ID: 1183591690

View in Genome Browser
Species Human (GRCh38)
Location 22:38782820-38782842
Sequence GCAGGCCCTGCCAACTCGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183591686_1183591690 -6 Left 1183591686 22:38782803-38782825 CCCAGGAGATTCAGGAAGCAGGC 0: 1
1: 0
2: 0
3: 30
4: 339
Right 1183591690 22:38782820-38782842 GCAGGCCCTGCCAACTCGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 124
1183591687_1183591690 -7 Left 1183591687 22:38782804-38782826 CCAGGAGATTCAGGAAGCAGGCC 0: 1
1: 0
2: 0
3: 27
4: 200
Right 1183591690 22:38782820-38782842 GCAGGCCCTGCCAACTCGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183591690 Original CRISPR GCAGGCCCTGCCAACTCGGT GGG Exonic
900620784 1:3586758-3586780 GCAGGCCCAGCCAACCAGGTGGG + Intronic
904169508 1:28581695-28581717 GCCGGGCCTTCCAACCCGGTGGG - Intergenic
905031094 1:34885149-34885171 GCAGGACCTGCCAGCTGGCTTGG - Intronic
911625513 1:100119591-100119613 ACAGGCCCTGCCTCCTCTGTTGG - Intronic
919430169 1:197482714-197482736 GCAGGCACTGCCAAATATGTTGG - Intergenic
920705221 1:208245324-208245346 GCAGATCCTGCGAACTCGCTGGG - Intergenic
1065752010 10:28896154-28896176 GCCGGCACTGGCAACTCGCTCGG - Intergenic
1068290787 10:54999654-54999676 TCCTGCCCTGCCAACTCAGTAGG - Intronic
1069160414 10:65084926-65084948 GCTCCCCCTGCCAACTTGGTAGG + Intergenic
1073890742 10:108097511-108097533 TGTGGCCCTGCCAACTCAGTAGG + Intergenic
1075923972 10:126235826-126235848 GCAGGGCCTGGCAACTGGCTGGG + Intronic
1076024546 10:127100877-127100899 GCAGGCCTTGCCCACACTGTGGG + Intronic
1076618658 10:131772937-131772959 CCTGGCCCTGCCACCTGGGTGGG + Intergenic
1077288855 11:1779640-1779662 GCAGTCCCTGCAAACTCAGTGGG - Intergenic
1077894385 11:6442928-6442950 GCAGGCCCAGCAAAATCTGTAGG - Intergenic
1083706177 11:64517996-64518018 GCAGTCCCTGCCGCCTCAGTGGG + Intergenic
1083915953 11:65743994-65744016 TCCTGCCCTGCCAACTCGGCAGG - Intergenic
1084933459 11:72574711-72574733 GCAGGCCATGACAACGCTGTGGG - Intergenic
1085394762 11:76201612-76201634 GGAGGCCTTGCCACCCCGGTAGG - Intronic
1091792557 12:3280229-3280251 GAAGGCCCTGCCCACTGGGGTGG - Intronic
1091801106 12:3325003-3325025 GCAGGCCCAGCCTACTCTGGGGG - Intergenic
1091871981 12:3899729-3899751 GCAGTCCCTCCCAAATGGGTTGG - Intergenic
1092234810 12:6800068-6800090 TCAGGCCCTGCCATTTCTGTGGG + Exonic
1092272164 12:7031694-7031716 TCCTGCCCTGCCAACTCAGTAGG + Intronic
1092809576 12:12260234-12260256 GCAGGCCCCGCCAACACGCCCGG - Intronic
1094491251 12:30962316-30962338 GCAGGCCCAGCCCAGTCTGTGGG + Intronic
1095749802 12:45697425-45697447 ACCTGCCCTGCCAACTCGGTAGG + Intergenic
1096120903 12:49089016-49089038 CCAGGCCCTGCCACCAAGGTAGG + Intergenic
1097864037 12:64544060-64544082 GCACGCCTTGGCACCTCGGTGGG + Intergenic
1099682170 12:85843691-85843713 TCCTGCCCTGCCACCTCGGTAGG - Intergenic
1105954596 13:25268782-25268804 TCCTGCCCTGCCAACTCGGTAGG - Intronic
1110999979 13:82165761-82165783 TCCCGCCCTGCCAACTCGGAAGG + Intergenic
1111091376 13:83452388-83452410 TCCCACCCTGCCAACTCGGTAGG - Intergenic
1114625139 14:24123903-24123925 GCAGGCCCTGCCCTCTGGGAAGG + Exonic
1116961532 14:50972979-50973001 TTTGGCCCTGCCAACTCAGTAGG - Intergenic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1121315133 14:92956886-92956908 CCAGCCCCTGCCCACTGGGTGGG - Intronic
1123165215 14:106319623-106319645 GCAGGCTGCGCCAACTCGGTGGG - Intergenic
1123583494 15:21737391-21737413 GCAGGCTGCACCAACTCGGTGGG - Intergenic
1123620144 15:22179994-22180016 GCAGGCTGCACCAACTCGGTGGG - Intergenic
1123943545 15:25228126-25228148 GCAGGCCTTGCCATCTCAGGAGG - Intergenic
1125675748 15:41501856-41501878 GCGTGCCCTGCCAGGTCGGTTGG + Intronic
1127359251 15:58230504-58230526 CAAGTCCCTGCCAGCTCGGTAGG - Intronic
1128110174 15:65071345-65071367 GCAGGGCCTGGGAACTCTGTGGG + Intronic
1128561683 15:68672831-68672853 GCAGTCCCTGGCCACTTGGTGGG - Intronic
1132996659 16:2827086-2827108 GAAGGCCCCGCCAACTGAGTGGG + Intergenic
1133042156 16:3066474-3066496 CCAGGCCCTGCGCACTCTGTGGG + Intronic
1133324601 16:4935539-4935561 GCAGGCCCTGCCCAGTCTCTGGG + Intronic
1135105070 16:19642128-19642150 GCAGCCCCTGCCTCCTGGGTTGG - Intronic
1137559370 16:49493004-49493026 GCCGGGCCTGACACCTCGGTCGG + Intronic
1139507288 16:67405315-67405337 GCAGCTCCTGCCAGCTCTGTGGG - Intronic
1142188267 16:88705167-88705189 ACTGGCCCTGCCACCTCCGTGGG + Intronic
1142474958 17:183236-183258 GCAGGCCCTGCCTACATCGTGGG - Intergenic
1144553218 17:16259814-16259836 ACTGGCCCTGCCAACTCAGAAGG - Intronic
1147597395 17:41725742-41725764 GAAGGCCCTGCTATCTCGGCTGG - Intronic
1151265004 17:72948006-72948028 GCATGGCCTGGCAACTGGGTTGG - Intronic
1151808361 17:76420849-76420871 GCCGTCCCTGCCAACTCACTGGG - Intronic
1152197028 17:78924324-78924346 GGAGGCCCTGCAAACTGGCTGGG - Intronic
1152199910 17:78939351-78939373 CCAGGCCCTGACCACCCGGTTGG - Intergenic
1152766763 17:82145672-82145694 CCAGGCACTGCCCACTCTGTGGG + Intronic
1155446004 18:25913505-25913527 GCAGGCCCTGCCCACTCATTTGG + Intergenic
1157188815 18:45563085-45563107 CCAGGCCCTGACAAGACGGTTGG + Intronic
1157281906 18:46351800-46351822 CCAGGCCCTGCCGCCACGGTGGG - Intronic
1159704984 18:71675174-71675196 TCCTGCCCTGCCAACTCGGTAGG + Intergenic
1160058618 18:75509567-75509589 GCTGGCCTTGCCAACTGTGTGGG + Intergenic
1160627703 18:80223935-80223957 GCCAGCCCTGCCAGCTGGGTTGG - Intronic
1163521748 19:17795657-17795679 GCAGGCCCTGCCAGGTGGCTGGG + Intronic
1163687343 19:18719324-18719346 GCAGGCCCTGGGGACCCGGTGGG - Intronic
1167013079 19:46821756-46821778 TCCTGCCCTGCCAACTCGGAAGG - Intergenic
1168162875 19:54523807-54523829 GGAGGCCATGCCCACTCTGTAGG + Intergenic
926111457 2:10186925-10186947 CCTGGCCCTGCCAACTTGGATGG - Intronic
927236584 2:20880530-20880552 TCCTGCCCTGCCAACTCGATAGG + Intergenic
928149152 2:28810742-28810764 GCAGGCCCCGCCCCCTCGGCCGG + Intronic
928820650 2:35356593-35356615 TCCTGCCCTGCCAACTCAGTAGG + Intergenic
936780237 2:116023784-116023806 GCAGACCCTGTCCACTCAGTGGG + Intergenic
938732647 2:134158525-134158547 GCAGGCCCTTCCAAGCCTGTGGG + Intronic
940516649 2:154691820-154691842 CCAGCCACTGACAACTCGGTGGG + Intergenic
1176062084 20:63176840-63176862 GCAGTCACTGCCAGCTCGATAGG - Intergenic
1176284732 21:5013350-5013372 ACAGGTGCTGCCCACTCGGTGGG - Intergenic
1179640839 21:42746382-42746404 GCAGGCCCTGCCACCTCTGAAGG + Intronic
1179872449 21:44250125-44250147 ACAGGTGCTGCCCACTCGGTGGG + Intronic
1179920872 21:44506643-44506665 GCAGCCCGTGCCAGCTCGCTGGG + Intronic
1180998036 22:19975176-19975198 GCAGGCTCTTCCAACTGGCTAGG + Intronic
1181039073 22:20183502-20183524 TCAGGCACTGCCAGCCCGGTGGG - Intergenic
1183366917 22:37411730-37411752 GCAGCCCCTGGCAACCCTGTGGG + Intronic
1183380672 22:37489105-37489127 GGAGACCCTGGCAACTCGGGTGG - Intergenic
1183591690 22:38782820-38782842 GCAGGCCCTGCCAACTCGGTGGG + Exonic
1183784191 22:40019849-40019871 GAAGGCCCTGTCACCTGGGTTGG - Intronic
951145206 3:19218728-19218750 GCAGGCCCTGCTCCCTCTGTTGG + Intronic
954216303 3:49126318-49126340 ACGGGCCCTGCCATCTTGGTTGG + Intronic
955376216 3:58399478-58399500 GCAGGCCACGCCAACTCTGCAGG - Intronic
961773007 3:129263855-129263877 GCAGGCCCTGCCACCAAGATGGG - Intronic
963906190 3:150775062-150775084 GCAGGCCCTTCCAACCCAGCAGG + Intergenic
963974112 3:151461229-151461251 CCAGGACCTGCCAACTTGCTAGG - Intergenic
969237744 4:5877878-5877900 GCAGGCCCTGCCCACTCTTAGGG - Intronic
969980885 4:11152943-11152965 GCAGGGCGTGCAAACTAGGTAGG + Intergenic
970807764 4:20056017-20056039 GCAGGCACTTCTAACACGGTGGG - Intergenic
971185289 4:24369827-24369849 CCAGCCCCTGCTAACTCGGAGGG - Intergenic
976297321 4:83485153-83485175 GCAGGCCCCGCCTCCTCGCTGGG - Exonic
978404947 4:108369291-108369313 GCAGGCCCTGTCTATTCAGTAGG + Intergenic
985727314 5:1523273-1523295 GCAGGGCCTGCCAAGGCGGGCGG + Intronic
987537612 5:19208560-19208582 TCCTGCCCTGCCAACTCAGTAGG - Intergenic
995548761 5:113258652-113258674 GCAGTCCCTGCCAAAAAGGTTGG + Intronic
1001685408 5:173590992-173591014 GCAGTCCCTGCCAACTGAGTTGG + Intergenic
1001906612 5:175478654-175478676 GCAGGCCCAGCCAGGTGGGTGGG + Intronic
1003640025 6:7868772-7868794 GCAGGCCCTGCCAGCTCAGCCGG - Intronic
1006986290 6:38177948-38177970 GCAGGCCCTGCCATCAAGTTAGG + Intronic
1007529323 6:42526951-42526973 GCAGGCCCAGTCAACTCAGAAGG + Intergenic
1007953379 6:45893549-45893571 GCAGGGCCTGCCAGCTCTCTAGG + Intergenic
1009643212 6:66363279-66363301 TCCTGCCCTGCCAACTTGGTAGG + Intergenic
1011624434 6:89271704-89271726 GCAGGCCCTGCCATCCCGGTGGG - Exonic
1011822730 6:91271963-91271985 TCCTGCCCTGCCAACTTGGTAGG + Intergenic
1019711252 7:2519281-2519303 GCAGGCCTTGCAAACTGGGGTGG - Intronic
1025099430 7:56122942-56122964 CCCAGCCCTGCCAACCCGGTGGG - Intergenic
1029413426 7:100429363-100429385 GCAGGCGCTGCCCACTAGGGGGG + Intronic
1032197879 7:129799716-129799738 GCAGCCCCTGCCCACTGGATGGG + Intergenic
1035732644 8:1863653-1863675 GCAGACCCTCCCACCTCGGAGGG - Intronic
1036907514 8:12719926-12719948 TCCTGCCCTGCCAACTCAGTAGG - Intergenic
1045111611 8:98942288-98942310 GCTGGCCCTGCCGCCTCGATGGG - Intronic
1047571034 8:126098921-126098943 ACAGGCCCTGCAAACTCTCTGGG + Intergenic
1052580727 9:30350326-30350348 TCCTGCCCTGACAACTCGGTAGG + Intergenic
1057790474 9:98121340-98121362 GCATGCTCTGCCAACTGGCTGGG + Exonic
1057847782 9:98538817-98538839 GCAGGCCCTGGAAACTCGCCAGG - Intronic
1058109720 9:101018773-101018795 GGAGACCCTGCCAACTCATTTGG - Intergenic
1058702826 9:107614856-107614878 GCTGGCCCTTCCAACTCAATCGG + Intergenic
1060404124 9:123364681-123364703 GCAGGCCCTGCCCCCTAAGTGGG - Intronic
1061325525 9:129861595-129861617 GCAGGCCCTGTCCAATTGGTAGG + Exonic
1062273338 9:135719665-135719687 GAAGGCCCTGCCCACTGGCTGGG + Intronic
1062408078 9:136407290-136407312 TCAGGCCCTGCCAGCTCCGACGG + Exonic
1062541382 9:137043167-137043189 CCAGGCCCGGCCAGCTCGGGGGG - Intronic
1188673785 X:32913608-32913630 GCAGACACTGCCCACTCTGTTGG + Intronic
1193169242 X:78316556-78316578 GCTGGCCTTGCCAACTGTGTGGG + Intronic
1195050002 X:101088493-101088515 GTAGGCCCAGCTAACTCGGGAGG + Intronic
1197406909 X:126065049-126065071 TCCTGCCCTGCCAACTCGGTAGG - Intergenic
1200009645 X:153111476-153111498 GCCTTCCCTGCCCACTCGGTAGG + Intergenic
1200029955 X:153288446-153288468 GCCTTCCCTGCCCACTCGGTAGG - Intergenic
1201992025 Y:20037464-20037486 GTAGTCCCAGCCAACTCGGGAGG + Intergenic