ID: 1183597875

View in Genome Browser
Species Human (GRCh38)
Location 22:38823128-38823150
Sequence CCAGGCAGCCAGGTTCTCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 232}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183597870_1183597875 -2 Left 1183597870 22:38823107-38823129 CCCATGAGGCTTGATGGGGTGCC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597866_1183597875 11 Left 1183597866 22:38823094-38823116 CCAAGATAAGGATCCCATGAGGC 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597860_1183597875 28 Left 1183597860 22:38823077-38823099 CCTTACCTGCTCCTGGCCCAAGA 0: 1
1: 0
2: 1
3: 20
4: 219
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597861_1183597875 23 Left 1183597861 22:38823082-38823104 CCTGCTCCTGGCCCAAGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597863_1183597875 17 Left 1183597863 22:38823088-38823110 CCTGGCCCAAGATAAGGATCCCA 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597871_1183597875 -3 Left 1183597871 22:38823108-38823130 CCATGAGGCTTGATGGGGTGCCA 0: 1
1: 0
2: 1
3: 17
4: 122
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597864_1183597875 12 Left 1183597864 22:38823093-38823115 CCCAAGATAAGGATCCCATGAGG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183597875 Original CRISPR CCAGGCAGCCAGGTTCTCAC CGG Exonic