ID: 1183591526

View in Genome Browser
Species Human (GRCh38)
Location 22:38781870-38781892
Sequence GTGGAGGCCCAGAGCGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183591526_1183591530 -6 Left 1183591526 22:38781870-38781892 CCCTCATCGCTCTGGGCCTCCAC 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1183591530 22:38781887-38781909 CTCCACAGCGGCCTCCTCGCTGG 0: 1
1: 0
2: 1
3: 15
4: 242
1183591526_1183591534 14 Left 1183591526 22:38781870-38781892 CCCTCATCGCTCTGGGCCTCCAC 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1183591534 22:38781907-38781929 TGGTCTCCCCACTTCTGCTCTGG 0: 1
1: 1
2: 2
3: 35
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183591526 Original CRISPR GTGGAGGCCCAGAGCGATGA GGG (reversed) Intronic
900439319 1:2645453-2645475 GTAGAGGCCCTGTGTGATGAGGG + Exonic
900613810 1:3555394-3555416 GTGGAGGCCCAGAGCGGCTTGGG - Intronic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
902511421 1:16968992-16969014 ATGGAGGCCCAGAGAGAAGTGGG + Intronic
902628723 1:17692121-17692143 GTGAAGGCTCAGAACTATGATGG - Intronic
902821461 1:18945824-18945846 GTGGATGGCAAGTGCGATGATGG - Intronic
902987684 1:20165098-20165120 GTGGAGGGGGAGGGCGATGAGGG - Intronic
903213978 1:21833113-21833135 GTGGAGGCCCAGAGGTCTGGGGG + Intronic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
904659934 1:32076800-32076822 GCGGCGGCCCAGAACGATGGTGG - Exonic
905893708 1:41532177-41532199 ATGGAGGACAAGAGAGATGAAGG + Intronic
906471792 1:46137066-46137088 ATTGAGACCCAGAGCAATGAGGG + Intronic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
907247694 1:53118459-53118481 GTAAAGTCCCAGAGAGATGATGG - Intronic
907713391 1:56905306-56905328 ATGGAGGCCCAGTGGGATCATGG + Intronic
912211131 1:107558261-107558283 GTGGAGGTCAAGTGAGATGAGGG - Intergenic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912548452 1:110467836-110467858 GTGGAGGCCAAGATCAATGGCGG - Intergenic
913058964 1:115187416-115187438 GTGGTGGCCCAGAGAGGTGGTGG - Intergenic
913355709 1:117919532-117919554 GTGGTTGCCCAGAGGGATTAAGG + Intronic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
916735669 1:167605032-167605054 GTGGAGGCCTAGAGTAATGTTGG + Intergenic
920260942 1:204687259-204687281 ATGGAGGCCCAGATCGTTTAAGG + Intergenic
920544825 1:206807450-206807472 GTGAAGGCCCTGAGAGAAGAAGG - Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063961021 10:11305409-11305431 GCAGAGGCCCAGAGTGTTGAAGG - Intronic
1065112350 10:22452644-22452666 ACGGAGGCCCAGAGAGGTGAGGG + Intronic
1065911055 10:30305842-30305864 GTGGAATCCCAGAGGAATGAAGG + Intergenic
1069557304 10:69406758-69406780 AGGGAGGGCCAGAGAGATGAAGG - Intronic
1069880714 10:71591165-71591187 GAGGAGGCCGAGAGGGCTGAGGG + Intronic
1071450747 10:85789946-85789968 GTGGATGCCAAGAGCCATGAGGG - Intronic
1073109130 10:101050409-101050431 GTGGGGGCCGAGAGCGCTGCAGG - Intergenic
1073475596 10:103750641-103750663 GGGGAGGCTCAGAGAGCTGATGG + Intronic
1074457679 10:113609711-113609733 GTGGAGGCTCAGAGAGGTGTAGG + Intronic
1075349801 10:121713583-121713605 GTGGTGGCGCAGAAAGATGATGG - Intergenic
1076888783 10:133274227-133274249 GTGCAGGCCCTGAGCGAGGAGGG + Exonic
1079245989 11:18752695-18752717 GTGGAGGCCCAGAAGTACGAGGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1083883826 11:65561084-65561106 GCGGAGGCCCTGAGAGCTGAAGG - Intergenic
1084950701 11:72663877-72663899 GTGGAGGGACAAAGAGATGATGG - Intronic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1087883889 11:103454484-103454506 GTGGAGGCCCAGTGAGGTTAAGG - Intronic
1088383367 11:109221356-109221378 GCTGAGGCCCAGGGAGATGAGGG + Intergenic
1089402306 11:118171404-118171426 GCAGAGGCCCAGAGCTCTGAGGG + Intronic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1098048062 12:66422824-66422846 GTGGATGCCCATTGGGATGATGG + Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101736021 12:107463940-107463962 ACAGAGGCCCAGAGAGATGAGGG - Intronic
1101747293 12:107552659-107552681 ATCGAAGCCCAGAGTGATGAGGG + Intronic
1102506021 12:113385000-113385022 GTGAAGGCCCAGAGCCGTGCTGG + Intronic
1102544731 12:113646255-113646277 ATGGATGCCCAGAGAGATGAAGG + Intergenic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1104042559 12:125139979-125140001 GAGGAAACCCAGAGAGATGAGGG + Intronic
1105120788 13:16776417-16776439 TTGGAGGCCCATGGTGATGAAGG + Intergenic
1105120874 13:16777782-16777804 TTGGAGGCCCAGGGTGATAAAGG + Intergenic
1105138796 13:17070579-17070601 TTGGAGGCCCATGGTGATGAAGG + Intergenic
1105144077 13:17156369-17156391 TTGGAGGCCCAGGGTGATAAAGG + Intergenic
1105303984 13:19156625-19156647 GTGGAGGCCCAAAGGGCTGGGGG - Intergenic
1106753501 13:32797889-32797911 GTGGGGGCCAAGAGCGTCGAGGG + Intergenic
1107133956 13:36924163-36924185 GTGGAGGCCCAGGGGGGTGCAGG - Intergenic
1112844043 13:103616064-103616086 GTGGAGATCAAGAGTGATGAGGG + Intergenic
1113719072 13:112539239-112539261 GGGAAGGCCCAGAGAGGTGAAGG + Intronic
1115392354 14:32867157-32867179 GTGGAGGGGCAGAGCCAAGATGG - Intergenic
1117201730 14:53396694-53396716 GTGGTGGCTGAGAGAGATGAAGG + Intergenic
1117612693 14:57501128-57501150 GTAGAGGGCCAGAGCAGTGAGGG - Intergenic
1117748962 14:58901111-58901133 GTGGTGGGACAGAGCCATGAAGG + Intergenic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1121019543 14:90570861-90570883 ATGGAAGCACAGAGAGATGAAGG + Intronic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1122421026 14:101577507-101577529 CTGGGGGCCCAGAGCCCTGATGG + Intergenic
1122853977 14:104551432-104551454 GAGGAGGCCCAGAGAGAGGCAGG - Intronic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1131639386 15:94273846-94273868 GTGAAGGCCCACAGGGATGGTGG - Intronic
1132648208 16:1008729-1008751 GTTGAGGTCCAGAGAGATGGGGG + Intergenic
1132699380 16:1215855-1215877 GTGGAGAGCCAGAGGGATGCAGG + Intronic
1135398038 16:22146256-22146278 GTGGACGCCCAGGGAGATGGAGG + Exonic
1136013973 16:27383250-27383272 GTAGAGGCTCAGAGAGAGGAAGG + Intergenic
1136371143 16:29836864-29836886 GTGGGGGCCCAGGGTGGTGATGG - Exonic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1138245772 16:55466266-55466288 GTGGAGGGTCAGAGGGATGTTGG + Intronic
1139282645 16:65783907-65783929 GTGGAGGCCCGGAGAGAGGAAGG - Intergenic
1140526464 16:75627072-75627094 GTGGAGGACAAGAGCAACGAAGG - Intergenic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141771440 16:86092122-86092144 GAGGAGGCCCGGACCGAGGAAGG + Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1143031605 17:3971120-3971142 GTGGAGGCCCCCAGAGATGAAGG + Intergenic
1144684353 17:17216234-17216256 ACGGAGGCCCAGAGCCATGGGGG + Intronic
1145199478 17:20929731-20929753 GTGAAGGACCTGAGCAATGAAGG + Intergenic
1145979202 17:29001957-29001979 GTGGAGGCCCAGAGAGGACAGGG + Intronic
1146309245 17:31754510-31754532 GTGGAGGTTCAGAGAGGTGAAGG - Intergenic
1147306637 17:39568751-39568773 GTGGGGGCTCAGAGGCATGAAGG - Intergenic
1147904616 17:43814613-43814635 ATTGAGGCTCAGAGAGATGAAGG - Intronic
1148105932 17:45118871-45118893 CTGGAGGACCAGGGCGAGGAGGG - Exonic
1148867414 17:50635654-50635676 AGGGAGGCCCAGAGAGAGGAAGG + Intronic
1149600242 17:57888823-57888845 CTGGAGGGGCAGAGAGATGATGG - Intronic
1151703786 17:75756518-75756540 GTGCGGGCCCAGAGCCAGGAAGG + Exonic
1152537524 17:80959377-80959399 GTGGAGGCACAGAGCGCAGCAGG + Intronic
1153248395 18:3095988-3096010 TAAGAGGCCCAGAGTGATGAGGG + Intronic
1154173571 18:12067675-12067697 GTGGGGCCCCAGAGCTATGGAGG - Intergenic
1157567425 18:48689036-48689058 GTGGGGGCACAGAGAGGTGAGGG + Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1160768679 19:821053-821075 GCGGAGGCCCAGAGAGGTTAGGG + Intronic
1160923225 19:1530191-1530213 GTGGAGGCTCAGGGAGAGGAGGG - Intronic
1161078890 19:2300679-2300701 CGGGAGGCCCAGAGCGAGGGAGG - Intronic
1161355148 19:3814883-3814905 CAGGAGGCCCAGAGCAAGGAGGG - Intronic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1163207373 19:15813581-15813603 GTGGAGACACAGAGAGATGTGGG + Intergenic
1164540604 19:29119019-29119041 GAGGAGGCCCAGAGAAAGGATGG - Intergenic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1165472464 19:36011241-36011263 GTGGAGGTCCTGAGGGATTAGGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
924998776 2:387034-387056 GTGGATGCAGAGAGCGGTGAGGG - Intergenic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
932259203 2:70312991-70313013 ATGGAGCCCCAGAGTGATGTGGG + Intergenic
933901762 2:86855224-86855246 GAGGAGGCTCAGAGAGGTGAGGG - Intronic
935778786 2:106494039-106494061 GAGGAGGCTCAGAGAGGTGAGGG + Intergenic
937214594 2:120303611-120303633 GAAGAGGCACAGAGCGATGAGGG - Intergenic
943869547 2:192976288-192976310 GTGCTGGCCCACAGTGATGAGGG + Intergenic
944008799 2:194945545-194945567 GTGGAGGCTGAGAGAAATGAGGG - Intergenic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
946185770 2:217979645-217979667 GTGGAGTCCCAGAGCCCTGGGGG - Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948981634 2:241497698-241497720 GTGGAGGCCCAGGGTGAGCAGGG + Intronic
1168814796 20:728924-728946 GTGGGGGTCCAGGGAGATGAGGG + Intergenic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1171230540 20:23480670-23480692 TTGGAGGGGCAGAGAGATGAGGG + Intergenic
1171361681 20:24590485-24590507 GGGGAGGCGCAGGGCGACGACGG + Intronic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1172620070 20:36312946-36312968 ATGGAGGCCCAGAGAGGTGCAGG - Intronic
1172830263 20:37827936-37827958 TTAGAGGCCCAGAGATATGAAGG - Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1175068555 20:56311971-56311993 GTGCAGGACCAGTGCAATGATGG - Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1178686470 21:34715183-34715205 GTGGAGACCCAGAGCCATAAAGG - Intronic
1181854436 22:25772089-25772111 GTGCAGGACCACAGCGAAGAGGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182101207 22:27658819-27658841 GGGGAGGCCCAGAGACATCAAGG - Intergenic
1183013017 22:34962884-34962906 GTGGAGGCCCAGAGACGGGAGGG - Intergenic
1183064314 22:35352928-35352950 GTGGAGGCCCAGGGAGGGGAGGG + Intergenic
1183234396 22:36606390-36606412 GTGGAGGGACAGAGGGGTGAAGG + Intronic
1183269380 22:36851114-36851136 ATGGAGGCCGAGAGTGAAGAAGG - Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183383512 22:37502389-37502411 ATGGAGGCCCAGAGAAGTGAAGG + Intronic
1183458140 22:37933818-37933840 GTGGAGGGCCAGAGAGGTCAAGG + Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
1183632681 22:39042833-39042855 GGGGAGGCCCAGAGCCATGCAGG + Intronic
1183706909 22:39479816-39479838 GTGGAGGCCCAGGGCAGTGCGGG + Intronic
1184098196 22:42327973-42327995 GAGGGGGCCCAGAGCTATGATGG - Intronic
1184347340 22:43921933-43921955 ATGGAGGCCCAGAGCAAGGCAGG - Intergenic
1184802115 22:46767797-46767819 GAGGACTCCCAGAGCGATGCTGG + Intronic
1185294153 22:50045201-50045223 GTGGAGGCCCCGAGCTCTGGTGG + Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950212068 3:11131023-11131045 GTTGAGACCCAGAGGGATGGTGG - Intergenic
950588566 3:13917042-13917064 TTGGAGGCCTAGAGGGTTGAGGG + Intergenic
953571906 3:44077947-44077969 GGGAGGGCCCAGAGCGAGGAGGG - Intergenic
953880448 3:46688595-46688617 GAGGAGGCCCAGAGCCAGGGGGG - Intronic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
954674287 3:52307194-52307216 GGGAAGGCACAGAGAGATGAAGG - Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961006656 3:123410129-123410151 GTGGAGGCCCTGAGGGCAGATGG - Intronic
963077434 3:141360229-141360251 GTGGGGTCCCAGAGCTAAGATGG - Intronic
963736172 3:149019887-149019909 GTGGCGGTCCAGAGCCATGCTGG + Intronic
964496413 3:157295365-157295387 GTGGAGGCAGTGAGCTATGATGG + Intronic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
969304789 4:6319416-6319438 GCGGAGGCCCAGGGTGGTGATGG - Intergenic
971327608 4:25656857-25656879 GACAAGGCCCAGAGCGATCAGGG - Intronic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
976141324 4:81995374-81995396 GTAGAGGGCCAGAGTGCTGAGGG + Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
984851026 4:184152508-184152530 GGGGAGGCCTAGAACGTTGAAGG - Intronic
986233282 5:5885882-5885904 GTGGTGGCCCAGAAGGCTGATGG - Intergenic
986815390 5:11404338-11404360 CTGGAGGGCCAGATCGATAATGG - Intronic
989043042 5:37249045-37249067 GGGTAGGCCCAGAGCGAGGACGG + Intronic
991014630 5:61917771-61917793 GTGGAGGCTCAGAGAGATTTGGG - Intergenic
993733904 5:91453019-91453041 GTGGAAGCCCAGAGGGCTGAAGG - Intergenic
994182365 5:96781798-96781820 GTGGGGGCCCAGAGCACAGAAGG - Exonic
995086621 5:108118439-108118461 GTGGAGGCTGAGGGAGATGAGGG - Intronic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
998292284 5:140926874-140926896 GTGGACGCCTAGAGGGAGGATGG + Exonic
999583745 5:153067778-153067800 TTGGAGGCCCAGACAGATAAGGG + Intergenic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000971582 5:167720784-167720806 GTGGAAGCCCAGAGGAAGGAAGG + Intronic
1001411086 5:171512456-171512478 ATGGAGGCTCAGAGAAATGAAGG - Intergenic
1001557254 5:172645219-172645241 GTGGAGGCTCAGAGAGGTCAAGG + Intronic
1001890237 5:175332402-175332424 GTGGAGGCCCAGAGAAGTTAAGG - Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002556537 5:180046131-180046153 GTGCAGGCCCACAGTGCTGAGGG + Intronic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1003972409 6:11312018-11312040 CTGGAGGCTCAGTGCCATGATGG - Intronic
1004105474 6:12663881-12663903 TTGGAGGCCCAGAGACATGCAGG - Intergenic
1006340144 6:33442470-33442492 GTTGAGGCCTCGAGCCATGAAGG - Exonic
1006375699 6:33670642-33670664 GTGGAGGCCATGAGGCATGAAGG - Intronic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1011407111 6:87027486-87027508 GTGTAGAACCAGAGCCATGAAGG + Intergenic
1013139451 6:107317403-107317425 GGAGAGCCCCAGAGTGATGAGGG + Intronic
1013616778 6:111850792-111850814 GTGGAGACCCTGAGCGTGGATGG - Intronic
1016619242 6:146088955-146088977 GTGGAGGTGCAGACCCATGATGG + Intronic
1019519268 7:1453363-1453385 GTGAAGGCACAGGGCGAAGACGG + Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1023659946 7:42460903-42460925 CTGCAGGCCCAGTGCGAGGAAGG + Intergenic
1024096887 7:45989028-45989050 GAGGAAGCCCACAGCGGTGAAGG - Intergenic
1025031788 7:55562777-55562799 GTGGAGGCCTAGTGAGAAGAGGG + Intronic
1030130634 7:106196582-106196604 GTTGAGGCCCAGAGAGGTTAAGG + Intergenic
1034341952 7:150363092-150363114 GGGGAGGCCCCGAAAGATGAAGG - Intergenic
1034743338 7:153498704-153498726 GTGGAGGCTGAGAGAGGTGAGGG + Intergenic
1035111363 7:156484918-156484940 ATGGAGGCCTAGAGAGATCAAGG - Intergenic
1036489566 8:9212360-9212382 ATGGAGGCCCAGAGATATTAAGG - Intergenic
1036686914 8:10917823-10917845 GTTGAAGCCCAGAGAGATCAAGG - Intronic
1037579871 8:20238799-20238821 TTGGAGGCCCAGCCAGATGAAGG + Intergenic
1038189382 8:25305085-25305107 GTGGAGGCCAAGAGCATTGCCGG + Intronic
1041791427 8:61700110-61700132 GTGGAGGCCCAGGGGATTGAGGG + Intronic
1044218765 8:89645489-89645511 ATGGAAGCCCAGAGTGATGAAGG - Intergenic
1045502535 8:102754290-102754312 GCAGAGGCCCAGAGCGGAGATGG + Intergenic
1046585853 8:116148242-116148264 GTGGAAGCCAAAAGCGATCACGG + Intergenic
1047316672 8:123741103-123741125 TTGGAGGCCCAGAGGGGAGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1048442567 8:134470573-134470595 GTTGAGGCCCAGAGCAAAGAGGG + Intergenic
1048590741 8:135818479-135818501 CTGGAGGTCCTGAGAGATGAGGG + Intergenic
1049178002 8:141206013-141206035 GTGGAGGCCCAGGGCGCGGAGGG - Intergenic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1053307009 9:36991790-36991812 GTGGAGGACGAAAGTGATGAGGG - Intronic
1057062276 9:92016376-92016398 GTTGAGGCACAGAGAGGTGAGGG - Intergenic
1059330667 9:113533618-113533640 ATGGAGGCCCAGGGAGATTAAGG + Intronic
1060646787 9:125287438-125287460 GGGGAGGCACAGAGCCATGATGG + Intronic
1060982933 9:127803841-127803863 GTGGAACCCCAGAGTCATGAGGG + Intronic
1061299858 9:129698157-129698179 GAGGGGGCCCAGAGAGCTGAAGG - Intronic
1062016240 9:134292690-134292712 GGGGATGCCCAGAGGGTTGAGGG + Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1062501627 9:136854348-136854370 GTGGGGGCCCAGAGTGAGGCTGG + Intronic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1186206525 X:7206106-7206128 CTGGGGGCCCAAAACGATGAAGG - Intergenic
1187274423 X:17805605-17805627 GCTGAGGCCCAGTGGGATGAAGG + Intronic
1187777103 X:22772890-22772912 GTGGAGGAACAGAGGGATCATGG + Intergenic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1189946414 X:46184589-46184611 TGGGAGGCACAGAGGGATGAAGG + Intergenic
1190994327 X:55591454-55591476 GTGCACGCCCAAAGGGATGAGGG + Intergenic
1192024605 X:67435880-67435902 GTGGAGGCACAGAGCAGTGAGGG + Intergenic
1192204344 X:69086225-69086247 GATGAGGCCCAGAGAGGTGAAGG - Intergenic
1192343367 X:70281737-70281759 GTGGAGGCTGAGGGAGATGAGGG + Exonic
1192491585 X:71580174-71580196 GTGGAGGGCCAGTGGGATGTGGG + Intronic
1198089752 X:133316285-133316307 GTGGAGCCCCAAAGAGATTAAGG + Intronic
1199211359 X:145215112-145215134 GTGGAGGCTCACAGTGATAAAGG + Intergenic
1199897374 X:152137698-152137720 GAGGAGTCCCAGAGCCCTGAGGG - Intronic
1199947520 X:152680590-152680612 GAGGAGTCCCAGAGCTCTGAAGG + Intergenic
1199962159 X:152787864-152787886 GAGGAGTCCCAGAGCTCTGAAGG - Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic