ID: 1183599152

View in Genome Browser
Species Human (GRCh38)
Location 22:38830053-38830075
Sequence GTCCCCTGCATCAGAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183599146_1183599152 12 Left 1183599146 22:38830018-38830040 CCTGTTTTCTAGCCATGGGACAA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1183599152 22:38830053-38830075 GTCCCCTGCATCAGAGTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1183599150_1183599152 0 Left 1183599150 22:38830030-38830052 CCATGGGACAAGGGGAGAAGTGC No data
Right 1183599152 22:38830053-38830075 GTCCCCTGCATCAGAGTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1183599143_1183599152 28 Left 1183599143 22:38830002-38830024 CCTTAACTTCTCTGAGCCTGTTT 0: 1
1: 5
2: 43
3: 179
4: 751
Right 1183599152 22:38830053-38830075 GTCCCCTGCATCAGAGTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183599152 Original CRISPR GTCCCCTGCATCAGAGTGCT GGG Intronic
901811922 1:11772229-11772251 GCCCCCAGCACCAGAGAGCTTGG + Exonic
902128625 1:14239351-14239373 GTCCCCAGACTCAGAGAGCTTGG - Intergenic
902580197 1:17403134-17403156 GACACCTGCAGCAGAGAGCTGGG + Intergenic
905573771 1:39026992-39027014 TTCCCCCGCATCTGAGTGCCTGG + Intronic
906207886 1:43996791-43996813 GTCCCCTTCCCCAGGGTGCTGGG + Intronic
909656125 1:78034499-78034521 GTAGGGTGCATCAGAGTGCTGGG + Intronic
910875512 1:91874409-91874431 GTCACCAGCATAAGAGTGGTGGG + Intronic
911093901 1:94040123-94040145 GTCCCCTGCAACAGATGGATGGG + Exonic
913718129 1:121560077-121560099 GTCGGATGCATAAGAGTGCTAGG - Intergenic
915602984 1:156933951-156933973 GTCTCCTGCCTCTGAGTGCCTGG + Intergenic
916003614 1:160639331-160639353 GTCCCCTGCCTCAGTCTCCTGGG + Intronic
916715437 1:167443252-167443274 AGCCCCAGCATCAGAGTGCAGGG + Intronic
917512861 1:175682624-175682646 GTCCTCTCCATCAGAGTCTTGGG - Intronic
917709414 1:177669439-177669461 TTCCCCTGCCTCAGAGTAATAGG + Intergenic
922811596 1:228418213-228418235 GTGCCCTGAGTCAGAGTCCTGGG + Intergenic
923184239 1:231554454-231554476 GTCCCCACCCTCAGAGTTCTAGG + Intronic
923394080 1:233543512-233543534 GTCCCCTGCAAGGCAGTGCTGGG + Intergenic
924444097 1:244112519-244112541 GTCCTCTGCATAACAGTCCTGGG - Intergenic
1069422555 10:68260382-68260404 GTCCCCTGCCTCAAAATGCATGG - Intergenic
1071601263 10:86959722-86959744 GGCTCCTGCATCCTAGTGCTGGG + Intronic
1073551133 10:104402783-104402805 GTCCCCGGCTTCAGAGGTCTTGG - Intronic
1074663478 10:115690559-115690581 GACCCCTGGACCAGAGTACTGGG + Intronic
1075782736 10:125027332-125027354 GTCCCCAGCTACGGAGTGCTTGG - Exonic
1076072649 10:127503811-127503833 GCCCCCTGCATTAGTTTGCTGGG + Intergenic
1079475297 11:20823619-20823641 ATCTCCTGAATCTGAGTGCTTGG + Intronic
1079669538 11:23150003-23150025 GACCTCTGCATAAGAGTTCTTGG + Intergenic
1081694461 11:45100297-45100319 GTCCTATCCATCAGAGTGATGGG + Intronic
1082204724 11:49419223-49419245 TTCCCCTGGATCATAGGGCTTGG - Intergenic
1083298586 11:61728356-61728378 GGCCCCTGCAGCGGAGGGCTCGG + Intronic
1083835280 11:65262470-65262492 TTCCCCTGGAGCAGAGTTCTCGG + Intronic
1085393160 11:76192910-76192932 ATCCCCTGCATCAGAGACATGGG + Intronic
1086700765 11:89898250-89898272 CTCCACTGCATCAGAGAGGTTGG - Intergenic
1086705404 11:89946277-89946299 CTCCACTGCATCAGAGAGGTTGG + Intergenic
1088902250 11:114127109-114127131 TTCCCCTGGATCACAGAGCTTGG + Intronic
1091344194 11:134842012-134842034 GTCTGCTGCACCAGAGTGCTGGG - Intergenic
1100776038 12:97975813-97975835 GTCATCTGCATCAGTGTCCTTGG + Intergenic
1101271607 12:103151973-103151995 CTCCCCTGCATCAAATTTCTTGG - Intronic
1111432104 13:88158514-88158536 GCCACCTGCTTCAGAGTGCTGGG + Intergenic
1113746942 13:112751825-112751847 TTCTCCCGCCTCAGAGTGCTGGG + Intronic
1114027003 14:18536970-18536992 GACCCTTGCATCAGAGTTCTGGG - Intergenic
1118902653 14:69999606-69999628 GGCACCTGCATCAGAGAGATGGG - Intronic
1121823596 14:96992061-96992083 GCCCATGGCATCAGAGTGCTTGG - Intergenic
1124365501 15:29068503-29068525 GTCTACTGCAGCAGAGTGCCAGG + Intronic
1128337659 15:66797749-66797771 GGCCCCAGCCTCAGTGTGCTTGG - Intergenic
1129461606 15:75702650-75702672 GTCCCCTGCCTCTGAGCCCTGGG - Intronic
1132485565 16:188822-188844 GTCCCCTGCATCTGACTGACGGG - Intergenic
1134271236 16:12735064-12735086 GTCACCAGCAGCAGAGAGCTAGG + Intronic
1142302514 16:89266787-89266809 GTCCCCTGTACCTGGGTGCTGGG - Intergenic
1142360134 16:89622121-89622143 GGCTCCTGCATGAGAGTCCTGGG - Intronic
1144326744 17:14189841-14189863 GTCCACTCCATCAGGATGCTTGG + Intronic
1144593956 17:16549995-16550017 GTCCCTTGCATAATAGTGCATGG - Intergenic
1146521105 17:33526295-33526317 GTCCCCAGCACCTGACTGCTTGG - Intronic
1148694942 17:49553148-49553170 GCCCCCTCCATGAGAGTCCTGGG + Intergenic
1150492752 17:65585647-65585669 GTTCTCTGCATCAGAGTCCTGGG + Intronic
1150694299 17:67390935-67390957 GTCCCCTTTGTCAAAGTGCTGGG - Intronic
1150817024 17:68400527-68400549 GTCACCTGCATCAGAACCCTTGG + Intronic
1151161997 17:72173793-72173815 GGCCCCTGCATCCGGGTTCTGGG + Intergenic
1151595247 17:75074445-75074467 GTGCCCTGCATCAGGCTGCAGGG + Intergenic
1152071769 17:78137701-78137723 TTCCCCTGCACCCCAGTGCTGGG + Exonic
1152549842 17:81023785-81023807 GGCCCCTGCATCTGGGTGGTTGG - Intergenic
1203156631 17_GL000205v2_random:10149-10171 GACCCCAGCAACAGAGTTCTGGG + Intergenic
1153469773 18:5430804-5430826 TCCCCCTGTCTCAGAGTGCTAGG + Intronic
1156604954 18:38655292-38655314 GTGCCCTGAATCCCAGTGCTTGG - Intergenic
1160892700 19:1387615-1387637 GTCCCCTGCTTGAGACTGCATGG - Intronic
1164380466 19:27733391-27733413 GTCTCTTTCATCAGAATGCTTGG + Intergenic
1166068473 19:40374095-40374117 GCCTACTGAATCAGAGTGCTGGG - Intronic
1167473745 19:49688868-49688890 GTCCCCAGCTGCAGAGGGCTGGG - Exonic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
927055952 2:19365601-19365623 GCCTCCTAAATCAGAGTGCTGGG - Intergenic
927828835 2:26330553-26330575 TTCCCCTCCCTCAGAGTTCTCGG + Intronic
931669000 2:64630174-64630196 TACCCCTGCATCAGTGTGCTAGG + Intergenic
932463136 2:71896296-71896318 GTCACCTCCATCAGACTGTTAGG + Intergenic
933253098 2:80050525-80050547 GGCCCTTGCTTCACAGTGCTGGG + Intronic
936060096 2:109289366-109289388 GTTCCTTGCATCAGAGTTTTAGG + Intronic
937669865 2:124527121-124527143 GTCCCCTCCCTGAGAATGCTAGG + Intronic
938965090 2:136381294-136381316 GTCTCCAGCTTCAGAGGGCTGGG + Intergenic
942503654 2:176618739-176618761 GTGCCCTCCATCAGAGAGGTTGG + Intergenic
944277349 2:197853993-197854015 CTCACCTGCATCAGAATCCTTGG + Intronic
948880505 2:240854893-240854915 CTCCCCTGCATCATAGTGACTGG - Intergenic
948994762 2:241572720-241572742 GGCCCCTGCATCTGAGGCCTGGG - Exonic
1170570307 20:17628784-17628806 GGCCCCTGCTCCAGAGGGCTGGG - Intronic
1170708427 20:18767118-18767140 GTCCCCTGCAGCAGAGAGACGGG + Intergenic
1173217066 20:41094915-41094937 GCTCCCTGCATCAGAGTAGTGGG - Intronic
1173869912 20:46334827-46334849 GTGTCCTGCACCAGGGTGCTTGG + Intergenic
1180451138 22:15464165-15464187 GACCCTTGCATCAGAGTTCTGGG - Intergenic
1180859833 22:19071602-19071624 GCCCCCTGCAAAAGAGGGCTGGG + Intronic
1181691312 22:24562943-24562965 GTCTCCTGTATCTGAGTGCCAGG - Intronic
1182428004 22:30285030-30285052 GTCCCCTCCATCTGAGGTCTTGG - Intergenic
1182679637 22:32068605-32068627 GTCCACTGCCCCAGAGGGCTGGG + Intronic
1183296666 22:37033874-37033896 GTCCCCTGTCTCAGTGTGCACGG + Intergenic
1183486051 22:38088381-38088403 GCCCCCTGCATCAGAGTTCCAGG + Intronic
1183599152 22:38830053-38830075 GTCCCCTGCATCAGAGTGCTGGG + Intronic
949829751 3:8201290-8201312 GTCACCTGCCTCACAGTGCCTGG + Intergenic
950144214 3:10636229-10636251 CACTCCTGCCTCAGAGTGCTAGG + Intronic
953099172 3:39809208-39809230 GTCTCCTGCCTCTGAGTCCTGGG - Intronic
953532635 3:43752359-43752381 TTCCTTTGCATCAGAGTCCTAGG - Intergenic
954788248 3:53111161-53111183 TCCGCCTGCCTCAGAGTGCTGGG - Intronic
955235411 3:57134861-57134883 TCCCCCTGCCTCAAAGTGCTGGG - Intronic
956740063 3:72268770-72268792 GTCCTCTGTATTAGTGTGCTAGG - Intergenic
961478128 3:127161296-127161318 GTGGCCTGGACCAGAGTGCTGGG - Intergenic
961856781 3:129879332-129879354 GTCCCCTGCATCAGTGTCTCAGG - Intronic
967341983 3:188408463-188408485 GTGCCCTGCAGCACAGTCCTTGG + Intronic
967858817 3:194136901-194136923 GTCAGCTGCTTCAGAGTGCTGGG - Intronic
968439194 4:612990-613012 TTGCCCTGCATCACTGTGCTTGG + Intergenic
969522592 4:7687195-7687217 GTCCCCAGCAGCAGTGTGCCCGG - Intronic
970866629 4:20766456-20766478 GTCTCCTGCCTCAGCCTGCTGGG - Intronic
971046365 4:22809658-22809680 CTCCCCTGCTTTAGTGTGCTGGG - Intergenic
972365179 4:38367847-38367869 GTCCCCTGGATCACAGGGCAAGG - Intergenic
976738124 4:88331299-88331321 GTCCCTTTCATCAAAGTACTGGG + Intergenic
978114505 4:105003258-105003280 GTCTCCTGCCTCAGTGTGGTAGG + Intergenic
983892650 4:173046499-173046521 CTCCCCTGAAGAAGAGTGCTAGG + Intergenic
984946600 4:184973677-184973699 GTCCCCTGTATTAGTTTGCTAGG + Intergenic
984950945 4:185007374-185007396 GTCCCTTCCAGCAGTGTGCTGGG - Intergenic
989613163 5:43314243-43314265 GTCCCTTTCCTCAGAGTGCATGG - Intergenic
992918213 5:81481700-81481722 GACAACTGCATCAGAGTTCTTGG - Intronic
995455584 5:112348531-112348553 GTCCCCTGAATCACACTGCAGGG + Intronic
1001843845 5:174903717-174903739 GTCCCCTCCATTAGTGTCCTTGG - Intergenic
1005632156 6:27718222-27718244 GTCCTCTGCACCAGAAAGCTTGG + Intergenic
1007986050 6:46207678-46207700 GTACCCTACACCAGAGAGCTTGG - Intergenic
1008854097 6:56060791-56060813 CTTCCCTGCATCAAAGTGTTAGG + Exonic
1014736525 6:125100716-125100738 GTACCCTGCCTCAGAGTCCCTGG - Intergenic
1015812933 6:137179183-137179205 GTCCCCTGGATCAGGCTGCTGGG - Intergenic
1019149514 6:169994868-169994890 GTTCTCTGCATTAGAGTCCTCGG - Intergenic
1019737947 7:2659728-2659750 GTCCCCTGTAGCACAGAGCTGGG + Intronic
1021411856 7:20337949-20337971 CTCTCCTGCATCAGTGTCCTTGG - Intronic
1021590064 7:22251411-22251433 GGGCCCTGCCTCAGAATGCTGGG + Intronic
1021621291 7:22553111-22553133 ATCCAGTGCATCAGAGTCCTAGG - Intronic
1022172100 7:27840559-27840581 CTCTCCTGCATTAGAGTGCGTGG - Intronic
1023686281 7:42738711-42738733 TTCCCCTGTATCTGAGTGCGTGG - Intergenic
1024543461 7:50498249-50498271 GTCCTCTGCATTAGACTCCTTGG - Intronic
1026612829 7:71875579-71875601 GTCCCCAGTATCAGGGTCCTAGG - Intronic
1026830774 7:73608649-73608671 GTCCTCTGCCTCAGAAGGCTAGG + Intronic
1033539927 7:142347138-142347160 GTCTCCTGAAGCAGAGTCCTGGG + Intergenic
1034317980 7:150151902-150151924 GAATCCTGCATCAGAGTGCCTGG - Intergenic
1034318218 7:150154246-150154268 GAATCCTGCATCAGAGTGCCTGG - Intergenic
1034774535 7:153812986-153813008 GAATCCTGCATCAGAGTGCCTGG + Intergenic
1034774770 7:153815337-153815359 GAATCCTGCATCAGAGTGCCTGG + Intergenic
1039422155 8:37452199-37452221 GTCCCCAGCCTGAGAGAGCTTGG - Intergenic
1040948091 8:52906120-52906142 GTTCCCTGCACCACTGTGCTCGG - Intergenic
1043596790 8:81896973-81896995 GTTTCCTGCCTCACAGTGCTGGG - Intergenic
1044580652 8:93822661-93822683 CTTTACTGCATCAGAGTGCTGGG + Intergenic
1044628202 8:94255141-94255163 GTCCCCTGTACCTGAGTGGTGGG - Intronic
1048077658 8:131090608-131090630 GGCCTCTCCATCAGAGTTCTTGG - Intergenic
1048125548 8:131631231-131631253 TTCCCCTACATCAGACTTCTAGG + Intergenic
1049577904 8:143398097-143398119 GTCCCCTGCCCCTGAGTTCTTGG - Intergenic
1049656292 8:143799842-143799864 GGCCACTGCTCCAGAGTGCTAGG + Intronic
1050270656 9:3941015-3941037 GACCCCAGAATCAGAATGCTGGG + Intronic
1056161919 9:83904944-83904966 TTACCTTGCATCAGAGTGCAAGG + Intronic
1059282039 9:113143240-113143262 GCCTCCAGAATCAGAGTGCTTGG + Intergenic
1061139816 9:128758906-128758928 GTCTCCTTGATCAGAGTACTGGG + Intronic
1186071730 X:5828186-5828208 GGCCCCTGTAGCAGAGTGGTTGG + Intergenic
1187455527 X:19438215-19438237 AACTCCTGCCTCAGAGTGCTGGG + Intronic
1191230458 X:58089478-58089500 GTCGCTTGCATTAGAATGCTTGG - Intergenic
1191849173 X:65572922-65572944 GACCCCTGCACTAGAGGGCTGGG - Intergenic
1193685300 X:84570919-84570941 GTCACCTCCATCAGAGCTCTTGG - Intergenic
1199656955 X:150005807-150005829 GATCCCTGGATCAGAGTGGTGGG + Intergenic