ID: 1183613772

View in Genome Browser
Species Human (GRCh38)
Location 22:38928940-38928962
Sequence TTCCAAAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 852450
Summary {0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183613766_1183613772 -8 Left 1183613766 22:38928925-38928947 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1183613772 22:38928940-38928962 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
1183613764_1183613772 3 Left 1183613764 22:38928914-38928936 CCTCAGGTGATCCATCCACCTTG 0: 191
1: 5646
2: 22146
3: 50848
4: 77308
Right 1183613772 22:38928940-38928962 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
1183613762_1183613772 26 Left 1183613762 22:38928891-38928913 CCAGGCTGGTCTTGAACTCTTGA 0: 2250
1: 56705
2: 131052
3: 182328
4: 198099
Right 1183613772 22:38928940-38928962 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183613772 Original CRISPR TTCCAAAGTGCTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr