ID: 1183615201

View in Genome Browser
Species Human (GRCh38)
Location 22:38940178-38940200
Sequence GCTTTCTCCAGAATCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183615199_1183615201 -8 Left 1183615199 22:38940163-38940185 CCAGATGGGGTGGAGGCTTTCTC No data
Right 1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG No data
1183615198_1183615201 -4 Left 1183615198 22:38940159-38940181 CCGGCCAGATGGGGTGGAGGCTT No data
Right 1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG No data
1183615196_1183615201 -1 Left 1183615196 22:38940156-38940178 CCACCGGCCAGATGGGGTGGAGG No data
Right 1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183615201 Original CRISPR GCTTTCTCCAGAATCTCAGG TGG Intergenic
No off target data available for this crispr