ID: 1183599534

View in Genome Browser
Species Human (GRCh38)
Location 22:38831962-38831984
Sequence GAGAGGAGATGCTGGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 382}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183599534_1183599547 28 Left 1183599534 22:38831962-38831984 CCCTGGAGCCAGCATCTCCTCTC 0: 1
1: 0
2: 2
3: 40
4: 382
Right 1183599547 22:38832013-38832035 TTGCCAGGAAGAACAGAGGGAGG 0: 1
1: 0
2: 1
3: 35
4: 355
1183599534_1183599542 0 Left 1183599534 22:38831962-38831984 CCCTGGAGCCAGCATCTCCTCTC 0: 1
1: 0
2: 2
3: 40
4: 382
Right 1183599542 22:38831985-38832007 TCCAGCAAAGGGAGAGAGGGAGG 0: 1
1: 0
2: 12
3: 81
4: 733
1183599534_1183599540 -4 Left 1183599534 22:38831962-38831984 CCCTGGAGCCAGCATCTCCTCTC 0: 1
1: 0
2: 2
3: 40
4: 382
Right 1183599540 22:38831981-38832003 TCTCTCCAGCAAAGGGAGAGAGG 0: 1
1: 0
2: 3
3: 55
4: 329
1183599534_1183599541 -3 Left 1183599534 22:38831962-38831984 CCCTGGAGCCAGCATCTCCTCTC 0: 1
1: 0
2: 2
3: 40
4: 382
Right 1183599541 22:38831982-38832004 CTCTCCAGCAAAGGGAGAGAGGG No data
1183599534_1183599545 24 Left 1183599534 22:38831962-38831984 CCCTGGAGCCAGCATCTCCTCTC 0: 1
1: 0
2: 2
3: 40
4: 382
Right 1183599545 22:38832009-38832031 AGACTTGCCAGGAAGAACAGAGG 0: 1
1: 0
2: 2
3: 22
4: 246
1183599534_1183599544 13 Left 1183599534 22:38831962-38831984 CCCTGGAGCCAGCATCTCCTCTC 0: 1
1: 0
2: 2
3: 40
4: 382
Right 1183599544 22:38831998-38832020 GAGAGGGAGGAAGACTTGCCAGG 0: 1
1: 1
2: 6
3: 51
4: 509
1183599534_1183599546 25 Left 1183599534 22:38831962-38831984 CCCTGGAGCCAGCATCTCCTCTC 0: 1
1: 0
2: 2
3: 40
4: 382
Right 1183599546 22:38832010-38832032 GACTTGCCAGGAAGAACAGAGGG 0: 1
1: 0
2: 2
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183599534 Original CRISPR GAGAGGAGATGCTGGCTCCA GGG (reversed) Intronic
900419838 1:2551264-2551286 GAGTGGAGTTGCTGGGTCCTAGG + Intergenic
900425137 1:2574774-2574796 GAGTGGAGTTGCTGGGTCCTAGG - Intergenic
900491763 1:2952834-2952856 GAGAGGAGATGGTGGGTCAGGGG - Intergenic
900550385 1:3251573-3251595 GAGAAGGGGTGCTGGTTCCAGGG - Intronic
900597818 1:3490494-3490516 GACTGGAGAGGCGGGCTCCACGG + Exonic
900744385 1:4351292-4351314 CGGAGGAGATGGGGGCTCCATGG + Intergenic
901757411 1:11449686-11449708 GAGAGGACGTGCTGGATCAAAGG - Intergenic
901775665 1:11558994-11559016 GTGAGGAGGTGCAGGCTCCAAGG - Intergenic
902225083 1:14991681-14991703 GAGAGGCCAGGCTGGCCCCAGGG + Intronic
902736704 1:18405972-18405994 GGGAGGAGATGCTGGGGACATGG + Intergenic
903337488 1:22634888-22634910 GAGAGGAGCTACCCGCTCCAGGG - Intergenic
904359708 1:29963440-29963462 TAGAGGACATGCTGCCTCCCTGG - Intergenic
905866996 1:41382010-41382032 GAGCGGCGATGATGGCGCCAGGG - Exonic
906010918 1:42524707-42524729 GAGAGGAGATGGCTGCTGCAGGG + Intronic
906174952 1:43762997-43763019 AAGTGGAAATGCTGGGTCCAAGG - Intronic
906980364 1:50622385-50622407 GTGAGGAGATGCTGAAGCCAAGG - Intronic
907152987 1:52306273-52306295 GAGAGGAGCTGCCCACTCCAGGG + Intronic
907152996 1:52306341-52306363 GAGAGGAGCTGCTCACTCCAGGG + Intronic
908456507 1:64309627-64309649 GTGAGAAGATGCTGGCTGCATGG - Intergenic
908671619 1:66554319-66554341 GAGATTAGATGCTTTCTCCAAGG + Intronic
909078775 1:71084458-71084480 GAGAGGAGATAGTGACTTCATGG + Intergenic
910835362 1:91503048-91503070 CAGAGGAGATACTGCCGCCAAGG - Intronic
911540063 1:99146942-99146964 GAGAGGAGCTACCGTCTCCAGGG + Intergenic
912472263 1:109913781-109913803 GGGAGGAAATGCTGGGCCCAGGG + Intronic
912564107 1:110572887-110572909 GAGAGGACAAGCTGGGTCCTGGG - Intergenic
912700523 1:111875065-111875087 GAGGGGCCATGGTGGCTCCAGGG + Intronic
913191263 1:116415311-116415333 TAGAGGTGATGCAGGCCCCAAGG - Intergenic
913995662 1:143650424-143650446 GAGAGAAGCTGCGGGGTCCAGGG + Intergenic
914360607 1:146932806-146932828 GAGAGAAGCTGCGGGGTCCAGGG - Intergenic
914392702 1:147236652-147236674 GAGAGGAGCTGCTTACTCCAGGG - Intronic
914491979 1:148157833-148157855 GAGAGAAGCTGCGGGGTCCAGGG + Intergenic
915100472 1:153495500-153495522 GGGAGGACAGGCTGGCCCCAGGG + Intergenic
915365547 1:155313466-155313488 GAGAGGAGCAGCTGGCTCAAGGG + Intronic
915622019 1:157091865-157091887 GAGAGGAGATGCTGGCAGGAGGG + Intergenic
916436263 1:164780635-164780657 GACAGGAAATGATGGCTCCATGG + Intronic
917269613 1:173258622-173258644 GAGAGGAGCTGCTGTCACCGTGG + Intergenic
917612834 1:176706395-176706417 GAGCGGAGATGGCTGCTCCAAGG + Exonic
919914468 1:202130937-202130959 GGGGAGAGATGGTGGCTCCAAGG + Exonic
921885111 1:220297567-220297589 GAAAAAAGATGTTGGCTCCAGGG - Intergenic
921935909 1:220796808-220796830 GAGAGGTTCTGCTGCCTCCATGG + Intronic
922748348 1:228059641-228059663 GAGAGGAGACACTAGCTCCAGGG - Exonic
923394733 1:233550447-233550469 GAGAGCAGAGACTGGCTCTAGGG - Intergenic
924053369 1:240099893-240099915 GAGAGGAGATGATGGATGGATGG - Intronic
1064891060 10:20174358-20174380 CAGAGGAAATGCTGGTTTCATGG - Intronic
1065861511 10:29876222-29876244 GAGATGAAATGATAGCTCCATGG - Intergenic
1070594396 10:77821882-77821904 GAAAGGAGCTGCTGCCTCCTGGG + Exonic
1072613631 10:97035329-97035351 GAGAGGACAGGCTGGGGCCATGG - Intronic
1072654510 10:97320576-97320598 GCGAGGAAATGCAGGCTCCGCGG - Exonic
1073053081 10:100681696-100681718 TAGAGGAGCTGATGGCTCCTGGG - Intergenic
1073390895 10:103175742-103175764 GATAGGGGATGCTGGCTCAATGG - Intronic
1073480623 10:103784156-103784178 GAGAGAAGATGCTGGCTGCTCGG + Intronic
1074458159 10:113613334-113613356 GAGAGGTAGAGCTGGCTCCACGG + Intronic
1075447660 10:122525033-122525055 GGGAGGTGATGGTGGCTGCATGG - Intergenic
1076124245 10:127961969-127961991 CTCAGGAGATGCTGGCTCCAGGG + Intronic
1076655117 10:132018957-132018979 GAGAGGAGCTACTCACTCCAGGG - Intergenic
1077916964 11:6617601-6617623 GAGAGGAAATGATTGCTCCATGG - Intronic
1078145674 11:8720502-8720524 GAGAAGAGAGGCTGGCACAAGGG - Intronic
1078760594 11:14248321-14248343 AAGAAGAGAACCTGGCTCCAAGG + Intronic
1079184098 11:18221032-18221054 GAGAGGAGCTGCCCACTCCAAGG - Intronic
1080394526 11:31877449-31877471 TAGAGGAGAGGCTGCCTCCCTGG - Intronic
1081665063 11:44911863-44911885 GAGAGGTGATCCTGGCTGCCAGG + Intronic
1081896731 11:46593583-46593605 GGGAGGAGATGTTGGGTCTAGGG - Intronic
1083481979 11:62954928-62954950 TAGAGGTGAAGCTGGCTCTAGGG - Intronic
1083599681 11:63939117-63939139 GAGAGGAGATGGGAGGTCCAGGG + Intronic
1083635724 11:64119986-64120008 AAGAGGAGATGCTGGTCCGAGGG + Intronic
1083955092 11:65978560-65978582 GAGAGGAGATGCAGGGCCCTGGG - Intronic
1084693570 11:70740784-70740806 CTGGGGAGAGGCTGGCTCCAAGG - Intronic
1085100655 11:73797198-73797220 GAGAGGAGCTGCCCACTCCAAGG + Intronic
1086157347 11:83682224-83682246 GACAGGAGAACCTGGCACCAAGG - Intronic
1086749995 11:90480464-90480486 GAGAGTAAATGCTGGCTGCCAGG + Intergenic
1087123755 11:94601932-94601954 GAGAAGAGTTGCAGGTTCCATGG + Exonic
1087740464 11:101881325-101881347 GAGGGCAGATGCTGGCCCCAAGG + Intergenic
1089697993 11:120227560-120227582 GGGCAGAGATGCTGGCACCAGGG - Intronic
1090329634 11:125920861-125920883 GAGAGGAGAGGGTGGCTCTGTGG + Intronic
1093233401 12:16576346-16576368 GAAAGTAGATGCTGAGTCCAGGG - Intronic
1093807411 12:23451481-23451503 GAGAGGATGTGGTGGCTCTAGGG + Intergenic
1094052887 12:26239847-26239869 GATAGGTGAGGCTAGCTCCATGG - Intronic
1094428035 12:30336339-30336361 GAGAGGAGATGCAGCCTCTCTGG + Intergenic
1096182436 12:49558116-49558138 GAGAGGATAGGCTGGATCCCTGG + Exonic
1096461611 12:51824548-51824570 GAGAGGTGATGCTGGCCACTGGG + Intergenic
1097633454 12:62092742-62092764 TAGATTAGAAGCTGGCTCCAAGG + Intronic
1097650497 12:62292302-62292324 TACAGGAGATGCTTGCCCCATGG + Intronic
1098756110 12:74365359-74365381 CATAGGAGATGCCTGCTCCATGG - Intergenic
1099373476 12:81866489-81866511 GAGAGGTGATGCTGGTGTCAAGG - Intergenic
1101207145 12:102499779-102499801 GATAAGAGATGATGGGTCCATGG + Intergenic
1101249375 12:102917121-102917143 CAGTGGACATGCTGGCTCCCCGG + Exonic
1101666620 12:106822385-106822407 GAGAGGAGATGCTGACTCACAGG - Intronic
1101784500 12:107871285-107871307 AAGAGGAGATGCGGGGTCCTTGG + Intergenic
1101939302 12:109088248-109088270 GAAAGAAGGTTCTGGCTCCACGG - Exonic
1102952647 12:117040768-117040790 GAGAGGAGAGGCAGGCAGCAGGG - Intronic
1103427042 12:120845015-120845037 GAGTGCAGAAGCTGCCTCCATGG - Intronic
1104565646 12:129878922-129878944 GGGAGGAGATGGTGTTTCCAGGG - Intronic
1104900862 12:132188945-132188967 GCCAGGAGATGCTGGTTCCGGGG + Intergenic
1105415354 13:20207064-20207086 GTGAGGAGAAGCTGACTGCAGGG + Intergenic
1105419397 13:20239390-20239412 GAGAGGAGATAATGGCTGGAGGG + Intergenic
1105620524 13:22061608-22061630 GAGAGGAGAGCATGCCTCCATGG - Intergenic
1106789251 13:33137994-33138016 GCCAGGAGGTGCTGGCTGCAAGG + Intronic
1108179644 13:47828176-47828198 GTGAGGACATGCTGCCCCCAGGG + Intergenic
1108582622 13:51839800-51839822 GAGAGAAGCTGCGGGCTGCATGG - Intergenic
1109418600 13:62078342-62078364 GAATGGAGATGTTGGCTACAGGG + Intergenic
1112199401 13:97260519-97260541 GAGAGAGAATGCTGGCTCCAAGG + Intronic
1113437565 13:110305730-110305752 CAGTGGAGAAGCTGCCTCCAGGG + Intronic
1113730289 13:112636820-112636842 CAGAGCAGATCCTGGCTCCTGGG - Intergenic
1114071863 14:19116811-19116833 GAGAGCAGAGGCAGGCTACAGGG + Intergenic
1114090395 14:19283153-19283175 GAGAGCAGAGGCAGGCTACAGGG - Intergenic
1114528512 14:23380873-23380895 GAGAGGAGTGGCTGCCACCAAGG - Intergenic
1116350245 14:43852307-43852329 AAAAGCAGATGCTGGCACCATGG + Intergenic
1117014857 14:51508062-51508084 GAGGGGAGTAGCTGGCTGCAGGG - Intronic
1117181538 14:53196837-53196859 GAGAGGTAAGGGTGGCTCCAAGG + Intergenic
1117815939 14:59597852-59597874 GAGAGGACAAGCTGGCGGCAAGG + Intronic
1117898229 14:60509205-60509227 TGGAGGAGGTGCTGGCTCCGCGG - Exonic
1118602481 14:67480538-67480560 GAGAACAGATCCAGGCTCCAGGG + Intronic
1119178699 14:72588899-72588921 GAGAGGGGTTGCTGGCTTGACGG - Intergenic
1120308366 14:82799289-82799311 CGGAGGAGATGCTGGCAGCATGG + Intergenic
1121109674 14:91303635-91303657 CAGAGGAGAGGCTGGGCCCAGGG - Intronic
1121646364 14:95519951-95519973 TGGTGGAGATGCTGGCTGCAGGG - Intergenic
1122103278 14:99430740-99430762 GAGAGGAGAAGGTGGCGCCTGGG - Intronic
1123405857 15:20019032-20019054 GAGAGGAGGTGTGGGCTCTAAGG + Intergenic
1123515187 15:21025680-21025702 GAGAGGAGGTGTGGGCTCTAAGG + Intergenic
1123990143 15:25677418-25677440 GAGAGTAGATGCTTGCTCTTGGG - Exonic
1124439901 15:29678136-29678158 GGGAGGAGATGGTGGCAGCAGGG + Intergenic
1125561059 15:40633945-40633967 CATAGGAGATGATAGCTCCATGG + Intronic
1129969908 15:79769165-79769187 GGATGGAGGTGCTGGCTCCAGGG - Intergenic
1130327850 15:82895992-82896014 GAGTAGAGATGCTGGCTCTAGGG - Intronic
1130419661 15:83731931-83731953 GAGAGGAGATGTTGGTTAAAGGG + Intronic
1130514001 15:84611932-84611954 GAGAGGAGATGGTGGCAGCTGGG - Intronic
1130871223 15:87973804-87973826 GAGGGGCGATGCTGGCTGCTTGG - Intronic
1130933475 15:88449342-88449364 CTAAGGAGATGCTGCCTCCAGGG + Intergenic
1131455093 15:92577186-92577208 GAGAGTAGGTGATGGCTCCAGGG - Intergenic
1132006898 15:98235541-98235563 GAGAGGGGAGGCTGGGACCAGGG - Intergenic
1132028392 15:98421406-98421428 CCGAGGAGACGCTGGCTGCAGGG - Intergenic
1132870939 16:2115512-2115534 GCAAGCAGATGTTGGCTCCAGGG + Exonic
1132904514 16:2275591-2275613 GAGAGAAGCTGCTGGCATCAGGG - Intergenic
1133048031 16:3099975-3099997 GAGAGGTGGTCCTGGCTCCCCGG - Intergenic
1133322877 16:4925146-4925168 GACAGGTGAGGCTGGTTCCAGGG - Intronic
1133410260 16:5562423-5562445 GAGGGCAGATGCTGGGGCCAGGG + Intergenic
1134233651 16:12448963-12448985 GGGAAGAGTTGCTGGCTGCAGGG + Intronic
1134521589 16:14921371-14921393 GCAAGCAGATGTTGGCTCCAGGG - Intronic
1134709260 16:16320022-16320044 GCAAGCAGATGTTGGCTCCAGGG - Intergenic
1134716470 16:16360051-16360073 GCAAGCAGATGTTGGCTCCAGGG - Intergenic
1134950345 16:18348623-18348645 GCAAGCAGATGTTGGCTCCAGGG + Intergenic
1134958280 16:18392108-18392130 GCAAGCAGATGTTGGCTCCAGGG + Intergenic
1136451220 16:30355242-30355264 AAGAAGAGATGCTTGCGCCAGGG + Exonic
1136476194 16:30515161-30515183 CAGAGGAGATGCTGGCTTAGGGG - Intronic
1136618848 16:31414731-31414753 GGCAGGAGAACCTGGCTCCACGG + Intronic
1137671445 16:50281827-50281849 CAGAGCAGCTGCTGGCTTCATGG + Intronic
1138062931 16:53910422-53910444 GAGAGGAGAGGCTGGAGGCATGG + Intronic
1139836351 16:69841790-69841812 GAGAAGAGAAGCTGTTTCCAAGG + Intronic
1141009786 16:80386849-80386871 GAGTGGACATGCTGGCTTGAAGG + Intergenic
1141684091 16:85560542-85560564 GTGAGGGGATGCTGGCTGCAGGG + Intergenic
1141701630 16:85645061-85645083 GAGGGGAAACGCTGGCTGCAGGG - Intronic
1142149289 16:88505657-88505679 GGCAGGGGGTGCTGGCTCCAGGG - Intronic
1142199465 16:88754214-88754236 GAGGGGAGAGGCTGCCCCCACGG + Intronic
1142749161 17:1977426-1977448 GAGACGAGGTGGTGGATCCAGGG - Intronic
1142997401 17:3769063-3769085 GGAAGGAGATGCTGGGTCTAGGG - Intronic
1143520487 17:7441584-7441606 GAGAGGGGAAGCTGGCTGCAGGG + Intronic
1144599303 17:16598678-16598700 GGAAGCAGATGCTGGCTCCGTGG + Intergenic
1145877648 17:28331756-28331778 CAGTGGAGCTGCTGGCTCCCTGG - Intronic
1146280566 17:31541691-31541713 GAGAGGGGACCCAGGCTCCAGGG - Intergenic
1146509190 17:33431072-33431094 GTGAGGACATGCTGGCTACTTGG - Intronic
1147468959 17:40639018-40639040 GAGAGGAAATACTGCTTCCAAGG - Intronic
1147531495 17:41282582-41282604 AAGAACAGATACTGGCTCCAGGG + Intergenic
1148070281 17:44904675-44904697 GACAGGAGATGATGAGTCCATGG - Exonic
1148143569 17:45345296-45345318 GAGTGGAGGTGCTGGATCCTGGG + Intergenic
1148282231 17:46357509-46357531 GAGATGAGATGCTGCCACTAAGG + Intronic
1148304449 17:46575434-46575456 GAGATGAGATGCTGCCACTAAGG + Intronic
1148973177 17:51502526-51502548 AAGTGGAGATGCTGGCAACAGGG - Intergenic
1149625695 17:58079071-58079093 GAGAGGGGAGACTGGCACCAGGG + Intergenic
1150386320 17:64764611-64764633 AAAAGGGGATGCTGGATCCAGGG - Intergenic
1152252915 17:79221075-79221097 GAGCGGAAATCCTGGCTGCAGGG - Intronic
1152367558 17:79865411-79865433 GAGAGTAGACCCAGGCTCCAGGG - Intergenic
1152370701 17:79886888-79886910 GAGAGGAGGGGCTAGCTACATGG + Intergenic
1152512728 17:80801424-80801446 GGAAGGAGATGCAGGCTCCAGGG - Intronic
1152530398 17:80915126-80915148 GAGAGGAGCTGCACACTCCAGGG + Intronic
1152530406 17:80915196-80915218 GAGAGGAGCTGCACACTCCAGGG + Intronic
1152598887 17:81251572-81251594 CAGCGGAGAAGCCGGCTCCAGGG - Exonic
1152779913 17:82222308-82222330 GAGCGGAGTTGCTGGGTCCCAGG - Intergenic
1153062062 18:1004933-1004955 AAGAGGAAATGCTTTCTCCAGGG - Intergenic
1156301670 18:35841652-35841674 GAGAGGGGCTGCAGTCTCCACGG + Intergenic
1157208345 18:45719522-45719544 ATGAGGGGATGCTGGCCCCAAGG - Intergenic
1158527842 18:58231392-58231414 GAAAGGAGGTGCTGGCTGCCTGG + Intronic
1158649562 18:59273478-59273500 GAGAGAAGGGGCTGGGTCCAGGG - Intronic
1160855796 19:1217106-1217128 GAGTGGAGCTGCTGGCTCACAGG + Intronic
1161347181 19:3774272-3774294 GAGAGGTGGAGCGGGCTCCAGGG + Intergenic
1161638807 19:5406774-5406796 GAGAGGAGATGAAGGCTTAAGGG - Intergenic
1161739590 19:6012572-6012594 GGGGGGTGATGCTGGCTCCGCGG + Intronic
1162974144 19:14198708-14198730 GACAGAAGATGGTGGCTCAAAGG - Intronic
1163493199 19:17629348-17629370 GAGAGGAGAGGCTGGCACCAAGG + Intronic
1163541779 19:17915746-17915768 GACAGGAGCTTCTGCCTCCATGG + Intergenic
1163688502 19:18725645-18725667 GGGAGGAGGGGCTGGCGCCAAGG - Intronic
1164387459 19:27786605-27786627 CAGAGGAGAAGCTGGGTGCAGGG + Intergenic
1167012292 19:46816494-46816516 GAGAGGAGACGCAGGTTCCCAGG + Intergenic
1168160657 19:54508372-54508394 CAGAGGAGATCAGGGCTCCAGGG - Intronic
925522990 2:4768275-4768297 CAGAGTAGAAGCTGGCTCCAGGG - Intergenic
925564449 2:5235224-5235246 CAGAGCAGATGCAGGCTCCGGGG + Intergenic
925714234 2:6770253-6770275 GAGGGGAGACGCAGGCTCCTGGG + Intergenic
926330544 2:11821841-11821863 GAGAGGGGAGGCTGGAGCCAAGG + Intronic
926437012 2:12848569-12848591 GTGAGGAGAAGATGGCTCTAGGG + Intergenic
927166759 2:20330859-20330881 GAGAGCTGATGCTCTCTCCAGGG + Intronic
927940432 2:27099959-27099981 GAGAGGAGAAGCTGGCTCTGAGG - Exonic
929288029 2:40157662-40157684 GACAGGGAATGCTGGCTTCATGG + Intronic
929555254 2:42921851-42921873 GACTGGAGATGCTGGCTCCCTGG + Intergenic
931988826 2:67768796-67768818 GAGAGGAGCTGCTACCTCTAGGG - Intergenic
933874853 2:86609292-86609314 CTGAGCAGATGCTGGCACCATGG + Intronic
935060707 2:99605120-99605142 GATCGGAGATGCTGCCTCCTTGG - Intronic
936228297 2:110678182-110678204 GGGAGGAGCTACTGGCTCAAGGG - Intergenic
936522440 2:113219746-113219768 GAGAGGACCTCCTGCCTCCACGG - Intronic
937313596 2:120917015-120917037 GAGAGCAGAGTCTTGCTCCATGG + Intronic
937482228 2:122273790-122273812 GAGAGAAGGTGGTGGCTACAGGG + Intergenic
937870713 2:126784119-126784141 TAGAGTAGGTGCTGGCTCCAGGG + Intergenic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
938069716 2:128301982-128302004 GAGAGGAGCTGGCGGCACCATGG - Intronic
938486110 2:131710263-131710285 GAGAGCAGAGGCAGGCTACAGGG + Intergenic
939200983 2:139033581-139033603 GAAAGGAGGGGCTGACTCCATGG + Intergenic
941580725 2:167293209-167293231 GAGAAGTGATGCTGGCGCCGGGG + Intergenic
942594522 2:177580344-177580366 GAGAGGACATCCTGGCTCTTTGG + Intergenic
942710539 2:178830283-178830305 AAAAATAGATGCTGGCTCCACGG - Exonic
943603085 2:189943848-189943870 GAAAGGAGCTACAGGCTCCACGG - Intronic
944535441 2:200705041-200705063 GAGAGGAGGTGCTGCCTTCCTGG + Intergenic
946359178 2:219208796-219208818 TAGAGGAAATGAAGGCTCCATGG - Intronic
947201197 2:227616036-227616058 GAAAGGAGTTTATGGCTCCAAGG + Intronic
1170043834 20:12065402-12065424 GAAAGGAGCTGCCTGCTCCAAGG - Intergenic
1170495065 20:16915883-16915905 GAGAGGAGCTACTCTCTCCAGGG + Intergenic
1170781563 20:19430191-19430213 CAGCAGAGATGATGGCTCCAAGG - Intronic
1170806216 20:19634310-19634332 ATGAGAAGATGCTGGCTCCCAGG - Intronic
1170826384 20:19799724-19799746 GAGAAGAGATGCTGGCGTGAAGG + Intergenic
1171259328 20:23717961-23717983 GAGAGGTGCTGCTAGCTGCATGG + Intergenic
1171364408 20:24613890-24613912 GAGAGGCCATGCTGCCTCCCAGG + Intronic
1172004759 20:31811442-31811464 GAGAGTGGCTGCTGGCTCCTTGG - Intergenic
1172347068 20:34210029-34210051 GAGAGGAGCTGCCCACTCCAGGG + Intronic
1172868840 20:38121942-38121964 GAGGGGAGTTGCTGGCTCACAGG + Intronic
1172931129 20:38587192-38587214 GAGGCGAGAGGCTGGCTCCCGGG - Intronic
1173079175 20:39849796-39849818 GAGGGGCGTTGCTGGCTCCCTGG - Intergenic
1174295122 20:49540254-49540276 GGGAGGAGATGCCTGCTCCCAGG + Intronic
1174766108 20:53255464-53255486 CAGAGCAGATGTGGGCTCCAGGG - Exonic
1175302470 20:57952659-57952681 GAGAGGATGTGCTGGCTCTAGGG - Intergenic
1175775192 20:61648653-61648675 GAGAAGAGCTGCTGGCTGCAGGG + Intronic
1175990939 20:62788818-62788840 GCAAGCAGAGGCTGGCTCCATGG + Intergenic
1176050790 20:63118636-63118658 GAAAGCATTTGCTGGCTCCAAGG - Intergenic
1176080178 20:63268638-63268660 GAGAGGAGGTGCCGGCTCTTGGG - Intronic
1176407337 21:6428267-6428289 GAGAGCAGAGGCAGGCGCCATGG + Intergenic
1179251920 21:39677871-39677893 GGGAGGAGAAGGGGGCTCCATGG + Intergenic
1179682845 21:43036670-43036692 GAGAGCAGAGGCAGGCGCCATGG + Intergenic
1179828389 21:43981308-43981330 GTGGGGGGATCCTGGCTCCAGGG - Intronic
1179990148 21:44943833-44943855 GAGAGGTGAGGCAGGCTCGACGG + Exonic
1180490304 22:15839166-15839188 GAGAGCAGAGGCAGGCTACAGGG + Intergenic
1180729626 22:17971841-17971863 GAAAGGAGGAGCTTGCTCCAGGG + Intronic
1180834381 22:18922609-18922631 GAGGGGAGATGCTGGCAGGAGGG - Intronic
1180868637 22:19133865-19133887 GAGACGTGATGCAGGCCCCAGGG + Exonic
1181065430 22:20303494-20303516 GAGGGGAGATGCTGGCAGGAGGG + Intergenic
1181459721 22:23078835-23078857 GAGGGGACATCCTGGCTCCCGGG + Intronic
1181559650 22:23692711-23692733 CAGTGGTGGTGCTGGCTCCAGGG - Exonic
1181911598 22:26242641-26242663 AAGAGGAGATGCTGGGGCCTCGG + Intronic
1182117393 22:27764807-27764829 GAGAATAGATGCTTCCTCCAGGG - Intronic
1183323053 22:37176719-37176741 GAGAGGAGAGGGGGGCTGCAGGG + Intergenic
1183599534 22:38831962-38831984 GAGAGGAGATGCTGGCTCCAGGG - Intronic
1184090527 22:42290740-42290762 GGGATGAGATGCTGGCCTCAAGG + Intronic
1184130854 22:42515631-42515653 GGGAGGAGGTGTGGGCTCCAGGG + Intronic
1184141030 22:42577461-42577483 GGGAGGAGGTGTGGGCTCCAGGG + Intergenic
1184536889 22:45093714-45093736 GAGAGAGGGTGCGGGCTCCATGG - Intergenic
1184690512 22:46115265-46115287 GGGAGGAGAGGCTGGCTCCTCGG - Intergenic
1184843377 22:47065778-47065800 GTGAGGAGATGCGGGTTCCTTGG + Intronic
1185214114 22:49588885-49588907 GGAAGCAGATGCTGGGTCCAGGG - Intronic
1203284470 22_KI270734v1_random:147908-147930 GAGGGGAGATGCTGGCAGGAGGG - Intergenic
950740497 3:15047284-15047306 GAGTGGAGATTCTGACTTCATGG - Exonic
950815188 3:15693726-15693748 GAGAGGTGATGGTGTTTCCAAGG + Intronic
951906711 3:27714121-27714143 GGGAGGAGATACTGGCTCGGGGG - Intergenic
952756794 3:36876160-36876182 GAGAGGAGGTGCTGTCTCAAAGG - Intronic
952847250 3:37698699-37698721 GAGTGTAGGTGCTGGCTCAAAGG + Intronic
953193729 3:40713072-40713094 GAGAGGAAATGCTGTGGCCAGGG - Intergenic
953538348 3:43793053-43793075 GAAAGGAGGTGCTGCCTACAGGG - Intergenic
953847866 3:46443245-46443267 GAGAGTGGAGGCTGGCACCAGGG - Intronic
953853434 3:46483271-46483293 GAGAGGAGAGGCTGGGTTCCAGG - Intronic
953990863 3:47482335-47482357 GAGAGGAGATGATGTGTCCAAGG + Intergenic
954132601 3:48568107-48568129 AAAAGGAGATGTTGGCTTCATGG - Exonic
954431086 3:50471190-50471212 GCCTGGAGATGCTGGCTTCAAGG + Intronic
955432212 3:58858357-58858379 CAGAGGAAGTGCTGGCTCCTTGG - Intronic
955936235 3:64105338-64105360 GGGAGAAGATCCTGGCTCCCAGG - Intronic
957338605 3:78863550-78863572 GAGAGGAGCTGTTGGCTCAGTGG - Intronic
958730206 3:97953070-97953092 GAGAGGACATTCTAGGTCCAAGG - Intronic
961655293 3:128438476-128438498 GAGAGGATAAGCTGGCTCCTGGG - Intergenic
963522877 3:146378290-146378312 GAGACTAGATGGTGGCTACAGGG - Intergenic
965160167 3:165122989-165123011 CATAGGAGATGACGGCTCCATGG - Intergenic
966256136 3:177918078-177918100 GAGAGGAGCTCCCTGCTCCAGGG + Intergenic
967977752 3:195044881-195044903 GAGAGGAGAACCTGGCTGGATGG - Intergenic
968533557 4:1109782-1109804 TGGAAGAGATGCTGCCTCCAAGG - Intronic
968567634 4:1322561-1322583 GCAAGGGGGTGCTGGCTCCAGGG - Intronic
968841157 4:3006775-3006797 GAAAAGAGATGTTGGCTCCATGG + Intronic
969053627 4:4388564-4388586 GAGAGTAGATGCTGTGTCTATGG - Intronic
969158652 4:5235866-5235888 GAGAGGAGATGGTCTTTCCAGGG + Intronic
969343531 4:6557353-6557375 GTCAGGAGATGCTGGGTGCAAGG + Intronic
969376230 4:6765158-6765180 AGGAGGAGCTGCTGGCTGCACGG - Intergenic
969553073 4:7884979-7885001 CAGAGGAGAGGCTGGGTCAATGG + Intronic
971526036 4:27620511-27620533 GAGAGGTGATGGTGACACCAAGG + Intergenic
971575701 4:28271437-28271459 GAGAGGAATTGCTGGCTCTAAGG + Intergenic
972371811 4:38431273-38431295 GTCAGGAGTTTCTGGCTCCAAGG + Intergenic
972406737 4:38753240-38753262 GAGAGGGCTTGCAGGCTCCAGGG - Intergenic
972917800 4:43902990-43903012 GGGAGGAGAAGGTGGGTCCATGG + Intergenic
974894895 4:67926962-67926984 GAGAGGAGCTTCTACCTCCAGGG + Intronic
975664438 4:76721025-76721047 AAGTGGAGTTGCTGGCTCAAAGG - Intronic
977106053 4:92886370-92886392 GAGAGGAGATGCTGGAAAAATGG + Intronic
981214547 4:142149015-142149037 GAGAGGAGATGCTGCCTATCTGG + Intronic
982063179 4:151624990-151625012 GAGGGGAGAAGATGGCTGCAAGG + Intronic
982545242 4:156724877-156724899 GAGAGGAGATGCCCATTCCAGGG + Intergenic
982639985 4:157946271-157946293 GGGAGGAGATGCTGGCTGGTGGG - Intergenic
984850530 4:184148474-184148496 TAGAGGAGATGCTGCCTCTTTGG - Intronic
985656222 5:1132756-1132778 GGGAGGCGGTGCTGGCCCCAAGG - Intergenic
985668405 5:1193626-1193648 GAGGGGAGATGCTGCCTCCTGGG - Intergenic
986120993 5:4836094-4836116 AAGAGGAGTTGCTGGGTCAAAGG + Intergenic
986307230 5:6524849-6524871 GAGAGGGGCTGCTGCCTGCAAGG + Intergenic
986614312 5:9601091-9601113 GAGAGAAGATGCTGTCTCTTTGG - Intergenic
989520707 5:42396861-42396883 GAGAGGAGCTACTCACTCCAGGG + Intergenic
989744194 5:44808711-44808733 GGGAGGAGATGCTGCCACCTAGG - Intergenic
990943868 5:61230141-61230163 GAGGGGAGAGGGTGGCTCCTGGG - Intergenic
995682311 5:114733319-114733341 CAGAGGAAACGCTGGCTTCATGG - Intergenic
995902615 5:117087835-117087857 GAGAAGAGATCCAGGATCCAGGG - Intergenic
996081696 5:119264855-119264877 AAGAGGTGATGCTGGGTCCTTGG - Intergenic
996234112 5:121106812-121106834 GAGAGGAGTTACTCTCTCCAGGG - Intergenic
997265199 5:132491070-132491092 GAGAGGACAGGCTGGGGCCAGGG - Intergenic
997296277 5:132770886-132770908 GAGAGGGGATAATGGCCCCATGG - Intronic
998642822 5:144031440-144031462 GAGAGGAGCTGTGGGCACCAAGG + Intergenic
998792320 5:145778331-145778353 GAGAGGAGCTTCTCACTCCAGGG + Intronic
999152550 5:149435881-149435903 CAGAGGGGCTGCTGGTTCCAAGG - Intergenic
999550068 5:152676995-152677017 GAAAGGAGATCCAGGCTCCTGGG - Intergenic
1000978544 5:167791905-167791927 GAGTGGGGATGATGGCTCCCTGG - Intronic
1001024899 5:168215791-168215813 CAGAGGAAATCCTGGCTCCATGG + Intronic
1002171707 5:177378387-177378409 GAGGGGTGATGCTGGTTCTATGG - Intergenic
1002317573 5:178353611-178353633 GAGAGGAGAAGCTGCGTCCCAGG - Intronic
1003176548 6:3756499-3756521 GAGAGGAGATGCTCGCCCCAGGG + Intergenic
1004658288 6:17686245-17686267 CATAGGAGATGATAGCTCCATGG + Intronic
1006260758 6:32867478-32867500 GAGAGGAAATGCTGGAACTACGG - Intergenic
1006512021 6:34526543-34526565 GAGAGGAGCTCCTGGCTCAGTGG - Intronic
1007448158 6:41922931-41922953 GAGAGGAGATGGTGGGGGCAGGG - Intronic
1009846868 6:69145758-69145780 GAGAGGAGCTACCGACTCCAGGG - Intronic
1015935424 6:138403357-138403379 GCTAGGGGGTGCTGGCTCCATGG + Intergenic
1016017169 6:139198450-139198472 GGCCTGAGATGCTGGCTCCAGGG - Intergenic
1017054538 6:150425226-150425248 GAGAGGAGCTTCTCACTCCAGGG + Intergenic
1017204822 6:151793323-151793345 CAGAGGAGATGACAGCTCCAGGG - Intronic
1017420461 6:154267715-154267737 GAGAGGAGCTGCCCTCTCCAGGG - Intronic
1018611125 6:165648915-165648937 GTGAGGAGAAGGTGGCTGCACGG - Intronic
1018810268 6:167293777-167293799 GAAAGGAGGTGGTGGCTACAGGG - Intronic
1018886782 6:167945319-167945341 CACAGGAGGTGATGGCTCCATGG - Intronic
1019167257 6:170106989-170107011 GAGAGGAGCTGATGCCTTCAAGG - Intergenic
1019788408 7:2994236-2994258 CAGAGGAGTTGCAAGCTCCAGGG + Intronic
1019906756 7:4070685-4070707 GAGAGGTGGCACTGGCTCCAAGG - Intronic
1022625519 7:32032221-32032243 GAGAGAAGAGGCTGCCTCAAAGG + Intronic
1023168874 7:37370885-37370907 GAGAGGAGATGCTGTGTTGAAGG - Intronic
1023700001 7:42883375-42883397 GAGAGGAGCTGCCCACTCCAGGG - Intergenic
1023817568 7:43962173-43962195 GAGATGGGAGGCTGGCCCCAAGG - Intergenic
1023867858 7:44247316-44247338 GAGAGGAGATGCTGGCCAGGAGG + Intronic
1024729492 7:52238671-52238693 GAAAGAAGATTCTGGCTCCTAGG - Intergenic
1024935298 7:54705885-54705907 ATGAGGAGATGTTGTCTCCAGGG + Intergenic
1026095815 7:67345817-67345839 GGGATCAGATGCTGTCTCCAAGG - Intergenic
1026484862 7:70809002-70809024 GAGAGGAGGTGGTGGCCTCAGGG + Intergenic
1026524040 7:71139297-71139319 GAGAGGAGAGGGTGTCTCTAAGG - Intronic
1026760426 7:73122160-73122182 GAGAGGGTATCCAGGCTCCATGG + Intergenic
1027036768 7:74930981-74931003 GAGAGGGTATCCAGGCTCCATGG + Intergenic
1027086795 7:75270478-75270500 GAGAGGGTATCCAGGCTCCATGG - Intergenic
1027170156 7:75866267-75866289 GAAAGTAGATGCTGTTTCCAAGG - Intronic
1028186061 7:87786029-87786051 GAGAGGTGATGCAGACACCAAGG - Intronic
1028512681 7:91642637-91642659 AAGAGGATCTGCTGGCCCCAAGG + Intergenic
1028527371 7:91801119-91801141 GAGAGGAGCTCCTCACTCCAGGG - Intronic
1028682674 7:93555060-93555082 GACAGGCGATGCTGGTTACAGGG + Intronic
1028830652 7:95323833-95323855 GACATCAGATGCTGGCTCCAGGG + Intronic
1030069331 7:105685506-105685528 GAGAGGAGATGATTGCTACCAGG - Intronic
1030514024 7:110519181-110519203 GAGAGGAGATACCCACTCCAGGG - Intergenic
1030522081 7:110610240-110610262 AAGAGTAGTTGCTGGCTGCATGG - Intergenic
1031743682 7:125467933-125467955 GAGAGGAGCTGCTCTCTCCAGGG - Intergenic
1031927921 7:127655920-127655942 GATAAGATATGCTGCCTCCATGG - Intronic
1032153916 7:129453043-129453065 GAGAGGAGAGGTAGTCTCCAGGG - Intronic
1032768400 7:135023316-135023338 GAGAGGTGATGCAGACACCAAGG + Intronic
1032802207 7:135325754-135325776 GAAAGCAGCTGCTGGCCCCATGG + Intergenic
1033030503 7:137821249-137821271 GAAAGGAGTTGATGGCTGCAAGG + Intronic
1033411529 7:141122579-141122601 GAGATGAAATGCTGGGTCCAGGG + Intronic
1034761219 7:153673780-153673802 GACAGCAGAGGCTGGCTCTAGGG + Intergenic
1037808578 8:22072401-22072423 GAGAGGAGATGAAGGCTCTCAGG + Exonic
1037976691 8:23219065-23219087 GAGAGGCTGTGCCGGCTCCAGGG - Intronic
1039245787 8:35606902-35606924 GAGAGGACAGGCTGGCTTCTAGG + Intronic
1042554233 8:70020896-70020918 GATAGGAGACTCTGGGTCCAGGG - Intergenic
1044830022 8:96238145-96238167 GAGAGGACAGGATGGTTCCATGG + Intergenic
1045489677 8:102658649-102658671 TATAGGAGAAGCTTGCTCCAAGG + Intergenic
1046614201 8:116458027-116458049 GTGAAGACATGCTGGCCCCAAGG - Intergenic
1047171072 8:122492662-122492684 GAAAGGAGATGGAGGCACCAGGG + Intergenic
1048986637 8:139738366-139738388 GAGAGGACATACAGGCTCCCGGG - Intronic
1049225602 8:141449131-141449153 GAGGGGAGCTCCTGGCTCCTGGG + Intergenic
1049328903 8:142039254-142039276 GACAGGAGAAGCTGCCTGCAAGG - Intergenic
1051613348 9:18982493-18982515 GACAAGAGCTGCTGCCTCCAGGG + Intronic
1054085520 9:60739388-60739410 TAGAGGAGATGGTGGCTGGACGG - Intergenic
1056766277 9:89446587-89446609 GAGAGGGGAGGCTGCCTCCCAGG + Intronic
1057014794 9:91642234-91642256 GAGAGGGGATGCTGGGTCCTGGG + Intronic
1057759391 9:97860443-97860465 GAGAGGAGATGCTGGAGAGAGGG - Intergenic
1058774602 9:108271384-108271406 GACAGGATATGCGGGCTACAGGG - Intergenic
1058896125 9:109402017-109402039 GAGGGGAGTTTCTGGCCCCAAGG - Intronic
1059003680 9:110377889-110377911 GAGAGTAGATGGTGGTTCCCAGG - Intronic
1059221217 9:112621187-112621209 TAGAGGACATGCTGCCACCATGG - Intronic
1059391553 9:114002482-114002504 GGGAGGAGAGGCTGGCATCAGGG + Intronic
1060432441 9:123561916-123561938 GAGAGGAGAGGATGGATTCAGGG - Intronic
1060586628 9:124790655-124790677 GAGAGGATATGCTGCCTCACTGG + Intronic
1061405935 9:130393116-130393138 GACAGGAGAGGCTGGCTGCGTGG - Intronic
1062191928 9:135252545-135252567 GAGGGCAGATGCTTGCTTCAAGG - Intergenic
1062360952 9:136187798-136187820 GAGGGGAGATGCTGATTCCCTGG + Intergenic
1185774709 X:2793317-2793339 GAGAGGAAAGGCAGACTCCAAGG + Intronic
1186106755 X:6215802-6215824 GACAGGACAGGATGGCTCCAGGG - Intronic
1186483347 X:9913009-9913031 CAGAGCAGATGATGGCTCTACGG - Intronic
1186490215 X:9966198-9966220 GAAATGAAATGCTGGCTCCATGG + Intergenic
1187478602 X:19634490-19634512 AAGAGGAGATCCTGGTGCCAGGG + Intronic
1187821516 X:23293113-23293135 GAGAGAAGAGGCTGGCAGCATGG - Intergenic
1187877301 X:23815017-23815039 GTGAGGAAATGCAGGCCCCATGG - Intergenic
1188225687 X:27593681-27593703 GAAAACAGATGCTTGCTCCAGGG + Intronic
1189203300 X:39216342-39216364 GCTAGGAGATGCTGTCCCCAGGG - Intergenic
1190158705 X:48014829-48014851 GAGTGGAGTTGCTGGATCCTAGG - Intronic
1190174403 X:48137117-48137139 GAGTGGAGTTGCTGGATCCTAGG - Intergenic
1190873090 X:54440843-54440865 GAGAGGAAATGCAGGCTCTGCGG - Intronic
1192086982 X:68109539-68109561 GAGTGGAGTTGCTGGATCTATGG + Intronic
1192200700 X:69064823-69064845 GAGAGGCCATGGTGGCTGCAGGG + Intergenic
1194971652 X:100350873-100350895 GCGGGGAGCTGCTGCCTCCACGG - Intronic
1195712384 X:107784034-107784056 TAGAGGAGATGATGGCTTGAAGG + Intronic
1195751454 X:108164672-108164694 GAGAGGTGAGCCTGGCTTCATGG - Exonic
1197952115 X:131908558-131908580 GAGAGGAGTTACTCTCTCCAGGG + Intergenic
1198159125 X:133989593-133989615 GGGAGGAGAGTCTGGTTCCATGG + Intergenic
1198798611 X:140426478-140426500 GAGAAGAGATGCTGGGTACAAGG + Intergenic
1199746726 X:150776358-150776380 TAGAGGAGAAGCAGGCTCCCAGG - Intronic
1202191063 Y:22245385-22245407 GAGAGGAGCTGCCCCCTCCAGGG + Intergenic
1202362576 Y:24127528-24127550 GAGAGGATAGGCAAGCTCCAGGG + Intergenic
1202508282 Y:25544545-25544567 GAGAGGATAGGCAAGCTCCAGGG + Intergenic