ID: 1183597875

View in Genome Browser
Species Human (GRCh38)
Location 22:38823128-38823150
Sequence CCAGGCAGCCAGGTTCTCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 232}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183597860_1183597875 28 Left 1183597860 22:38823077-38823099 CCTTACCTGCTCCTGGCCCAAGA 0: 1
1: 0
2: 1
3: 20
4: 219
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597861_1183597875 23 Left 1183597861 22:38823082-38823104 CCTGCTCCTGGCCCAAGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597863_1183597875 17 Left 1183597863 22:38823088-38823110 CCTGGCCCAAGATAAGGATCCCA 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597864_1183597875 12 Left 1183597864 22:38823093-38823115 CCCAAGATAAGGATCCCATGAGG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597871_1183597875 -3 Left 1183597871 22:38823108-38823130 CCATGAGGCTTGATGGGGTGCCA 0: 1
1: 0
2: 1
3: 17
4: 122
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597866_1183597875 11 Left 1183597866 22:38823094-38823116 CCAAGATAAGGATCCCATGAGGC 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232
1183597870_1183597875 -2 Left 1183597870 22:38823107-38823129 CCCATGAGGCTTGATGGGGTGCC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG 0: 1
1: 0
2: 1
3: 16
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183597875 Original CRISPR CCAGGCAGCCAGGTTCTCAC CGG Exonic
900217177 1:1487758-1487780 CCAGGCAGGCAGATCCCCACGGG - Intronic
900371984 1:2336295-2336317 CCCGCCAGCCAGGGTCTCGCGGG - Intronic
900440438 1:2652408-2652430 CCAGGCTGTCAGATGCTCACTGG - Intronic
900446091 1:2681628-2681650 CCAGGCTGTCAGGTGCTCGCTGG - Intronic
900448220 1:2692307-2692329 CCAGGCTGTCAGATGCTCACTGG - Intronic
900451073 1:2750087-2750109 CCAGGCTGTCAGATGCTCACTGG - Intronic
900481255 1:2900527-2900549 CCAGGAAGCCATGTTCCCAGTGG + Intergenic
900867063 1:5276157-5276179 CCAGGCAGCAGGGCTCTCCCTGG + Intergenic
901433608 1:9233370-9233392 CCAGGGAGCCAGGCACTCTCTGG - Intergenic
901672049 1:10861794-10861816 GGAGGAAGCCAGGTTCTCGCTGG - Intergenic
903443224 1:23403858-23403880 CCAGCCAGCCAGCTCCTAACCGG - Intronic
903501528 1:23802709-23802731 CCAGACAGACAGGAGCTCACAGG - Intronic
903909149 1:26709493-26709515 CCAGGACCCCAGGTTCCCACTGG + Intronic
904037651 1:27567498-27567520 CCAGGCAGCCAAGGTGTCTCCGG - Intronic
904684630 1:32251307-32251329 CCAGGCAGCCAGGTTAGGCCAGG + Exonic
907326214 1:53640205-53640227 CCAGGCAGCCAGGGTCAGGCAGG + Intronic
911382437 1:97131768-97131790 CAAGGCATCCAGGTCCTAACAGG + Intronic
912414027 1:109496022-109496044 CCGGGCAGCCAGGGTCTCAAGGG + Exonic
913108844 1:115640559-115640581 TCAGGCAGCCAGGTTCCTATGGG - Intergenic
915561738 1:156691931-156691953 CCAGGCATCCAGCCGCTCACAGG - Intergenic
915941218 1:160119632-160119654 CCAGCCTTCCAGGGTCTCACAGG - Intronic
916263153 1:162862403-162862425 CCATGGAGCCAGGTCCTCTCTGG - Intronic
916529988 1:165647867-165647889 CCAGGCAGCCTGGGCCACACAGG - Intronic
920008822 1:202853054-202853076 CAGGGCAGCCAGGTCCTCTCAGG + Intergenic
924748023 1:246856524-246856546 ATATGCACCCAGGTTCTCACTGG + Intronic
1062769015 10:85237-85259 CCAGGCAGCCAGGATGTTATTGG + Intergenic
1062921319 10:1282091-1282113 TCAGGCAGTGAGGTTATCACTGG - Intronic
1063514996 10:6687145-6687167 CCAGGAAGCCAAGTTTTCCCTGG - Intergenic
1065116862 10:22491733-22491755 CAAGGCAGCCAGAGTTTCACAGG + Intergenic
1065571298 10:27073040-27073062 CACAGCAGCCAGGTTCTCAGGGG + Intronic
1068053895 10:51986034-51986056 CCAGTCAGCCATGCTGTCACCGG - Intronic
1068560892 10:58513152-58513174 CCAGGTAGCCGGGCTCTCCCTGG - Exonic
1071023271 10:81083257-81083279 GCAGGCAGCCAGGGGCTCACAGG + Intergenic
1074696154 10:116051627-116051649 ACAGGCAGGCATGTTCTCCCTGG - Intergenic
1075529715 10:123219025-123219047 TCAGGGAGCCATCTTCTCACAGG + Intergenic
1076216225 10:128695785-128695807 ACAGACAGACAAGTTCTCACTGG - Intergenic
1076315163 10:129534694-129534716 CCAGGCAGCAAGGTGCCCAGCGG + Intronic
1076407821 10:130224978-130225000 GGTGGCAGCCAGGTCCTCACTGG - Intergenic
1076661543 10:132058948-132058970 CCAGGCAGCCAGGCTCACGTGGG - Intergenic
1076932924 10:133545853-133545875 TGAGGTATCCAGGTTCTCACTGG + Intronic
1077405455 11:2380546-2380568 CCAGGGAGCCCAGTTCTCACTGG - Intronic
1079238954 11:18708995-18709017 CCAGGGAGCCTGCTTCTGACTGG - Intronic
1079252931 11:18800715-18800737 CCAGGCAACCATGTCTTCACTGG - Intergenic
1079510595 11:21205572-21205594 CCAGGGAGCCAAGTGCTCAGTGG - Intronic
1080942180 11:36931460-36931482 CCAGACACCCAGGTTTACACAGG - Intergenic
1081603115 11:44509081-44509103 CCAGGGAGCTATGTTCTGACAGG - Intergenic
1083167664 11:60901011-60901033 CCAGTCACCCATGTTCTCAGGGG + Intronic
1083341406 11:61960738-61960760 GCAGGCAGCCAGGCCATCACAGG + Intronic
1083620308 11:64046083-64046105 ACAGGCAGCCAAGGTCACACAGG + Intronic
1084155125 11:67308994-67309016 GCAGGCAGCCAGGTCCCCACGGG - Intronic
1084295550 11:68211674-68211696 CCAGGAAGCAACATTCTCACGGG + Intronic
1085191549 11:74629662-74629684 CTAGGCAGCCAGGGTATTACTGG + Intronic
1086497880 11:87422598-87422620 CCAGGCAGCCAGGAGGCCACTGG - Intergenic
1088890584 11:114041145-114041167 CCAGCCAGCCAGGGCCTCCCAGG - Intergenic
1092214954 12:6674672-6674694 CCAGGCATCCTGATTCCCACTGG - Intronic
1092529740 12:9334645-9334667 CCAGGGAGTCAGATCCTCACTGG + Intergenic
1093941705 12:25062190-25062212 CAAGGCAGCAAGGTTGGCACTGG + Intronic
1099912958 12:88855955-88855977 CTAGGCAGAGAGCTTCTCACTGG - Intergenic
1102028936 12:109728991-109729013 TCAGACAGCCAGGTACTGACAGG + Intronic
1102030757 12:109738915-109738937 CCAGGCACTGGGGTTCTCACTGG - Intronic
1102051464 12:109865203-109865225 CCAGGCAGACAGGTTCTGGGTGG - Intronic
1102470089 12:113154842-113154864 TCAGGCAGTCAGGTGCTCTCGGG - Intronic
1103914504 12:124369495-124369517 CCTGGCAGCCAGGGCCTCCCGGG - Intronic
1104729604 12:131097698-131097720 GCTGGCATCCAGGCTCTCACGGG - Intronic
1105776525 13:23666829-23666851 CCAGTCATCCTGTTTCTCACGGG + Intronic
1116618100 14:47163929-47163951 AGAGGCAGCCATGTCCTCACTGG + Intronic
1116928556 14:50667818-50667840 CCAGGCGGCCAGGTGCTCCGGGG - Intronic
1119176088 14:72568546-72568568 ACAGGGAACCAGGTCCTCACTGG - Intergenic
1119936837 14:78599847-78599869 CCAGGCAGCAAGCTTTTCATGGG - Intronic
1121404147 14:93708711-93708733 CCAGGCAGCCAGGATCTTAGTGG + Intergenic
1121554552 14:94826363-94826385 CCAGTCAGGGAGCTTCTCACAGG - Intergenic
1122273212 14:100577669-100577691 ACAGGCAGCCGGGCTGTCACTGG - Intronic
1122413438 14:101537526-101537548 CAGGGCAGCCAGGTTCTGAGAGG + Intergenic
1122717880 14:103706259-103706281 CCAGCCAGCCACCTCCTCACGGG - Intronic
1122793116 14:104192764-104192786 GCAGGGAGCCAGGTACACACAGG - Intergenic
1123028538 14:105439847-105439869 CCAGGAAGGCAGCTTCTCCCAGG - Intronic
1124641861 15:31400823-31400845 CCAGCCAGCCAGACCCTCACAGG - Intronic
1125116522 15:36099903-36099925 CAAGGTAGCCATGTTCTCACTGG - Intergenic
1128592207 15:68909809-68909831 GCAAGCAGCCAGGTGGTCACAGG + Intronic
1129635999 15:77318544-77318566 GCAGGCAGTAAGCTTCTCACTGG + Intronic
1130561491 15:84962848-84962870 CCAGGCAGCCATGTCCTCTAAGG - Intergenic
1131182547 15:90250370-90250392 CCAATCATCCAGGTTCACACTGG - Intronic
1131511166 15:93050335-93050357 CCAGCCACCGACGTTCTCACCGG + Intronic
1131892090 15:96984015-96984037 GGAGGCAGCCAGATCCTCACAGG + Intergenic
1133253879 16:4504220-4504242 CAAGGCACCCAGCCTCTCACAGG + Intronic
1133444626 16:5849458-5849480 CCAGGCATCCAGTTTCTCCCAGG + Intergenic
1134190729 16:12119240-12119262 CCAGGGAGCAAAGTCCTCACAGG - Intronic
1138075386 16:54037211-54037233 CCAGGCAGCCATGCTCGCTCGGG - Intronic
1138182210 16:54949123-54949145 CCAGCCAGCCCAGATCTCACTGG - Intergenic
1139830790 16:69796472-69796494 CCAGTCAGCCACGTGATCACAGG - Intronic
1139834053 16:69824146-69824168 CCAGCCTCCCAGGTTCTCCCAGG + Intronic
1141564712 16:84893513-84893535 CCTGGCACCCAGGATCCCACAGG + Intronic
1141824916 16:86472148-86472170 CCAGGGGGCCATGTTCTGACTGG - Intergenic
1142292499 16:89199489-89199511 GCTGGCAGCCAGGGCCTCACTGG + Exonic
1142614567 17:1126933-1126955 CCAGCCAGCCAAGTTCTCCACGG + Intronic
1149600556 17:57890588-57890610 CCAGGAAGCCAGGATCACAGTGG + Intronic
1149638959 17:58191038-58191060 TCAGGGAGCCAGGTGCTCCCCGG - Intergenic
1151288456 17:73131037-73131059 CCAGGCAGCAGAGCTCTCACGGG - Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152574257 17:81133165-81133187 CCAGGCACGCAGCTCCTCACTGG + Intronic
1152581093 17:81165918-81165940 CCGGGCCGCCAGGGACTCACCGG + Exonic
1152656604 17:81522833-81522855 CCAAGCAGCCAGGGGCTCATGGG + Intronic
1153130842 18:1854120-1854142 CCAAACTGCCAGATTCTCACAGG - Intergenic
1154295433 18:13142830-13142852 CCTGGCATCCAGGTTCTTACAGG - Intergenic
1155106826 18:22675187-22675209 CCAGGGAGTCAGATTCTCCCAGG + Intergenic
1160428359 18:78793778-78793800 CCTGACAGCCAGGTTTTCAAAGG + Intergenic
1160817406 19:1042491-1042513 CCAGGCATCCAGGCTGTCCCTGG + Intronic
1161130469 19:2585561-2585583 CCAGGCTGCCTGTTTCTAACTGG - Intronic
1161338678 19:3728722-3728744 CCAGGCAGCTGGGTTCTGGCGGG + Intronic
1161343388 19:3754497-3754519 CCAAGCAGCCTGGCCCTCACAGG + Intronic
1161663994 19:5564039-5564061 GCAGGGAGACAGGTTGTCACGGG - Intergenic
1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG + Exonic
1163642422 19:18469254-18469276 CCAGACACCGAGGTTCTCACAGG + Intronic
1163777105 19:19225104-19225126 CCAGCCAGCCCGGGTCGCACTGG - Exonic
1165127916 19:33613789-33613811 CCAGCCAGCCAGGCTCCCAGGGG - Intergenic
1168645628 19:58057193-58057215 CCTGGCAGCCAGGGTCTCTTGGG + Intergenic
925423129 2:3727620-3727642 CCAGGCACCGAGGTGCTCAGTGG + Intronic
925858065 2:8149681-8149703 CCAGCTAGACAGGTTCCCACTGG - Intergenic
925868186 2:8247077-8247099 CCAGGCAGCCAGGGTCAGAAAGG + Intergenic
925946394 2:8867938-8867960 CCAGGCAGCCACACTCTTACAGG - Intronic
927008074 2:18871538-18871560 CCAGGCAGCTAGTTGCTCTCTGG - Intergenic
927860618 2:26558044-26558066 CCAGGCAGCCAGTAGCTCCCTGG - Intronic
929863440 2:45698412-45698434 CCAGGGAGCCAGGTCCCCACCGG - Intronic
931742911 2:65264340-65264362 CCTGGCTTCCAGGTTCTCAATGG - Intronic
932570127 2:72934160-72934182 CCAGGCAGGCAGGCTCTCCGAGG - Exonic
932584396 2:73016951-73016973 CCAGTCAGCCATGTGATCACGGG - Intronic
932619415 2:73257050-73257072 CAAGGCAGCCAGGCCCTTACTGG + Exonic
934989951 2:98914083-98914105 GCAGGCAGCCAGCCTCTTACTGG - Intronic
937026805 2:118705655-118705677 CCAGGCAGCCAGGGACTCCCAGG + Intergenic
939190128 2:138907634-138907656 CCAAGCAGACAGTCTCTCACAGG - Intergenic
939466306 2:142561765-142561787 CCAGGCATCCATGTGCTCTCAGG + Intergenic
940856288 2:158730876-158730898 CCCAGGAGCCAGGTTGTCACTGG - Intergenic
941878977 2:170462522-170462544 CCAGGCAGCCACCTTCCCATGGG - Intronic
944541291 2:200756260-200756282 CTAGGAACCCAGCTTCTCACAGG + Intergenic
945448464 2:209965819-209965841 GTAGGCAGTCAGGTTCACACTGG - Intronic
946196434 2:218035163-218035185 CCAGCCAGCCAGGCTCTCCTGGG + Intronic
946200716 2:218069327-218069349 CCAGCCAGCCAGGCTCTCCTGGG + Exonic
948582375 2:238996910-238996932 CCAGGCAGCCAGGAGCCCATAGG - Intergenic
948604925 2:239128987-239129009 CCAGGCCACCAGCTTCACACGGG + Intronic
1170881870 20:20304027-20304049 GCAGGCAGCCAGGGTCTGCCTGG - Intronic
1171421076 20:25017991-25018013 CCAGGCAGTCAGAATCACACGGG + Intronic
1172205720 20:33161608-33161630 CCAGGAGGCCAAGTTCTCTCTGG - Intergenic
1172750008 20:37244167-37244189 CCAAGCAGCCAGGGTGTCACTGG + Intergenic
1174277562 20:49414777-49414799 CCCGGCAGCCAGGGTCTGGCAGG - Intronic
1174360667 20:50027277-50027299 CCAGACAGTCAGGATCTGACTGG + Intergenic
1175142636 20:56872321-56872343 CCAGACAGACAGGTCCTCATAGG + Intergenic
1175898769 20:62351816-62351838 CCTGGCCGCCTGGTGCTCACGGG - Intronic
1176166702 20:63678065-63678087 CCAGGAATCCTGGTTCTCAAGGG + Intronic
1176263784 20:64197942-64197964 CCAGGTTGCCTGTTTCTCACGGG + Intronic
1177336764 21:19738282-19738304 ACAGGCTGGCAGGTCCTCACAGG - Intergenic
1179594508 21:42433401-42433423 CCAGGCACCCACATCCTCACAGG + Intronic
1179953428 21:44724314-44724336 TCCGGCAGCCAGGTGCTGACTGG + Intergenic
1179990780 21:44947281-44947303 CCAGGCAGACAGGCACCCACAGG - Intronic
1180756364 22:18164647-18164669 CCAGGCTTCCAGTTTCTCCCTGG - Intronic
1180864229 22:19106687-19106709 CCAGCCAGCTAGCTTCTCAGAGG + Intronic
1180995444 22:19963110-19963132 CCAGTCAGACAGGTTCTCCTGGG + Intronic
1181110352 22:20599101-20599123 ACATGCAGCCAGGTGCTCCCTGG + Intergenic
1181673430 22:24436792-24436814 ACGGGCAGGCAGGGTCTCACTGG + Intronic
1181878254 22:25956919-25956941 CCAGACAGCCAGCTTGTCAAGGG - Intronic
1182125105 22:27810533-27810555 CCATGCAGCCAGGGTCTGAGGGG - Intergenic
1182282280 22:29224530-29224552 CCAGGCAGCCAGCCTCCCTCTGG + Intronic
1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG + Exonic
1183945864 22:41325346-41325368 CCAGACAGCCAGGTTTTGCCAGG - Intronic
1184209182 22:43025237-43025259 GCAGGCAGGCAGGCTCTCCCCGG - Intergenic
1184803071 22:46774304-46774326 CCAGGCAGCCCTGTTCCCTCTGG - Intronic
1185129307 22:49028615-49028637 CCAGACAGCCCGGGTCACACAGG - Intergenic
1185219010 22:49619582-49619604 CAAGGCAGCGAGCTCCTCACGGG + Intronic
949513220 3:4784436-4784458 GCAGGCAGCCCTGATCTCACAGG + Intronic
950422574 3:12907476-12907498 CCAGTCAGCGAGCTTCTCCCAGG - Intronic
951998334 3:28756330-28756352 CCAGGAAGACAGGTTCTTTCAGG + Intergenic
953793195 3:45964161-45964183 GCAGGCAACCAGGTTCTCTGTGG + Intronic
955221544 3:57027317-57027339 CCAGGCAGTCACCTTCTCATAGG - Intronic
956909041 3:73797798-73797820 CCTAACAACCAGGTTCTCACAGG - Intergenic
957640799 3:82850576-82850598 CCAGGCATCAAGGATTTCACTGG + Intergenic
964662577 3:159136628-159136650 CCTGACAGCGGGGTTCTCACTGG + Intronic
965728546 3:171745899-171745921 GCAGGCAGCCTGGTTCCCACTGG - Intronic
968605266 4:1532381-1532403 CCAGGCAGCCAGCTGGGCACAGG + Intergenic
968878437 4:3286378-3286400 CCAGGCAGCCAGGAGCTTTCAGG - Intergenic
969322366 4:6420387-6420409 GCAGGCAGCCAGGATCTCACAGG + Intronic
969364513 4:6686351-6686373 CCAGCCAGCCCTGTGCTCACAGG + Intergenic
969374447 4:6754004-6754026 CCAGGCACCCGGCTTCTCCCAGG + Intergenic
970003588 4:11388642-11388664 CCATTCAGCCACGTGCTCACTGG + Intergenic
970790697 4:19854524-19854546 CCCTGCAGCAAGGTTCTCTCTGG + Intergenic
973569705 4:52225420-52225442 TCAGGCAGCCAGGAGCTCAGAGG - Intergenic
977709610 4:100110116-100110138 CCAACCAGCCAGATTCTCTCTGG + Intergenic
980054376 4:128065742-128065764 CAAGGCAGCCAGGTTATAAGTGG - Intronic
981072592 4:140559846-140559868 CCAGTCAGCAAGATTCCCACTGG + Exonic
984253261 4:177359930-177359952 CCAGGCAGCCTGTTTCTTGCAGG + Intronic
987403605 5:17502651-17502673 CCAGGCAGCCTGGCTCTGGCTGG + Intergenic
991949580 5:71934163-71934185 GCAGGCAGCCAGGCTCATACTGG + Intergenic
993498834 5:88640325-88640347 CCAGCCACCCTGGTTCTGACTGG + Intergenic
998380188 5:141718922-141718944 CCAGGCAGCCAGAGTCTGTCTGG + Intergenic
998498661 5:142613307-142613329 CCTGGCAGCCCGGTTCTCAGAGG - Intronic
1001981455 5:176040576-176040598 CCATGCCACCAGCTTCTCACGGG - Intergenic
1002236010 5:177803490-177803512 CCATGCCACCAGCTTCTCACGGG + Intergenic
1003221290 6:4163199-4163221 CCAGGCCGACAGGTTTTCAGCGG + Intergenic
1007274252 6:40661794-40661816 CCAGGCATCCAGGATCCCCCTGG + Intergenic
1011326963 6:86159075-86159097 AGAGACAGCCAGGTTATCACTGG - Intergenic
1016608376 6:145961082-145961104 CAATGCAGCCCGGTTCTAACAGG + Intronic
1016921960 6:149304393-149304415 CCAGGCAGCCAGTTTCCTGCTGG + Intronic
1017091381 6:150762429-150762451 CGAGGCAGGCAGGTTATCAGAGG - Intronic
1017117037 6:150987440-150987462 GCACGTAGCCAGGTCCTCACAGG - Intronic
1017501753 6:155032221-155032243 ACAAGCAGGCAGGTTCGCACAGG - Intronic
1017720664 6:157241044-157241066 CCAGGCAGCCAGGTTTCCAAGGG + Intergenic
1017819541 6:158039404-158039426 CCACGCAGCCCGATCCTCACGGG - Intronic
1018744275 6:166750110-166750132 CCAGGAAGCCAACTTCTCTCCGG - Intronic
1018777058 6:167027394-167027416 CGGTGCAGCCAGGTTCTCAATGG + Intronic
1018976377 6:168570496-168570518 GGAGGGAGCCAGGTTTTCACAGG + Intronic
1019481841 7:1270493-1270515 CCAGGCAGCCCGGATGCCACTGG - Intergenic
1020442352 7:8231670-8231692 AAAGGCAGCCCAGTTCTCACGGG + Intronic
1023758478 7:43442076-43442098 CCAGTCAGCCATGTGATCACAGG + Intronic
1028356417 7:89915699-89915721 CCAAGTGTCCAGGTTCTCACAGG + Intergenic
1029318260 7:99734334-99734356 CTAGGATGCCAGGATCTCACTGG + Intronic
1029421310 7:100473055-100473077 CCAGGCTGCCTGCTTCTCCCCGG - Intronic
1029659210 7:101948089-101948111 CCAGGCAGCCAGATTCGGCCAGG + Intronic
1030302618 7:107989698-107989720 CCTCCCAGCCAGGCTCTCACGGG - Intronic
1032097958 7:128948890-128948912 GCAGCCAGCCAGGTGCTCATCGG - Intronic
1032193549 7:129777782-129777804 CTGGGCAGCCAGGGACTCACAGG + Intergenic
1034535688 7:151724474-151724496 CAAGGCAGGGAGGTTCCCACAGG + Intronic
1034945675 7:155260286-155260308 CCAGGGACCCAGGTTCTCCTGGG - Intergenic
1035462358 7:159049828-159049850 TCAAGCAGCCAGGTGCTCTCTGG - Intronic
1048972012 8:139650482-139650504 CCAGACACCCAGGTGCACACAGG - Intronic
1049104185 8:140601146-140601168 GGAGACAGCCAGGTTCCCACGGG + Intronic
1049207173 8:141369017-141369039 CCTGGCAGGCAGGGTTTCACCGG + Intergenic
1053596491 9:39566944-39566966 TCAGTCAGGCAGTTTCTCACAGG + Intergenic
1054569768 9:66798074-66798096 TCAGTCAGGCAGTTTCTCACAGG - Intergenic
1055639610 9:78309308-78309330 TCAGGCAGCCAGCTTCCCGCAGG - Intronic
1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG + Intergenic
1057210378 9:93198107-93198129 CCAGGCAGCCAGGGGCTGAGTGG + Intronic
1058600335 9:106662404-106662426 CCAGGGAACAAGGTTCTCTCTGG - Intergenic
1059739898 9:117139963-117139985 TCAGACTGCCAGGTTCTCCCTGG + Intronic
1060892900 9:127199626-127199648 CCTGGCAGACAGGCTCTCCCAGG - Intronic
1062320135 9:135986689-135986711 CCAGGCAGCCAGGGACTTCCCGG + Intergenic
1062345812 9:136114656-136114678 GCAGGCGGCCAGGTGCTCAGAGG + Exonic
1062697182 9:137881390-137881412 CCAGGAAGCCAGGCTCTCGAGGG - Intronic
1188001783 X:24989257-24989279 CCATCCAACCTGGTTCTCACAGG - Intronic
1189846272 X:45141681-45141703 CTACCCAGCCAGGTCCTCACGGG - Intergenic
1190059538 X:47201953-47201975 CCAGGGACACAGGGTCTCACGGG + Intronic
1191253914 X:58271711-58271733 ACAGGCGGCCAGGCTTTCACGGG - Intergenic
1191255815 X:58279133-58279155 ACAGGCGGCCAGGCTTTCACAGG - Intergenic
1191256008 X:58279935-58279957 ACAGGCAGCCAGGCTTTCAGGGG - Intergenic
1193021765 X:76799797-76799819 CCATCCTGTCAGGTTCTCACAGG - Intergenic
1199504124 X:148542635-148542657 CCATGCAGACAGGTGCCCACAGG + Intronic
1199833196 X:151563748-151563770 CCAGGCTCCCGGGCTCTCACCGG + Exonic
1200161927 X:154014023-154014045 CCAGGTAGCCAGCTGCGCACTGG - Exonic
1202256614 Y:22928127-22928149 CCAGGCACCCAGATCCTTACAGG - Intergenic
1202368745 Y:24183546-24183568 CAAGGCAGCCAGGGTGGCACAGG - Intergenic
1202409605 Y:24561880-24561902 CCAGGCACCCAGATCCTTACAGG - Intergenic
1202461178 Y:25108197-25108219 CCAGGCACCCAGATCCTTACAGG + Intergenic
1202502040 Y:25486571-25486593 CAAGGCAGCCAGGGTGGCACAGG + Intergenic