ID: 1183601512

View in Genome Browser
Species Human (GRCh38)
Location 22:38843165-38843187
Sequence GCCGGACGACCGCGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183601507_1183601512 -6 Left 1183601507 22:38843148-38843170 CCGGAGGCTCGGGGACCGCCGGA 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 92
1183601500_1183601512 13 Left 1183601500 22:38843129-38843151 CCGGAACACAGACGGGAGACCGG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 92
1183601498_1183601512 15 Left 1183601498 22:38843127-38843149 CCCCGGAACACAGACGGGAGACC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 92
1183601499_1183601512 14 Left 1183601499 22:38843128-38843150 CCCGGAACACAGACGGGAGACCG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183601512 Original CRISPR GCCGGACGACCGCGGCCGGG CGG Intronic
901022196 1:6261088-6261110 GCCGGGCGGCCGGGGGCGGGGGG + Intergenic
901086617 1:6614887-6614909 GTCCGGCGACCGCGGGCGGGTGG + Intronic
901871699 1:12142345-12142367 GCCGGAGGGCCGGGGCCTGGCGG + Exonic
901915447 1:12495946-12495968 GCTGGACGACTGCTGCCGAGAGG - Intronic
904322584 1:29707249-29707271 GCCGCACTAGCGCGGCTGGGCGG + Intergenic
907012737 1:50978236-50978258 GCCTGAGGACCGGGGCCGGAGGG + Intergenic
916694420 1:167221408-167221430 GGCGGGCGGCCGGGGCCGGGCGG + Intronic
920333499 1:205228645-205228667 GCCGGAGGTCCGCGCCCGGCAGG - Exonic
920367741 1:205456942-205456964 GCCGGCTGACCGCGGCCGTCGGG - Intergenic
1067342947 10:45419234-45419256 GCCGGGCGAGCGCAGGCGGGCGG + Intronic
1067769842 10:49115368-49115390 GCCGGGCGGCCGCGCCGGGGAGG - Intronic
1073441443 10:103555172-103555194 GCCGGCTGGCCGCGGGCGGGCGG + Intronic
1075144616 10:119872629-119872651 GCGGGCCGAGCGCGGCCGGGCGG + Exonic
1075768761 10:124916606-124916628 GCCGGCTGACGGCGGCCTGGAGG - Intergenic
1076707023 10:132307754-132307776 GCGGGGCGCGCGCGGCCGGGGGG + Exonic
1076749845 10:132537262-132537284 GCTGGACGACTGCGGCCGCGCGG + Intergenic
1078561700 11:12377996-12378018 CCCGGGCGACCGCGAGCGGGCGG - Intronic
1083273006 11:61581328-61581350 GCCGGACGAGCCCGGCCGTGGGG - Intergenic
1083811292 11:65108290-65108312 GGCGCACGCCCGCGGCCGGCTGG + Exonic
1083923937 11:65794766-65794788 CCCGCACGGCCGCGGCCAGGCGG - Intronic
1088764715 11:112963462-112963484 ACCGGCCGACCGCGGGCCGGGGG + Intronic
1089559080 11:119334625-119334647 GCGGGAAGACGGGGGCCGGGCGG + Exonic
1090832277 11:130428002-130428024 GCCGGGCGACCGGGGGCGAGCGG - Exonic
1094025664 12:25958382-25958404 GCCGGGCGAGCGTGGCCCGGTGG + Intergenic
1103377697 12:120469576-120469598 GGCGGACGAGCGCGGCGGCGAGG - Exonic
1103764727 12:123271868-123271890 GCGGGGCGGCCGGGGCCGGGAGG + Exonic
1106087638 13:26557745-26557767 GCCGGGCGGCCGCGGCGCGGCGG + Exonic
1112402038 13:99086194-99086216 GCGGGACGACCGCGGGCCGGGGG - Intronic
1115651296 14:35404356-35404378 GCGGGACGCGCGCGGCCTGGGGG - Intronic
1115850085 14:37584054-37584076 GCCGGAGGGGCCCGGCCGGGCGG - Intergenic
1117309833 14:54510142-54510164 GCCGGAGGGCCGCGGGCCGGAGG + Intronic
1118797115 14:69153317-69153339 GCCGGAAGAACGCGGGCGGCCGG + Intergenic
1119539280 14:75428151-75428173 GGCGGAGCTCCGCGGCCGGGCGG + Intronic
1122209442 14:100165574-100165596 ACCGGGCGGCCGCGGACGGGCGG + Intergenic
1123106554 14:105844503-105844525 GCCGGACTGCCTCGGCAGGGTGG + Intergenic
1129468646 15:75738332-75738354 GCCGGACGGGCGTGGCCGGGAGG - Intergenic
1131049040 15:89334471-89334493 GCAGGACGCTCTCGGCCGGGTGG - Intronic
1136447942 16:30335400-30335422 GCCGTACGACAGCGGCGGCGCGG - Intergenic
1140478588 16:75251004-75251026 TCCGGGGGACCGAGGCCGGGCGG - Intronic
1142350298 16:89576442-89576464 GCCGGCCGACGGGGGGCGGGAGG + Intronic
1143639222 17:8186121-8186143 GCAGGACGCCGGGGGCCGGGAGG + Intergenic
1146339684 17:32007899-32007921 CCCGGACCACCGCAGCCCGGAGG + Intronic
1147264331 17:39225716-39225738 GCGGGACGACCCCGGGCGCGAGG + Exonic
1147971001 17:44219128-44219150 GCGGGAGGACGGCGGCCGGGAGG + Intronic
1150747351 17:67826059-67826081 CCCGGACCACCGCGGCCCGGAGG + Exonic
1150791975 17:68206002-68206024 CCCGGACCACCGCGGCCCGGAGG + Intergenic
1151724114 17:75874860-75874882 GCCCTACGACCGCGGCCGGCTGG - Exonic
1151780293 17:76240723-76240745 GCCGGGTGCCCGCGGCGGGGCGG + Intergenic
1152175093 17:78782131-78782153 GCCGGACGGCCGGGCCCGGAGGG + Intronic
1152995223 18:400121-400143 GCAAGAAGACAGCGGCCGGGGGG + Intronic
1156213849 18:34976998-34977020 GGCGGAGCACGGCGGCCGGGTGG + Intronic
1157849151 18:51030773-51030795 GCCTGACGAGCCGGGCCGGGCGG + Intronic
1158434683 18:57427838-57427860 GCCTGGCGCCCGCGGCCTGGAGG - Intergenic
1160676107 19:392272-392294 GCCGGGAGAACGCGGCAGGGAGG + Intergenic
1160813008 19:1021042-1021064 GGCGGCCGATGGCGGCCGGGAGG - Exonic
1160832004 19:1108513-1108535 GCGGGAAGGCCTCGGCCGGGGGG + Exonic
1160864029 19:1249399-1249421 CCCGGACGAAGGCGGCGGGGTGG + Intronic
1161207200 19:3047268-3047290 GCGGGGCGGCCGCGGCGGGGAGG + Intronic
1161231964 19:3178912-3178934 GCCGGAGGATGGCGGCCTGGGGG + Exonic
1162833057 19:13298911-13298933 GTCGGACCACCACGCCCGGGAGG - Exonic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
931763688 2:65436583-65436605 GCCGCACGCCCGGGGCGGGGGGG - Intergenic
938034873 2:128027635-128027657 GCCGGGGGAGCGCGGGCGGGCGG - Intronic
942292681 2:174487360-174487382 CCCGGAGGATCGCGGCTGGGAGG - Intergenic
947119409 2:226799807-226799829 GCCGGGCAGCCGCCGCCGGGAGG + Intergenic
1172118765 20:32585631-32585653 GCGGGACCGCCGCGTCCGGGAGG - Intronic
1175847288 20:62065515-62065537 GCAGGTAGAGCGCGGCCGGGGGG - Exonic
1176161833 20:63652450-63652472 GCCGGGCGACCTCGGGCGCGAGG - Intronic
1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG + Intronic
1184059649 22:42074231-42074253 GCCGGGAGACCCCGCCCGGGAGG - Exonic
950549023 3:13655314-13655336 GGCGGAAGGCGGCGGCCGGGCGG - Intergenic
952367236 3:32685514-32685536 GCGGGACGTGCGGGGCCGGGCGG + Intronic
953027365 3:39152959-39152981 GCCGGGCGCCCCCGGCCGGCGGG - Intronic
954004085 3:47578462-47578484 GCCGCCCGGCCGCGGCCAGGCGG + Intronic
954256633 3:49411936-49411958 GACGGAGGACCGCGGGCGGCGGG + Exonic
968729252 4:2261981-2262003 GGCGGACGGGCGCGGGCGGGAGG - Exonic
969379151 4:6782913-6782935 GCCGGACGCTCGCCGCCGTGGGG + Intronic
970456165 4:16226370-16226392 GCGGGACGGCCGCGGCGAGGCGG - Exonic
976765405 4:88592882-88592904 GGCGGCCGAGCGCGGGCGGGAGG - Intronic
978490061 4:109302770-109302792 GCCGGACGCCGGGCGCCGGGAGG - Intergenic
984803751 4:183735861-183735883 GCCGGCCGCCCCGGGCCGGGGGG - Intergenic
985073437 4:186190988-186191010 GCCGGGAGACCGCAGCCGCGGGG - Intergenic
985129223 4:186724447-186724469 GCCAGGCGCCCGCGGCGGGGAGG - Intronic
997291224 5:132737231-132737253 GCCGGACCCCCGCGGCCCCGGGG + Intronic
1001948108 5:175797046-175797068 GGCGGACAGCGGCGGCCGGGCGG + Intronic
1003552114 6:7108807-7108829 GGCGGACGGCGCCGGCCGGGAGG + Intronic
1011734119 6:90295882-90295904 CCCGGACCACCGCGACCGGCGGG - Intronic
1013170749 6:107634740-107634762 GCTGGCCGCCCGCGCCCGGGGGG - Exonic
1014755895 6:125301811-125301833 GCCGGGAGGCCGCGGCCGAGCGG - Intronic
1029896656 7:103990231-103990253 GCCGGGCGGCCGCGGCGGGAGGG - Intergenic
1032108408 7:129054601-129054623 GCCGCACGGCCGGGGCGGGGTGG - Intronic
1034475081 7:151277008-151277030 GCCGGCGCAGCGCGGCCGGGAGG + Intronic
1038176302 8:25184602-25184624 GCCGGGCGCCCGCGGCTCGGAGG + Intergenic
1054906924 9:70420322-70420344 GCCGGGCGGGCGCGGCCGCGGGG - Intergenic
1057546127 9:96021481-96021503 TCCGGACCCCCGCGGCCTGGGGG + Intergenic
1057716696 9:97501644-97501666 CCCGGGCGGCCGCGGGCGGGCGG - Exonic
1057733682 9:97633520-97633542 GTACGACGACCGCGGCCCGGGGG + Exonic
1060468671 9:123929957-123929979 GCCGGTCGGCCGCGGGCGGGCGG - Exonic
1060700987 9:125748173-125748195 GCCGGCCGACTGCGGCCAGCGGG - Intronic
1061061151 9:128250973-128250995 GCCGGACGGGCGTGGCCGGGAGG + Intronic
1062656105 9:137605323-137605345 GATGGATGAGCGCGGCCGGGGGG + Intergenic
1189322897 X:40097169-40097191 CCCGGGAGACCGCGGACGGGTGG - Intronic
1191830257 X:65407750-65407772 CCCGGGCGACTGAGGCCGGGGGG + Intronic
1195668261 X:107449593-107449615 GCCGGACGGCCGAGGAGGGGAGG - Intergenic