCTGCAAAAGAGAGG - Exonic
1083182178 11:60994063-60994085 AGATGAAACCTGGGCATGCATGG + Intronic
1085634940 11:78151471-78151493 AGATGTAACCTGAAAATGCCTGG - Intergenic
1092526879 12:9314871-9314893 AGAGGGAGCCTGGACAAGGGTGG - Intergenic
1092540395 12:9416908-9416930 AGAGGGAGCCTGGACAAGGGTGG + Intergenic
1092562692 12:9633144-9633166 AGATGGTACCTGGAAAATCGGGG - Intergenic
1094512653 12:31105571-31105593 AGAGGGAGCCTGGACAAGGGTGG - Intergenic
1102180342 12:110907737-110907759 AGATGTAACAGGGACTAGCCCGG + Intergenic
1107621416 13:42234574-42234596 AGATGTAAGTTGGATAAGAGTGG + Intronic
1109114016 13:58357818-58357840 AAATGTAACCTGGATAAGGGTGG - Intergenic
1113906516 13:113821870-113821892 AGATCTAACCTGGACAGGCTGGG - Intronic
1114065987 14:19060230-19060252 TGATGGTACCTGGACAAGTGCGG + Intergenic
1114096281 14:19339795-19339817 TGATGGTACCTGGACAAGTGCGG - Intergenic
1116380312 14:44259512-44259534 AAATGTAACCTGGACCCGTGAGG - Intergenic
1118834270 14:69465204-69465226 AGGTGAAACCTGGCCAGGCGTGG + Intergenic
1124552092 15:30690826-30690848 AGATGTAAATTGGCCAGGCGTGG - Intronic
1124679151 15:31714843-31714865 AGATGTAAATTGGCCAGGCGTGG + Intronic
1129802161 15:78423333-78423355 AAATGTCACATGGCCAAGCGTGG - Intergenic
1131555603 15:93395828-93395850 AGATGGCACCTGGAAAATCGGGG - Intergenic
1139296057 16:65901913-65901935 AGAGGTAACCTGGACAAAGAGGG + Intergenic
1145822131 17:27846805-27846827 AGCTGTAACATGGCCAGGCGCGG - Intronic
1146657667 17:34644638-34644660 AGAGGTAGCCTGGAGAAGGGTGG + Intergenic
1153560666 18:6369134-6369156 AGATGCTTCCTGGAGAAGCGGGG + Intronic
1156627394 18:38925400-38925422 ACATGTAACATGGCCAGGCGTGG + Intergenic
1163839167 19:19595384-19595406 TGTGGTAAGCTGGACAAGCGGGG - Intronic
1164963148 19:32454282-32454304 AGATGTAACAGGGCCAGGCGTGG + Intronic
927150071 2:20190389-20190411 AGAGGACACCTGGACAGGCGTGG - Intergenic
929469936 2:42181584-42181606 ATATGAAACCTGGCCAGGCGCGG - Intronic
932473241 2:71978395-71978417 AGATGGTACCTGGAAAATCGGGG - Intergenic
935931958 2:108136582-108136604 AGATGTAAAAAGGACAAGCAGGG - Intergenic
936597185 2:113859332-113859354 AGATGTGACTTGGACAAGCAAGG - Intergenic
937832309 2:126437361-126437383 AAATATAACCTGGCCAGGCGCGG + Intergenic
943091559 2:183381610-183381632 ATATGAATCCTGGACAAGCCTGG - Intergenic
948179061 2:235965893-235965915 AGATGGGACCAGGACAAGCTAGG + Intronic
1169100005 20:2939376-2939398 AGCTGTAACATGGAGAAGAGGGG + Intronic
1172549622 20:35788863-35788885 TGATATAACCTGGCCAGGCGTGG - Intronic
1180484467 22:15782822-15782844 TGATGGTACCTGGACAAGTGCGG + Intergenic
1182068468 22:27446545-27446567 AGATGCAACCATGACAAGAGAGG + Intergenic
1183591140 22:38779944-38779966 AGATGTAACCTGGACAAGCGGGG + Intronic
1184839956 22:47046722-47046744 AGTTAAAACCTGGACAAGTGCGG - Intronic
953233814 3:41088360-41088382 AGATGTTACATGGACAAGAAGGG + Intergenic
956402385 3:68894439-68894461 AGAAGTAACATGGCCAGGCGTGG - Intronic
957975493 3:87438215-87438237 AAATGTTACCTGGACAAGATTGG + Intergenic
960405338 3:117252875-117252897 AGGTGTCACCTGGACAGGCTAGG + Intergenic
966078597 3:175970468-175970490 AGATGTAACCTGAATAATCCAGG - Intergenic
967064543 3:185903232-185903254 AAAGATAACCTGGCCAAGCGCGG - Intergenic
969541410 4:7792102-7792124 ACATGTAAGCCGGACAAGTGGGG + Intronic
969735493 4:8986849-8986871 AGCTGTAAACTGAAAAAGCGTGG + Intergenic
970366389 4:15362760-15362782 AGATGTTAACTGGGCAAGCTTGG + Intronic
970718302 4:18955136-18955158 AGATATAACCTAGACAGGGGAGG + Intergenic
974597209 4:64029955-64029977 AGATGTACCCTGGGCCAGAGAGG - Intergenic
982791643 4:159598941-159598963 ACATGTAGCCTGCACAAGAGAGG - Intergenic
990244897 5:53854578-53854600 AGATGGTACCTGGAAAATCGGGG - Intergenic
990994106 5:61713714-61713736 AGATGTGAACTGAACAAGAGAGG + Intronic
994181610 5:96773204-96773226 ACAGGTAACCTGGACAAACCAGG + Exonic
997477800 5:134156538-134156560 AGATGTTAACTGGAAAAGCAAGG + Exonic
1001749712 5:174119384-174119406 AGATGCAAGCTGGTCAAGCTGGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1015777442 6:136828526-136828548 AGAGGTTTCCTGGACAAGAGGGG - Intronic
1015865658 6:137723958-137723980 AGATGAAACCAGGACCAACGTGG - Intergenic
1022181913 7:27929019-27929041 AAATCTAACCTGGGCAAGAGGGG + Intronic
1022954872 7:35371776-35371798 AGCTGTAACTTGGACTAGGGTGG + Intergenic
1029135530 7:98367912-98367934 TGATGAAACCCGGCCAAGCGTGG - Intronic
1034875160 7:154719228-154719250 GGATGTAACCAAGACAAGCCCGG - Intronic
1040054753 8:43047833-43047855 AGATGAATCCTGGCCAAGCACGG - Intronic
1056120355 9:83481707-83481729 AAATGTAACATGGAAAAGAGGGG + Intronic
1062667246 9:137681574-137681596 AGATGTCACCTGGACAAGCAGGG - Intronic
1200401677 X:156023653-156023675 AGAGGGAACCTGAACAAGTGAGG + Intergenic