ID: 1183617928

View in Genome Browser
Species Human (GRCh38)
Location 22:38956332-38956354
Sequence GGCAGCAGGAGCCACCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183617921_1183617928 2 Left 1183617921 22:38956307-38956329 CCAGGGGAAAGGCCATCACACTC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1183617928 22:38956332-38956354 GGCAGCAGGAGCCACCGGGAAGG 0: 1
1: 0
2: 2
3: 42
4: 408
1183617925_1183617928 -10 Left 1183617925 22:38956319-38956341 CCATCACACTCTGGGCAGCAGGA 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1183617928 22:38956332-38956354 GGCAGCAGGAGCCACCGGGAAGG 0: 1
1: 0
2: 2
3: 42
4: 408
1183617916_1183617928 28 Left 1183617916 22:38956281-38956303 CCAGGGGCATTTGATGCATTATT 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1183617928 22:38956332-38956354 GGCAGCAGGAGCCACCGGGAAGG 0: 1
1: 0
2: 2
3: 42
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183617928 Original CRISPR GGCAGCAGGAGCCACCGGGA AGG Intronic
900003563 1:29331-29353 GGCGGCGGGAGCTTCCGGGAGGG - Intergenic
900023283 1:199847-199869 GGCGGCGGGAGCTTCCGGGAGGG - Intergenic
901685035 1:10939039-10939061 GGCAGCAGGAGGTCCAGGGAGGG - Intergenic
901825549 1:11858793-11858815 AGGAGCAGGAGCGCCCGGGAAGG + Exonic
902053761 1:13583885-13583907 GGGAGCAGGAGCCCCGGAGAGGG - Exonic
902749278 1:18495877-18495899 GGCAGCAGGAGCCATCTGGTAGG - Intergenic
903398300 1:23019638-23019660 TGCAGCGGCAGCAACCGGGACGG + Exonic
904008219 1:27374775-27374797 AGCAGGAGAAGCCACAGGGAGGG + Exonic
904300951 1:29554908-29554930 AGCAGGTGGAGCCACTGGGAGGG - Intergenic
904476599 1:30769114-30769136 GGCAGCAGGACCCACAGATAAGG + Intergenic
904704642 1:32380725-32380747 GGCAGCAGGAGCCAGAGGAATGG - Intronic
905620681 1:39443751-39443773 GGCAGCAGTAGTGACAGGGAAGG + Intronic
906197277 1:43936796-43936818 GGCAGGAAGAGCCACCGGTAAGG - Exonic
906252247 1:44319587-44319609 GGCAGCAGGGGCTGCTGGGAGGG - Intronic
906346193 1:45016180-45016202 GGAAGCAGGTACCACCAGGAAGG - Intergenic
907267443 1:53271514-53271536 GGCAGCAGGCGGCACAGAGAGGG + Intronic
907395900 1:54189723-54189745 GGCAGGAGGGGCCACAGGGCAGG - Intronic
907541071 1:55215608-55215630 GGCAACAGGTTCCCCCGGGACGG + Intergenic
913182331 1:116334204-116334226 GGCAGCTGGAGGCAGCTGGATGG - Intergenic
913349561 1:117842616-117842638 GGCAGTAGGAGCCACCCTGTTGG - Intergenic
915632389 1:157162644-157162666 GGCAGCAGGAGCCGATGGCAAGG - Intergenic
920235162 1:204498084-204498106 TGCAGCAGGAACCTCCAGGAGGG + Intergenic
920673659 1:208024037-208024059 AGCAGCAGGGGCCAGCTGGAGGG + Exonic
920727116 1:208446318-208446340 GGCAGCAAGAACCACAGAGAGGG - Intergenic
920916523 1:210262250-210262272 GGCAGCTGGAGCTGCCAGGAGGG - Intergenic
921049459 1:211500799-211500821 GGGGGCAGGAGCCACAGGGAAGG - Intergenic
921318352 1:213913608-213913630 GGCTGCAGGAGCACACGGGAGGG + Intergenic
923561897 1:235047823-235047845 GGCACAAGGAGCCACAGGAAAGG + Intergenic
924161985 1:241242251-241242273 TGCAGCAGCAGCAACCTGGATGG - Intronic
924741914 1:246799147-246799169 GGCCGCAGGAGTCACCAGGGAGG - Intergenic
1063157487 10:3393687-3393709 GGAAGGAGTAGCCACTGGGAAGG - Intergenic
1066745571 10:38602539-38602561 GGCAGCAGGAGCAAGAGGCAGGG - Intergenic
1067773545 10:49144839-49144861 GGCAGAGGGAGGCACTGGGAGGG - Intergenic
1068647041 10:59479594-59479616 GGCAGCGGGAGGCAACGGGGCGG + Intergenic
1069588801 10:69629716-69629738 GGCAGAAGGAACCACCTGCAGGG - Intergenic
1070334958 10:75447235-75447257 GGTAGCTGGAGACACCAGGATGG - Intronic
1070582005 10:77728228-77728250 GGCAGCAGGAGGAACAGGGAAGG - Intergenic
1070726710 10:78796845-78796867 TTCAGCAGGAGCCACAAGGAAGG - Intergenic
1070746473 10:78936773-78936795 GCCAGCTGGAGCCAGCTGGAAGG - Intergenic
1072961084 10:99929817-99929839 GGCAGCAGGATCCTTCTGGATGG - Intronic
1073058240 10:100715638-100715660 GGGAGCAGGGGCGTCCGGGAGGG + Intergenic
1073070649 10:100791151-100791173 GGCAGGCGGAGCCTCAGGGAGGG - Intronic
1073845312 10:107547116-107547138 GGCAACAGGACCCCCCAGGAAGG - Intergenic
1074226323 10:111487968-111487990 GGCAGCAGGAGACAGAGAGAGGG - Intergenic
1075041860 10:119114426-119114448 GGCAGCAGAAGCCCGCAGGAGGG + Intronic
1075077534 10:119360987-119361009 GACAGCAGGTGCCTCTGGGAAGG + Intronic
1075724859 10:124606004-124606026 GGCAGCAGGACCCACCCTGCAGG + Intronic
1076255821 10:129024035-129024057 GGCAGCAGAGGCCCCAGGGAGGG + Intergenic
1076443413 10:130495779-130495801 GGCTGCAGGAGCCACAGACAGGG - Intergenic
1076726938 10:132418394-132418416 GGCAGCAGCATACACCTGGAGGG + Intergenic
1076883679 10:133251805-133251827 TGCAGCAGGAGGCCCCGGGATGG - Intergenic
1077147044 11:1051007-1051029 GGCAGGTGGGGCCACCGGGCAGG - Intergenic
1077303256 11:1856715-1856737 AGCAGCAGGAGCCCATGGGATGG + Intronic
1077430864 11:2515448-2515470 GGCAGCAGGGGCCTCGGGGACGG - Intronic
1078191394 11:9094598-9094620 GGCAGCAGCAGCTTCCGGGGTGG + Intronic
1079968434 11:27006739-27006761 GGCTGCAGGAGCCACAGAGCTGG + Intergenic
1080089218 11:28324949-28324971 GGCAGCAGGAGCCACAGGGCAGG - Intronic
1080887534 11:36380365-36380387 GGCAGCAGAAGGCATCGGGAGGG - Intronic
1083284254 11:61647811-61647833 GGCAGCAGCAGCCATCTGGGAGG - Intergenic
1083298580 11:61728346-61728368 CGCTGCAGGGGCCACAGGGAAGG - Intronic
1083310388 11:61780812-61780834 GGCAGCAGGAGCCAGAGGAGAGG - Intronic
1083702240 11:64487139-64487161 GGCAGCAAGGACCACCAGGATGG + Intergenic
1083950582 11:65953507-65953529 GGCAGCAGGAGCCTCACGGAGGG - Intronic
1084297831 11:68224700-68224722 GGCAACAGTAGCCACCAGGATGG - Intergenic
1084642640 11:70434878-70434900 GGCAGCAGGAGCCTCCGCGGTGG + Intronic
1084659402 11:70538187-70538209 GGCTGCAGGAGCCCCCGGGTGGG - Intronic
1084872681 11:72108751-72108773 GCCAGCAGGTGCCACCGTGCTGG + Exonic
1085393554 11:76194740-76194762 GGCCGCAGGAGCAGCCGGGCAGG + Exonic
1085446583 11:76604815-76604837 GGGAGCAGGAGCCCCCAGGAAGG + Intergenic
1085453828 11:76654861-76654883 GGCAGCAGGGGCCAGTGGGGAGG - Intergenic
1085461171 11:76694591-76694613 GGCAGCAGGAGCTACCATGATGG - Intergenic
1085994537 11:81894445-81894467 GGAATCAGGAGCCACAGAGAGGG + Intergenic
1086584048 11:88431828-88431850 GACAGCAGGAGCCACAGAGCCGG - Intergenic
1087878931 11:103392207-103392229 GGCAGCAGGAGGCTGGGGGAGGG - Intronic
1089599366 11:119604159-119604181 GGCAGCAGCAGCTTCCGGGGTGG - Intergenic
1089649044 11:119900333-119900355 GGGAGCAGGAGCTGCAGGGAGGG - Intergenic
1090387229 11:126364272-126364294 GGGACCAGGAGACACCAGGATGG + Intronic
1090389793 11:126381470-126381492 GGGACCAGGAGACACCAGGATGG + Intronic
1090398495 11:126434258-126434280 GGCACCAGGAGCCACCGAGGGGG + Intronic
1090844556 11:130519930-130519952 GGCAGCAGGATACCCCGAGAGGG + Intergenic
1091129685 11:133134830-133134852 GGCAGCAGGAAACACCAGTAAGG + Intronic
1091376982 12:31385-31407 GGCGGCGGGAGCTTCCGGGAGGG - Intergenic
1092707855 12:11303930-11303952 GGGAGCAGGAGGCAAGGGGAGGG + Intergenic
1093997490 12:25657644-25657666 GGCAGCAGGAGCCTTTTGGAAGG - Intergenic
1094296530 12:28913111-28913133 GGCAGTAGGAGCCATCAGGCAGG - Intergenic
1094816413 12:34190537-34190559 GACAGCAGGAGCAACAAGGAGGG - Intergenic
1095991364 12:48036850-48036872 GGAAGCAGGGGCTACCAGGAGGG + Intergenic
1097222846 12:57460921-57460943 GGCAGCGGGAGCCAGCCGCAGGG + Intronic
1097720556 12:63015786-63015808 GGCAGCAGGAGAGACTGAGAAGG - Intergenic
1098985124 12:77003990-77004012 GGCAGCAGCAGCCTCAGTGAGGG + Intergenic
1100427152 12:94498050-94498072 GGCAGCAGGAGCCATGGAGCTGG - Intergenic
1101066021 12:101021419-101021441 GCCAGCAGAAGACACTGGGAGGG - Intronic
1101247970 12:102902904-102902926 GGCAGCCCCAGCCACCTGGAAGG - Intronic
1101599855 12:106199818-106199840 CTCAGCAGGAGCCACAGAGAAGG + Intergenic
1101858079 12:108460792-108460814 TGTAGCAGGAGCCTCTGGGAAGG - Intergenic
1102033953 12:109760424-109760446 GAGAGCAGGAGCCAGGGGGATGG + Intronic
1103602815 12:122064886-122064908 GAGAGCAGGAGGCACAGGGAAGG + Intergenic
1104889304 12:132132642-132132664 GGGAGCAGGAGCCGTGGGGAGGG + Intergenic
1104971312 12:132532148-132532170 GCCAGCAGGAGCCAGAGTGAGGG + Intronic
1106205263 13:27587293-27587315 GGCAGCAGGAGCAGAAGGGAAGG - Intronic
1106343299 13:28852016-28852038 GGCATCAGGAGCGAGGGGGAGGG - Intronic
1107826438 13:44332726-44332748 GGCAGCAGCAGCAGCAGGGAGGG - Intergenic
1108484485 13:50910217-50910239 GGTAGTGGGAGCCACCGGGGTGG - Intronic
1108622263 13:52195700-52195722 GGCAGCAGGAGACAGAGGGGCGG - Intergenic
1109388533 13:61665169-61665191 GGCAGCAGGAGCCACAGAGCTGG - Intergenic
1111161470 13:84399794-84399816 GGCAGCAGGAGCCACAGAACTGG + Intergenic
1113634019 13:111907651-111907673 GGCACCAGGTGCCTCCAGGAAGG + Intergenic
1113778175 13:112960820-112960842 GGCAGCAGGAGGCTCAGGCAGGG - Intronic
1113788969 13:113017301-113017323 AGCAGGAGGAGCCTCCGGAAGGG - Intronic
1113951912 13:114076714-114076736 GGCAGCCGCGGCCACCAGGAAGG - Intronic
1114452561 14:22836836-22836858 GGGAGCAGGAGACAACGGGGGGG - Exonic
1114694666 14:24615199-24615221 AGCAGCAGGAGCCCCAGGGGAGG - Intergenic
1115756098 14:36527022-36527044 GGCAGCTGAAGCCACGGGGATGG - Intergenic
1115906689 14:38209465-38209487 GGCAGCAGGGGCCCCGGGGCCGG + Exonic
1118845908 14:69547802-69547824 GACAGCAGCAGCCACTGGGTGGG - Intergenic
1119187102 14:72650742-72650764 GTCAGAAGGAGTCACAGGGATGG + Intronic
1119856449 14:77904683-77904705 GGCAGGAGGAGCCCACAGGAGGG + Intronic
1120365318 14:83561398-83561420 GGCAGCCGCAGCCACCGTGCTGG - Intergenic
1122207666 14:100156179-100156201 GGCTGCAGGAGCCAGCTGGGTGG + Intronic
1122461011 14:101895480-101895502 GTCAGCAGGGGCCAGAGGGAGGG - Intronic
1122945719 14:105007968-105007990 GGCTGGCGGAGCCACCGGAAAGG - Intronic
1122983940 14:105203640-105203662 GGGAGCAGGAGGCAGAGGGAGGG + Intergenic
1123040910 14:105489949-105489971 GGCGGCGGGAGCCAGGGGGATGG - Intronic
1124142502 15:27089187-27089209 GTCAGGAGGAGCCGCAGGGAAGG + Intronic
1125841155 15:42802261-42802283 GGCAGCAGCAGCTTCCGGGGTGG - Intronic
1126303029 15:47221287-47221309 GGGAGCTGGAGCCATGGGGAGGG - Intronic
1126954255 15:53914596-53914618 GGCAGCAGGGGCCACAGAGCGGG + Intergenic
1132449938 15:101961609-101961631 GGCGGCGGGAGCTTCCGGGAGGG + Intergenic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1133260147 16:4543997-4544019 GGCAGGAGGACCCACTGGGAAGG + Intergenic
1133266777 16:4589554-4589576 GGCAGCAGGAGCACCCTGGCAGG + Intronic
1133470615 16:6071745-6071767 GTAACCAGGAGCCACGGGGAGGG - Intronic
1134029059 16:10977406-10977428 GCCAGCGGGAGCCACGGGGCTGG - Intronic
1134279425 16:12804324-12804346 GTCAGAAGGAGCCACTGGGGTGG + Intergenic
1134919643 16:18104051-18104073 GGAAGAAGGAGCCACCAGAATGG + Intergenic
1135114114 16:19711325-19711347 GGTGGCAGGAGGCAGCGGGAGGG + Intronic
1135913698 16:26583921-26583943 GGCATCAGTAGCCTCAGGGAAGG - Intergenic
1136088998 16:27904860-27904882 GGCAGCTGCAGCCACCTGGAGGG + Intronic
1136515482 16:30765598-30765620 AGCAGCAGGAGTGACCAGGAAGG - Intronic
1136737494 16:32477110-32477132 GGCAGCAGGAGCAAGAGGCAGGG + Intergenic
1137652201 16:50130176-50130198 GGGAGCAGGAGAGACGGGGAAGG + Intergenic
1138186441 16:54981286-54981308 GGCAGAAGCAGCCACAGGCATGG - Intergenic
1138266136 16:55660999-55661021 GGCTGCAGGAGGCTCTGGGAGGG + Intronic
1138270887 16:55695144-55695166 GGCAGCAGGAGCCACTGAAGGGG + Intronic
1138376026 16:56564706-56564728 GGCAGGAGGAGCCCCTGTGAAGG + Intergenic
1138619199 16:58198043-58198065 GGCAGCGGCAGCCACCGGCCGGG + Intergenic
1139268463 16:65660830-65660852 GGCATCAGGGGCCAAGGGGAGGG - Intergenic
1139292597 16:65872077-65872099 GGTAGCAGGAGGCACAGGGAGGG - Intergenic
1139370722 16:66467853-66467875 GGCTGCAAGAGCCACCAGCATGG + Intronic
1139923232 16:70472493-70472515 GGCTGCAGGGGCCACAGGAAAGG - Intronic
1140022103 16:71248413-71248435 GGCAGCTGGAGCATCCGGCAAGG + Intergenic
1140228468 16:73097731-73097753 GGCTGGAGGGGCCACGGGGACGG - Intergenic
1140265789 16:73419495-73419517 GGCAGCAGGGGCCACCACCAAGG - Intergenic
1140753859 16:78049752-78049774 GGCAGCAGCAGCTTCCGGGGTGG - Intronic
1141602962 16:85137382-85137404 GGAAGCCAGAGGCACCGGGATGG - Intergenic
1142382155 16:89739071-89739093 GGCAGAAGGAGCCTCCGGCTGGG + Intronic
1203015577 16_KI270728v1_random:352467-352489 GGCAGCAGGAGCAAGAGGCAGGG - Intergenic
1203033912 16_KI270728v1_random:625625-625647 GGCAGCAGGAGCAAGAGGCAGGG - Intergenic
1142851327 17:2706194-2706216 CGGAGCAGGAGCCTCAGGGAAGG + Intronic
1142887353 17:2921032-2921054 GGGAGAAGAAGCCAGCGGGAGGG - Intronic
1143166300 17:4898925-4898947 AGCTGCAGGAGCCAGCGGCATGG + Intronic
1143205180 17:5136214-5136236 GGCAGGAGGACCCTCAGGGAGGG - Intronic
1143240425 17:5438973-5438995 GGCTGCAGGAGCTGCCGGAAAGG + Exonic
1143776965 17:9205953-9205975 TGCGGCAGGAGCAACCGGAATGG - Intronic
1143859564 17:9878661-9878683 GGGTGCAGGAGCCACCAGGACGG - Intronic
1144219360 17:13086112-13086134 GGCACCAGCAGGCACGGGGAGGG - Intergenic
1144675750 17:17160515-17160537 GGCATCAGGAGGCACCTGGGAGG + Intronic
1146318950 17:31831509-31831531 AGCAGCAAGAGCCACCACGAAGG + Intergenic
1146848550 17:36201691-36201713 GGCAGCAGGCGCCCCAGGGATGG + Intronic
1147659307 17:42108715-42108737 GGCAGCAGGAGCCACAGGGCCGG + Intronic
1147792545 17:43022403-43022425 GGCTGCGGGATCCAGCGGGAGGG + Exonic
1148852194 17:50560800-50560822 GGCAGCGGCAGCCACCGCGGCGG + Intergenic
1150311087 17:64130004-64130026 AGCAGCAGCAGCCGCCGGGCCGG + Exonic
1150732708 17:67709987-67710009 CCCAGCAGGAGCCAGCAGGAGGG - Intergenic
1150782462 17:68134419-68134441 GGCAGCAGGGGCCCCGTGGAAGG + Intergenic
1151201278 17:72469773-72469795 GAAAGCAGGTGCCACTGGGAAGG - Intergenic
1151412748 17:73942160-73942182 GGCTGCAGGAGGCACTGTGAGGG + Intergenic
1151712128 17:75812979-75813001 GGAAGGAGAAGCCACTGGGAAGG - Intronic
1151854310 17:76710552-76710574 GGCAGCCGGAGCCCCGGGGGTGG + Intronic
1151973161 17:77469496-77469518 GGCAGCAGGAGCCATGGAGCAGG + Intronic
1151974395 17:77476155-77476177 GGCAGCATGACACACAGGGAGGG + Intronic
1152106268 17:78330988-78331010 GGCAGGAGGCTCCACTGGGATGG - Intergenic
1152258841 17:79255719-79255741 AGCTGCAGGTGCCCCCGGGATGG - Intronic
1152448398 17:80360433-80360455 GGCAGCAGGAGCCTGTGAGATGG + Intronic
1152648366 17:81480792-81480814 GGCAGCTGGAGCCACAGGAGAGG - Intergenic
1152659016 17:81533938-81533960 GGCAGCAGGAGCCCGCAGGAGGG - Intronic
1152663052 17:81551884-81551906 GGCAGCAGGAGTGTGCGGGAGGG + Intronic
1152739202 17:82011729-82011751 GGCTGCAGGAGGCACCTGGGCGG - Intronic
1152776652 17:82206094-82206116 GGCAGGAGAAGCCGCCGGGGAGG + Intronic
1152862862 17:82705852-82705874 GCCGGCGGGAGCCACCAGGACGG - Intergenic
1154095949 18:11414785-11414807 GGGAGGAGGAGCCACTGGCAGGG + Intergenic
1155320334 18:24612599-24612621 TGCAGCAGGAGTAACGGGGAAGG - Intergenic
1155412672 18:25563594-25563616 AGCAGCAGGAGGGACAGGGAAGG + Intergenic
1157110621 18:44816839-44816861 GGCAAGAGGACCCACGGGGAAGG - Intronic
1157279094 18:46334165-46334187 GGCTGCGGGAGCCGCCGGGGCGG - Intronic
1157841053 18:50958797-50958819 GGCAGCAGGAACCACAGTCAAGG - Intergenic
1158380644 18:56926271-56926293 GGCAGCTGCAGCCAAGGGGAGGG - Intronic
1159816547 18:73080660-73080682 GGCAGCACTGGCCACAGGGAAGG + Intergenic
1160395372 18:78566961-78566983 GGCTGCAGGTGACACCAGGAAGG - Intergenic
1160635316 19:70938-70960 GGCGGCGGGAGCTTCCGGGAGGG - Intergenic
1160738860 19:676882-676904 GGCACCAGGACCGACCCGGACGG - Intronic
1160776041 19:856147-856169 GCCAGCAGGACCCACTGAGAAGG + Exonic
1160826735 19:1083640-1083662 GGCTGCAGGCAGCACCGGGATGG - Intronic
1161332153 19:3693486-3693508 GCCAGCAGGCGCCAGCTGGACGG - Intronic
1161569648 19:5023541-5023563 GGCAGCAGGAACCAGCGAGATGG + Intronic
1162031768 19:7920621-7920643 TGCGGCAGGAGCCAGCGGGGCGG + Intronic
1163300955 19:16445822-16445844 GGCTGCAGGTGGCACCAGGATGG + Intronic
1164676268 19:30103844-30103866 GGCAGCAGGAACACCAGGGAAGG - Intergenic
1164760743 19:30726599-30726621 GGCAGCAGTACCCTCTGGGATGG + Intergenic
1164899436 19:31905968-31905990 GGCAAGGGGAGCCACTGGGAAGG + Intergenic
1166050715 19:40257209-40257231 GTCAGCAGGGGCCACCTGGAGGG - Intronic
1166770393 19:45278337-45278359 GGCATCAGGAGGCTCCGGCAGGG + Intronic
1167526881 19:49989680-49989702 GGCAGCAGGAGCCCTCACGAGGG - Exonic
1167620429 19:50557103-50557125 CGCGGCTGGAGCCACGGGGATGG + Intronic
1167621695 19:50564359-50564381 GGGAGAGGGAGCCACGGGGAAGG + Intronic
925153922 2:1635973-1635995 GGTAGCAGAAGCCTCCTGGAAGG + Intronic
925191908 2:1892001-1892023 GGCAGGTGGAGCCACCTGGCGGG - Intronic
925284479 2:2706756-2706778 GGAAGCAGGAGCCACAGGCAGGG - Intergenic
926395936 2:12442315-12442337 GGCCCCAGGAGCCACTGAGATGG + Intergenic
926398315 2:12468489-12468511 GGCAGCAGGAGACACCTGCCTGG + Intergenic
928035901 2:27822674-27822696 GGCAGCAGCAGCCAGCTGCATGG - Intronic
929190389 2:39134377-39134399 GACATGAGGAGCCACTGGGATGG - Intergenic
929575044 2:43046294-43046316 GGCAGCAGAAGCCTCCGAGCCGG + Intergenic
931705442 2:64942905-64942927 GGCTGCAGGAGCCCACAGGAGGG - Intergenic
933085400 2:78048571-78048593 GGCATCTGGAGCAACCTGGATGG - Intergenic
933703108 2:85270056-85270078 GCCTGCAGGAGCCGCGGGGAAGG + Intronic
934307970 2:91841730-91841752 GGCAGCAGGAGCAAGAGGCAGGG - Intergenic
934475598 2:94591441-94591463 GGCAGCCTGAGCCACAGAGATGG - Intronic
934577956 2:95414791-95414813 GGCAGGAGGAGCCATCGGAGTGG - Exonic
934846438 2:97663923-97663945 GGCTGCAGGAGGCACCGGATGGG + Exonic
935122854 2:100197681-100197703 GGCAGCAGCAGCCTGGGGGAGGG + Intergenic
935175173 2:100642788-100642810 GGCAGGAGGAGCCAACCGGTAGG + Intergenic
935305055 2:101729699-101729721 GGCAAGAGGAGCTACCTGGAGGG - Intronic
935820454 2:106887521-106887543 GGCAGCTGGAGCCTGCGGGCGGG + Intergenic
936011306 2:108927000-108927022 GGCAGCATGAGCCCCTGAGAGGG + Intronic
936566163 2:113584104-113584126 GGCGGCGGGAGCTTCCGGGAGGG + Intergenic
937257878 2:120567549-120567571 GTCTGCAGGTGCCACTGGGAAGG + Intergenic
938289528 2:130141964-130141986 GCAAGCTGAAGCCACCGGGAGGG - Intronic
938374841 2:130798383-130798405 GGCAGGAGGGGTCACCGGTAGGG + Intergenic
938421007 2:131146722-131146744 GGCAGGAGCAGCCACGGGCATGG + Exonic
938467002 2:131530974-131530996 GCAAGCTGAAGCCACCGGGAGGG + Intronic
939350044 2:141024803-141024825 GTCCGCAGGAGCAACTGGGAGGG + Intronic
941816241 2:169798843-169798865 GGCCGCAAGAGCTGCCGGGACGG + Intronic
943064563 2:183072341-183072363 GGCAGCAGCAGCTTCCGGGGTGG - Intergenic
943728294 2:191274750-191274772 TGCAGCAGGAGCCACAGAGACGG - Intronic
945321958 2:208434900-208434922 AGAAGCAGGAGCCAGTGGGATGG + Intronic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946767433 2:223053356-223053378 GGCTGATGGAGCCACCGGCAGGG - Exonic
946805824 2:223470533-223470555 GGAAGGAGGAGCCACGGGGAAGG + Intergenic
947330521 2:229024934-229024956 GGCAGCAGGAGGGAAAGGGAAGG + Exonic
947723282 2:232381801-232381823 GGAAGCAGGAGCCCCAGGGACGG - Exonic
947727626 2:232409878-232409900 GGAAGCAGGAGCCCCAGGGACGG - Exonic
948118954 2:235514645-235514667 GCCAGCAGGAGCCATCGGAATGG - Intronic
948287696 2:236799252-236799274 TGCACCAGGAGGCACCGGGCAGG + Intergenic
948999295 2:241603165-241603187 GGCTGGAGCAGCCACCTGGAGGG - Intronic
1168879486 20:1194435-1194457 GAAAGGAGGAGCCACCGTGATGG + Intergenic
1169071969 20:2738342-2738364 GGCAGCAGAAGCCACAGAGCTGG - Intronic
1169194395 20:3675407-3675429 GGCAGCAGGATCCACAGGATCGG + Intronic
1171045919 20:21809362-21809384 GGCTGCAGGAGGCACAGGGTAGG + Intergenic
1171460898 20:25297415-25297437 CACAGCAGGAGTCAGCGGGAGGG - Exonic
1171820087 20:29828088-29828110 GACAGCAGGAGCAACAAGGAGGG - Intergenic
1171822379 20:29865219-29865241 GACAGCAGGAGCAACAAGGAGGG - Intergenic
1171897742 20:30825069-30825091 GACAGCAGGAGCAACAAGGAGGG + Intergenic
1172877883 20:38177137-38177159 GGGACCAGGACCCACAGGGAAGG - Intergenic
1173560092 20:43998121-43998143 GGCAGCAGGAGACAGGGAGATGG + Intronic
1174575782 20:51536052-51536074 GGCAGGACCATCCACCGGGATGG + Intronic
1175397314 20:58675298-58675320 GGGAGGAGGAGACAGCGGGAAGG - Intronic
1176008819 20:62880974-62880996 GGCAGCAGCACCCTCCGGGCAGG + Exonic
1176180138 20:63746089-63746111 GTCAGCAGGAGCGGCCGGGCTGG + Exonic
1176292988 21:5056059-5056081 GGCAGGAGGACACACGGGGAAGG - Intergenic
1176429535 21:6567411-6567433 GGCATCAGGAGGCCCCAGGAGGG - Intergenic
1176429721 21:6568215-6568237 GGCAGCAGCACCCACGGAGAAGG - Intergenic
1177338136 21:19760097-19760119 GGCTGCAGGAGCTGCCGGAAGGG + Intergenic
1179163034 21:38913280-38913302 AGCAGCAGGAGTCACCTGGGAGG + Intergenic
1179613453 21:42566769-42566791 GGCAGCAGCTGCCACCATGAGGG - Intronic
1179666147 21:42913851-42913873 TACAGCAGGAGCCACCGTGCTGG + Intergenic
1179704929 21:43174873-43174895 GGCATCAGGAGGCCCCAGGAGGG - Intergenic
1179705115 21:43175677-43175699 GGCAGCAGCACCCACGGAGAAGG - Intergenic
1179801287 21:43812564-43812586 GGAGGGAGGAGCCACCAGGAAGG - Intergenic
1179837928 21:44049748-44049770 GGCAGCAGCAGCCAGGGGCAGGG - Intronic
1179864272 21:44207591-44207613 GGCAGGAGGACACACGGGGAAGG + Intergenic
1179880139 21:44290112-44290134 GGCAGCAGGACCCACCCGAGGGG - Intronic
1179881520 21:44295082-44295104 TGCTGCAGGAGCCTCCGGGGGGG + Intronic
1179899131 21:44379792-44379814 GGAAGCAGCAGGCACAGGGAGGG - Intronic
1180181451 21:46120331-46120353 GGCAGCTACAGGCACCGGGAAGG + Intronic
1180535052 22:16388813-16388835 GGCAGCAGGAGCAAGAGGCAGGG - Intergenic
1181023765 22:20116532-20116554 GGCTGCAGGGGGCACCGAGACGG + Exonic
1181478562 22:23183014-23183036 GGCAGCAGGAGCACACTGGAGGG - Intronic
1181521852 22:23452797-23452819 GGCATCAGCAGCCATCGTGAGGG - Intergenic
1181549274 22:23627704-23627726 AGCAGCAGGAGCCAAGGGGCAGG + Intronic
1181604149 22:23969997-23970019 GGCAGGAGGAGGGACAGGGAAGG + Intronic
1181776781 22:25165855-25165877 GGCTGGAGGAGCCAGTGGGAGGG + Intronic
1181813865 22:25421734-25421756 GGAAGAAGGAGCGACCAGGATGG - Intergenic
1181831832 22:25565560-25565582 GGAAGAAGGAGCGACCAGGATGG - Intronic
1182447595 22:30398463-30398485 GGGAGCAGGAGGCTCAGGGAGGG + Intronic
1182550188 22:31096760-31096782 GGCTGCAGGAGGCACGGGGCCGG + Exonic
1183084988 22:35481177-35481199 GGAGGCAGGAGAGACCGGGAAGG + Intergenic
1183358035 22:37369830-37369852 GGCAGGGGGGGCCACAGGGAGGG - Exonic
1183513211 22:38247969-38247991 GGCAGCAGGAGGCTCCCTGAGGG + Exonic
1183617928 22:38956332-38956354 GGCAGCAGGAGCCACCGGGAAGG + Intronic
1183660128 22:39214958-39214980 GCCACCTGGAGTCACCGGGAAGG + Intergenic
1183706036 22:39475432-39475454 GGCAGAAGGAGACCTCGGGAGGG - Intronic
1184172329 22:42767168-42767190 GGCAGCAGGAGCCAACTGATAGG - Intergenic
1184208836 22:43023421-43023443 GGCAGCAGGTGCCACCCCGCAGG - Intergenic
1184248138 22:43245951-43245973 GAAAGCAGAAGCCACTGGGATGG + Intronic
1184795865 22:46731984-46732006 GGCAGCAGGAGGGGTCGGGAGGG + Intronic
1184808494 22:46812269-46812291 GGCAGGAGGAGGCAGCGGCAGGG - Intronic
1184957638 22:47902288-47902310 GGAAGCAAGAGTCACCGGGGTGG - Intergenic
1185056034 22:48578808-48578830 GGCATCAGGAGCCCCAGGGGAGG + Intronic
1185209906 22:49564983-49565005 GGCAGCAGGAGAAACAGGGGAGG - Intronic
950096599 3:10334295-10334317 GGCCGCAGGAGTCATCGGGAGGG + Intronic
954379198 3:50210735-50210757 GGGGCCAGGAGCCACAGGGATGG - Intronic
954761369 3:52877122-52877144 GGCAGAAGCAGCCACAGGCAGGG - Intronic
954967742 3:54626060-54626082 GGCAGGGGGAGTCACCAGGAGGG - Intronic
956412706 3:68995158-68995180 GGCAACACCATCCACCGGGAGGG + Intronic
957086843 3:75687744-75687766 GACAGCAGGAGCAACAAGGAGGG + Intergenic
957966053 3:87323391-87323413 GGCAGCAGCAGCTTCTGGGATGG + Intergenic
958810921 3:98859159-98859181 GGCAGCAGGAGGCTGGGGGAGGG + Intronic
959166721 3:102789362-102789384 GCCAGCAGGAGACCCAGGGACGG - Intergenic
960215584 3:115032361-115032383 GGCTGCAGGAGACACAAGGAAGG + Intronic
961407644 3:126693002-126693024 GGCAGGAGGAGCTCCCTGGAAGG - Intergenic
963253394 3:143121211-143121233 GGCTGCAGGAGCCGCCCCGACGG - Exonic
967889215 3:194353228-194353250 GACAGCGGGAGCCTCTGGGATGG + Intergenic
968917193 4:3501721-3501743 GGCAGGAGGAAGCACCGGGCGGG + Intergenic
969393378 4:6905741-6905763 GGCAGCAAGAGACACCGAAATGG - Intergenic
969867316 4:10084338-10084360 TGCAGCTGGAGCCACCTGGCTGG + Intronic
970332569 4:15002055-15002077 GGAAGGAGGAGGCACCGCGAGGG + Intergenic
972397615 4:38671449-38671471 GGCAGCAGGGGCCAGTTGGAAGG + Intronic
981569357 4:146134998-146135020 GGCAGCACCATCCACCAGGAAGG - Intergenic
981717738 4:147768228-147768250 GGGAGCAGGAACCAGGGGGAGGG - Intronic
982172789 4:152678142-152678164 GGAAGGAGGTGCCACTGGGAAGG + Intronic
982459899 4:155656173-155656195 GGCAGCAGAAGACACCTGCAGGG + Intergenic
983591828 4:169421610-169421632 GGCAGCAGGAGACAGAGAGAGGG - Intronic
984702009 4:182824723-182824745 GGAGGCAGGAGACCCCGGGAAGG - Intergenic
985049091 4:185971946-185971968 TGCAGCAGGATGCACTGGGAGGG - Intergenic
986353637 5:6903499-6903521 GGCAACAGGGACCACTGGGATGG + Intergenic
988401764 5:30771279-30771301 GGCAGCGGGAGCAGCAGGGAGGG + Intergenic
990631932 5:57679929-57679951 GGCAGCAGGAGGCAGTGTGATGG + Intergenic
990900620 5:60744858-60744880 GGCAGCAGCAGCTTCCGGGGTGG - Intergenic
992676066 5:79107649-79107671 ACCAGCAGGAGCCACAGGCACGG + Intronic
994816255 5:104591730-104591752 AGCAGGAGGGGCCACAGGGATGG - Intergenic
995624769 5:114064272-114064294 AGCAGCAGGACCCAAAGGGATGG - Intergenic
996819712 5:127612863-127612885 GGCACCAGCAGCCAGCTGGATGG + Intergenic
997354510 5:133253691-133253713 GGCAGCAGGGGCAAACTGGAGGG - Intronic
997518790 5:134508936-134508958 GGCAGCAGGAGCAGCCTGGCTGG - Intergenic
998033862 5:138896594-138896616 GGGAGCAGGAGCCAGAGGGCTGG + Intronic
998138151 5:139685154-139685176 GCCAGCAGGGGGCACCGGGCAGG + Intergenic
998203782 5:140145342-140145364 GGCAGCAGGAGCCTCAGGGGAGG - Intergenic
998887303 5:146707456-146707478 GGCAGCAGCAGCTTCCGGGGTGG - Intronic
1000065546 5:157690566-157690588 GGCAGCAGGAGCCGCAGGTCGGG + Intergenic
1000073978 5:157767667-157767689 GGCAGCTGGAACCTCTGGGACGG + Intergenic
1001297011 5:170505182-170505204 GTCAGGAGGAGCAACCGTGAAGG + Intronic
1001455956 5:171859790-171859812 GGCAGCAGGTCCCACGGGCAAGG - Intergenic
1001482135 5:172095779-172095801 GGCACAGGGAGCCACCGGGATGG + Intronic
1002525797 5:179815600-179815622 GGAAGCAGGAGCCTTGGGGAGGG - Intronic
1002639037 5:180621966-180621988 GGCAGGAGGAGACCCCGGGGCGG - Intronic
1004290585 6:14363522-14363544 TGCAGAAGGAGCCCCCGGGTTGG + Intergenic
1004425087 6:15501695-15501717 GGCAGCAGGAGACCCAGTGAGGG + Intronic
1005518509 6:26577472-26577494 GCCAGCAGGAGACTCAGGGAGGG - Intergenic
1006367288 6:33622928-33622950 GGCACCAGGAGGGACCTGGATGG - Intronic
1006911360 6:37565772-37565794 GGCAGCAGCAGCCTCAGGGAGGG - Intergenic
1006985574 6:38173381-38173403 TGCAGCTGGAGCTACCGGGGAGG + Exonic
1007415002 6:41686398-41686420 GGCAACAGAAGTCACCAGGAGGG - Intronic
1007416665 6:41694967-41694989 AGCAGCAGGAGGCAGCTGGAGGG - Intronic
1007884804 6:45214982-45215004 GGGAGTAGGAGCCACGGGGTAGG - Intronic
1009563544 6:65278910-65278932 ACAAGCAGGAGCCACCGGGCTGG - Intronic
1011585801 6:88923984-88924006 GGAAGGGGAAGCCACCGGGAGGG + Intronic
1013155824 6:107490346-107490368 GGCAGCAGGAGCCGGAGCGACGG + Exonic
1013170464 6:107633779-107633801 GCCAGCTGTAGCCACCGGGGAGG - Exonic
1013175744 6:107675233-107675255 GGCAGCAGGTGCCACCTAGAGGG + Intergenic
1019049963 6:169175129-169175151 GGCGGAAGGAGCCGCCGGGCAGG - Intergenic
1019274744 7:170058-170080 GTGGGCAGGAGCCACCGGGCTGG - Intergenic
1019345760 7:529979-530001 GGCACCAGGAGCCACCAGTGTGG + Intergenic
1019455144 7:1123027-1123049 GCCAGCAGGGCCCTCCGGGATGG + Intronic
1019750298 7:2725035-2725057 TGCAGCAGCATCCACCAGGACGG + Intronic
1019889275 7:3933005-3933027 GGCAGCTGGTGCCACCGTGCTGG + Intronic
1020278584 7:6638396-6638418 GGCAGCGGGGGCCACCCAGAGGG + Intronic
1023043767 7:36194477-36194499 GGCAGGAGGAGGAACCAGGATGG - Intronic
1023815172 7:43943920-43943942 GGCAGCAGGAGCCAGGGTGGTGG + Intronic
1023984588 7:45087491-45087513 GAGAGCAGGAGCCACCAGGCAGG - Intronic
1024241564 7:47440072-47440094 GGCACGAGGGGGCACCGGGAGGG + Intronic
1024803483 7:53108444-53108466 GGCAGGAGGAGGCACCGGGCAGG + Intergenic
1025014708 7:55429960-55429982 GGCTGGAGGAGCCACTGGGAGGG + Intronic
1026205237 7:68251619-68251641 GGGAGCTGGAGACACCGAGAAGG - Intergenic
1027124638 7:75547638-75547660 AGCAGTAGCAGCCACGGGGAAGG - Intronic
1029458435 7:100682559-100682581 GGCACCTGGAGGCTCCGGGATGG - Intronic
1029508991 7:100981474-100981496 GGCTGCAGGAGCCAGAGAGAAGG + Intronic
1030201792 7:106913396-106913418 TGGAGCAGGAGCCACTGGTACGG - Intergenic
1030246289 7:107387322-107387344 GGCAGGAGGTGCAAACGGGAAGG + Intronic
1031023394 7:116652620-116652642 GGGAGCAGAAGCCACTGAGAAGG + Intergenic
1032465425 7:132141431-132141453 GGCAGGAGGTGCCAACTGGAGGG - Intronic
1034074875 7:148222006-148222028 GGCAGCTGGAGTCACTGGGCAGG - Intronic
1034455378 7:151167376-151167398 GGCAGCACGAGCGGCCGGTAGGG + Exonic
1034556895 7:151855758-151855780 GGCGGCAGGAACCACAGGGATGG + Intronic
1034895900 7:154876116-154876138 GGAAGCAGGAGAGGCCGGGAGGG + Intronic
1035171640 7:157020737-157020759 GCCTGCGGGAGCCCCCGGGAGGG - Intergenic
1036134823 8:6151192-6151214 GGATTCAGGAGCCACCAGGAAGG + Intergenic
1036202401 8:6780350-6780372 GGCAGGAGCAGAAACCGGGAAGG - Intergenic
1036774001 8:11597643-11597665 GGCAGGGGGAGGCCCCGGGATGG - Intergenic
1037808297 8:22070385-22070407 TGCAGCAAGAGCCAAGGGGAGGG - Intronic
1039273254 8:35906550-35906572 GGCGGCAGGAGCCACAGAGCCGG - Intergenic
1039477094 8:37844763-37844785 GAGAGAAGGAGCCACCGGGGTGG - Exonic
1041464753 8:58146738-58146760 GGCCGCAGGAGCCCGCAGGAGGG + Exonic
1043502908 8:80874155-80874177 GGCTGCAGGAGCCGCCGGCCAGG + Intronic
1044810158 8:96052516-96052538 GGCAGCAGGAGAAAATGGGAAGG + Intergenic
1047429536 8:124779125-124779147 AGCAGCTGGAGCCACAGGCATGG - Intergenic
1047471749 8:125181049-125181071 GGCAGCAGGAGCATCAGGAAAGG + Intronic
1048999810 8:139817604-139817626 GGCAGCAGGCGCCACGTGGCTGG + Intronic
1049203881 8:141354442-141354464 GGAGGCAGGGGCCAGCGGGAAGG - Intergenic
1049204914 8:141359196-141359218 TACAGCAGGGGCCACCAGGAGGG - Intronic
1049229943 8:141476788-141476810 GGCCCCGGGAGCCACGGGGAAGG - Intergenic
1049595912 8:143483330-143483352 AGCACCAGGAGAAACCGGGAGGG - Intronic
1049746574 8:144265660-144265682 TGCAACAGTAGCCACGGGGAGGG + Intronic
1049792518 8:144478443-144478465 GGCAGCAGGTGCCAACGGTCAGG + Intronic
1049819897 8:144627155-144627177 GGCAGCTGCAGACACTGGGATGG - Intergenic
1050923374 9:11233984-11234006 GGCAAAAGGAGCCACTGGGCTGG + Intergenic
1051513721 9:17906880-17906902 GGCACCAGGTGCCACCGAGGAGG - Intergenic
1051613417 9:18983277-18983299 GGCAGCAGGAGACAGAGCGAGGG + Intronic
1052854465 9:33398476-33398498 GGCAGCCTGAGCCACAGAGATGG + Intronic
1053058647 9:35010554-35010576 GTCATCAGGAGCCATCGAGAAGG + Intergenic
1053413875 9:37933981-37934003 GGCAGCAGAAGCGACCAGGATGG - Intronic
1053682471 9:40494637-40494659 GGCAGCCTGAGCCACAAGGATGG + Intergenic
1053932452 9:43122963-43122985 GGCAGCCTGAGCCACAGAGATGG + Intergenic
1054281243 9:63130292-63130314 GGCAGCCTGAGCCACAAGGATGG - Intergenic
1054295569 9:63330137-63330159 GGCAGCCTGAGCCACAGAGATGG + Intergenic
1057176281 9:93002771-93002793 GGCAGGAGGGGCCACTGTGATGG - Intronic
1058511664 9:105725268-105725290 GGGAGGAGGAGCCAAGGGGAGGG - Intronic
1058908576 9:109499975-109499997 GGAAGGAGGAGCCCCCTGGAGGG + Intergenic
1059246403 9:112853261-112853283 GGCAGGAGGAACCAGAGGGAGGG - Intronic
1059457886 9:114411336-114411358 GTCAGCAGGAGGCACAGAGAGGG + Intronic
1060187952 9:121575296-121575318 GACAGCAGCAGCCACCGCGCAGG + Intronic
1060268627 9:122126547-122126569 GGGAGAAAGAGACACCGGGAGGG + Intergenic
1060402175 9:123355588-123355610 GACAGCAGGAGACACTGAGAAGG + Intergenic
1061201177 9:129139375-129139397 GGCAGCAGAAGGAACAGGGAGGG + Intronic
1061725008 9:132577442-132577464 GGGAGGAGGAGCCAATGGGAAGG + Intergenic
1203784497 EBV:119901-119923 GACGGCAGCAGCCGCCGGGACGG + Intergenic
1203371751 Un_KI270442v1:313354-313376 GACAGCAGGAGCAACAAGGAGGG - Intergenic
1203375441 Un_KI270442v1:371844-371866 GACAGCAGGAGCAACAAGGAGGG - Intergenic
1187827454 X:23346280-23346302 TTCAGCAGGAGCCACTGAGATGG + Intronic
1188522080 X:31049978-31050000 AGCAGCAGGAGCTGCCTGGAAGG + Intergenic
1189489345 X:41457555-41457577 GGGAGCAGGAGCCAAGGGCAAGG - Intronic
1189893918 X:45633588-45633610 GGCAGCAGCAGCTTCCGGGATGG - Intergenic
1189927675 X:45973575-45973597 GGCAGCAAGATCAACTGGGATGG - Intergenic
1192568243 X:72181375-72181397 CGCAGTAGGAGCCACGGGGGTGG - Intronic
1196721656 X:118859957-118859979 GGCAGCATCAGCCTCCGGGGAGG - Intergenic
1196776340 X:119341331-119341353 GGCAGCAGGAGGCACTACGATGG - Intergenic
1197048746 X:122032293-122032315 GGCAGTAGCAGCAACCTGGATGG - Intergenic
1197206860 X:123798322-123798344 GGGAGCAGGGGACAGCGGGAGGG - Intergenic
1197209279 X:123815889-123815911 GGGAGCAGGGGACAGCGGGAGGG + Intergenic
1200111174 X:153741664-153741686 GGCAGCAGGAGCAAGAGGCAGGG - Intronic
1201284688 Y:12369009-12369031 GGCAGCAGGGGCAGCCGGGAGGG + Intergenic
1201761364 Y:17542751-17542773 GACAGCAGGAGCAACAAGGAGGG - Intergenic
1201840188 Y:18363239-18363261 GACAGCAGGAGCAACAAGGAGGG + Intergenic