ID: 1183607158

View in Genome Browser
Species Human (GRCh38)
Location 22:38872431-38872453
Sequence GGCTCTTAAAGGGGCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 1, 2: 3, 3: 4, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183607144_1183607158 28 Left 1183607144 22:38872380-38872402 CCGGGGCGGTTGCTAGGGAAAGT 0: 1
1: 0
2: 1
3: 25
4: 90
Right 1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG 0: 1
1: 1
2: 3
3: 4
4: 53
1183607143_1183607158 29 Left 1183607143 22:38872379-38872401 CCCGGGGCGGTTGCTAGGGAAAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG 0: 1
1: 1
2: 3
3: 4
4: 53
1183607142_1183607158 30 Left 1183607142 22:38872378-38872400 CCCCGGGGCGGTTGCTAGGGAAA 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG 0: 1
1: 1
2: 3
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183607158 Original CRISPR GGCTCTTAAAGGGGCCGCGC GGG Intergenic
902237698 1:15068309-15068331 GGCCCTTGGAGGGGCCGAGCCGG + Intronic
902501381 1:16913953-16913975 AGCGCTTACAGGGGCCGCCCTGG - Intronic
919790135 1:201285323-201285345 GGCTCTACAAGGGGCCACTCAGG - Intronic
1063458807 10:6202889-6202911 GGCTTTTAAAGAGTCCGGGCTGG - Intronic
1064600696 10:16989793-16989815 TGCTCTTCAAGGGGCCGCCAGGG - Intronic
1072881867 10:99236112-99236134 ATCTCTTAAAGGGGCGGTGCCGG - Intergenic
1076847559 10:133076781-133076803 GGCTCCTAAAGGCGCCACCCAGG - Intronic
1077367412 11:2166765-2166787 CGCTCTGCAAGGGGCCACGCGGG + Exonic
1080727534 11:34913489-34913511 AGCTCTTAAAGGTGGCACGCAGG + Intronic
1084591620 11:70093884-70093906 GGCTCTCAGAGGGGCTGGGCGGG - Intronic
1095539696 12:43295116-43295138 GGATCTTTAAGGGGCCTCTCAGG + Intergenic
1096883036 12:54688095-54688117 GGCTCTTGAAGGAGCCCCGTTGG + Intergenic
1098521786 12:71440966-71440988 GGCACTTCAAAGGGCGGCGCGGG - Intronic
1099817540 12:87668414-87668436 GGCTCTTGCAGGGGCCTGGCAGG + Intergenic
1104720025 12:131040065-131040087 GGCTCCTACAGGGGCCGGGAAGG - Intronic
1105857181 13:24384757-24384779 GACTCTGCAAGGGGCCGAGCTGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1115856437 14:37633953-37633975 TGCTCTAAAAGAGGCAGCGCAGG - Intronic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1122602780 14:102929733-102929755 GTCTGGTAATGGGGCCGCGCGGG + Exonic
1122626593 14:103088207-103088229 GGCTCTGAGAGGGGCCCCTCTGG - Intergenic
1122852496 14:104544275-104544297 GGCTCTTAAGGGGTCTGGGCAGG + Intronic
1124431473 15:29612408-29612430 GGTTCTAAGAGGGGCCACGCTGG - Intergenic
1132570445 16:641853-641875 GGCCCTTAAAGGGCCCGCACGGG - Exonic
1140749575 16:78011008-78011030 GGCTCTTAAAAGGGCTTTGCTGG - Intergenic
1141638862 16:85329702-85329724 GGTTATTAAAGGCTCCGCGCAGG + Intergenic
1143373437 17:6454334-6454356 GGCTCTTAAAGGAGCCTCTCTGG - Exonic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1147315589 17:39618620-39618642 GGCTCTTAAAGGGCCAGTGGCGG + Intergenic
1148648114 17:49230716-49230738 GGCATTTAAAGGGGACGCGGCGG - Exonic
1152683915 17:81684312-81684334 GGCTCTGCGAGGGTCCGCGCAGG + Intronic
1152743965 17:82030880-82030902 GGGTCTCAAAGAGGCGGCGCGGG - Exonic
1153052092 18:909136-909158 GGATCTCAAGGGGGCAGCGCTGG + Intronic
1160028578 18:75239160-75239182 GGCTCTGGAAGGGCCAGCGCAGG + Intronic
1162935311 19:13978931-13978953 GGCTCGTAATGGGGCGGCGGCGG + Intronic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
1163774806 19:19211913-19211935 TGCTTATAAAGGGGCCGCGAGGG - Intergenic
1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG + Intergenic
927861317 2:26562062-26562084 GGCTCTGTAGTGGGCCGCGCTGG - Intergenic
931728014 2:65129822-65129844 GGATCTTAAAGGGGTCGAGGAGG - Intronic
934052027 2:88219200-88219222 GCCTCTTAGAGGGGCCGCAGGGG + Intergenic
934655834 2:96116494-96116516 GGTTCTTAAAGGAGGCGCGGAGG + Intergenic
939666837 2:144963260-144963282 GGCTCTCAAAGGGGCTGGGGTGG - Intergenic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1173741900 20:45407218-45407240 GGCTCTTAGAGCTGCCGCCCAGG - Intronic
1175904840 20:62374711-62374733 GGCTCTTGGAGGGGCTGCCCAGG + Intergenic
1179488992 21:41728186-41728208 GACTCCTAAAGGGGCCGGGGAGG - Intergenic
1181940464 22:26471776-26471798 GGCTCTTAATGGGGCAGCACAGG + Intronic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
1185181972 22:49368869-49368891 GGCTCTTAAAGGCACAGTGCTGG - Intergenic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
956179200 3:66501341-66501363 GCCTCTTAAAGGAGACACGCAGG + Intergenic
985578895 5:686381-686403 GGCTCTCAAGGGGGCAGAGCAGG + Intronic
985593741 5:778444-778466 GGCTCTCAAGGGGGCAGAGCAGG + Intergenic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
999085230 5:148882444-148882466 GGCTCATAAAGGGGAAGTGCAGG + Intergenic
1004985634 6:21079057-21079079 GGCTGTTACAGGGGCGGCGTGGG + Intronic
1014947663 6:127516269-127516291 GGCGCCCAAAGGGGCCGCTCCGG - Exonic
1019291714 7:253733-253755 GGGTATTAAAGGGGCCTCCCGGG - Intronic
1029038036 7:97542169-97542191 GGCTCTTAAAGCGGCACCTCTGG - Intergenic
1061368994 9:130187398-130187420 CGCTCTTAAAGGGCCAGAGCCGG + Intronic
1191640684 X:63427818-63427840 GGCCCTTACAGGTGCCGCTCTGG - Intergenic