ID: 1183613772 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:38928940-38928962 |
| Sequence | TTCCAAAGTGCTGGGATTAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 852450 | |||
| Summary | {0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1183613766_1183613772 | -8 | Left | 1183613766 | 22:38928925-38928947 | CCATCCACCTTGGCCTTCCAAAG | 0: 52 1: 2206 2: 28156 3: 83347 4: 161118 |
||
| Right | 1183613772 | 22:38928940-38928962 | TTCCAAAGTGCTGGGATTACAGG | 0: 9594 1: 299194 2: 262940 3: 149017 4: 131705 |
||||
| 1183613764_1183613772 | 3 | Left | 1183613764 | 22:38928914-38928936 | CCTCAGGTGATCCATCCACCTTG | 0: 191 1: 5646 2: 22146 3: 50848 4: 77308 |
||
| Right | 1183613772 | 22:38928940-38928962 | TTCCAAAGTGCTGGGATTACAGG | 0: 9594 1: 299194 2: 262940 3: 149017 4: 131705 |
||||
| 1183613762_1183613772 | 26 | Left | 1183613762 | 22:38928891-38928913 | CCAGGCTGGTCTTGAACTCTTGA | 0: 2250 1: 56705 2: 131052 3: 182328 4: 198099 |
||
| Right | 1183613772 | 22:38928940-38928962 | TTCCAAAGTGCTGGGATTACAGG | 0: 9594 1: 299194 2: 262940 3: 149017 4: 131705 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1183613772 | Original CRISPR | TTCCAAAGTGCTGGGATTAC AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||