ID: 1183607096

View in Genome Browser
Species Human (GRCh38)
Location 22:38872218-38872240
Sequence ATACTCCCTGCGCCCGCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183607090_1183607096 8 Left 1183607090 22:38872187-38872209 CCATCTTGCTCAGCGGCACCCAC 0: 1
1: 0
2: 2
3: 12
4: 168
Right 1183607096 22:38872218-38872240 ATACTCCCTGCGCCCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 70
1183607087_1183607096 24 Left 1183607087 22:38872171-38872193 CCCACTGCAGACAGCTCCATCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1183607096 22:38872218-38872240 ATACTCCCTGCGCCCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 70
1183607091_1183607096 -10 Left 1183607091 22:38872205-38872227 CCCACAGCCCATAATACTCCCTG 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1183607096 22:38872218-38872240 ATACTCCCTGCGCCCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 70
1183607088_1183607096 23 Left 1183607088 22:38872172-38872194 CCACTGCAGACAGCTCCATCTTG 0: 1
1: 0
2: 0
3: 38
4: 269
Right 1183607096 22:38872218-38872240 ATACTCCCTGCGCCCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183607096 Original CRISPR ATACTCCCTGCGCCCGCGGC CGG Exonic