ID: 1183618673

View in Genome Browser
Species Human (GRCh38)
Location 22:38960148-38960170
Sequence CCCAGCTCCTCCCCAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 416}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183618673_1183618685 10 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618685 22:38960181-38960203 CTGAGGGGCCCTGAGCCCGGGGG 0: 1
1: 0
2: 2
3: 44
4: 305
1183618673_1183618678 -6 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618678 22:38960165-38960187 GCTGGGCCAGGCCAGGCTGAGGG 0: 1
1: 3
2: 14
3: 83
4: 661
1183618673_1183618688 24 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618688 22:38960195-38960217 GCCCGGGGGACTTTCTTCCCTGG 0: 1
1: 0
2: 2
3: 6
4: 133
1183618673_1183618677 -7 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618677 22:38960164-38960186 AGCTGGGCCAGGCCAGGCTGAGG 0: 1
1: 4
2: 17
3: 128
4: 817
1183618673_1183618679 -5 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618679 22:38960166-38960188 CTGGGCCAGGCCAGGCTGAGGGG 0: 1
1: 1
2: 9
3: 104
4: 803
1183618673_1183618682 7 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618682 22:38960178-38960200 AGGCTGAGGGGCCCTGAGCCCGG 0: 1
1: 1
2: 2
3: 70
4: 575
1183618673_1183618684 9 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618684 22:38960180-38960202 GCTGAGGGGCCCTGAGCCCGGGG 0: 1
1: 2
2: 2
3: 41
4: 436
1183618673_1183618683 8 Left 1183618673 22:38960148-38960170 CCAGCATTTGGGGAGGAGCTGGG 0: 1
1: 0
2: 1
3: 58
4: 416
Right 1183618683 22:38960179-38960201 GGCTGAGGGGCCCTGAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183618673 Original CRISPR CCCAGCTCCTCCCCAAATGC TGG (reversed) Intronic
900344241 1:2203557-2203579 CCCAGCTCCACCCCAGGTGAGGG - Intronic
901317820 1:8320879-8320901 CCCAGCCTCTCCCCACCTGCAGG - Intronic
901360549 1:8695498-8695520 CCCTGGGCCTCCCAAAATGCTGG - Intronic
901449291 1:9326258-9326280 CCCAGCACCACCCCAAGGGCTGG + Intronic
902315893 1:15617939-15617961 CCCAGCTCCTTTCCGGATGCGGG - Intronic
902729848 1:18362249-18362271 CCCAGCTCCTTCCTATCTGCCGG + Intronic
903305997 1:22413756-22413778 CTCAGGCCCTCCCCAAAGGCTGG + Intergenic
904477516 1:30774705-30774727 CCAAGATCCTCCCCAGAGGCCGG - Intergenic
904540295 1:31228244-31228266 CCCACCTCCTCCCAAAAAACAGG + Intronic
905049666 1:35039194-35039216 CCCAGCTACTCAGCAAATGGAGG + Intergenic
905397356 1:37675397-37675419 CCCAGCTCCTCCATAAGAGCAGG + Intergenic
905446095 1:38029312-38029334 CCCAGCTCCTCCGCTAATGAAGG - Intergenic
905685838 1:39907353-39907375 GCCTGGGCCTCCCCAAATGCTGG + Intergenic
905880727 1:41461833-41461855 GCCTCCTCCTCCCAAAATGCTGG + Intergenic
906505420 1:46375482-46375504 GCCTCCACCTCCCCAAATGCTGG - Intergenic
906510422 1:46407514-46407536 CCCAGCTCATCCCCTACTGCGGG + Intronic
906791172 1:48659810-48659832 GCTAGCTCCTCCCCTACTGCTGG + Intronic
909386806 1:75067605-75067627 CCCTGCTCATCCCCAGAGGCTGG + Intergenic
910008904 1:82436235-82436257 CCCACCTCCTACCCAAAGACTGG - Intergenic
911722552 1:101207202-101207224 GCCTGGGCCTCCCCAAATGCTGG + Intergenic
912069121 1:105786069-105786091 ATCAGCTCCTCTCTAAATGCTGG + Intergenic
912444387 1:109723826-109723848 CCCTCCACCTCCCAAAATGCTGG + Intronic
913320536 1:117585377-117585399 AGCAACTCCTCCCCAACTGCAGG - Intergenic
913578903 1:120206621-120206643 CCCACCTCCTCCCAAAGTGCTGG + Intergenic
913629270 1:120691748-120691770 CCCACCTCCTCCCAAAGTGCTGG - Intergenic
914215803 1:145626832-145626854 CCCAGCTACTCCCCGGAGGCCGG + Intronic
914467748 1:147947217-147947239 CCCAGCTACTCCCCGGAGGCCGG + Intronic
914560832 1:148818061-148818083 CCCGCCTCCTCCCAAAGTGCTGG + Intronic
914612002 1:149312154-149312176 CCCACCTCCTCCCAAAGTGCTGG - Intergenic
914694024 1:150059305-150059327 CCCCCCGCCTCCCAAAATGCTGG + Intergenic
914824597 1:151132238-151132260 GCCAGCTCCCCCTGAAATGCTGG + Exonic
917224552 1:172767597-172767619 GTCAGCTCATCCCCAGATGCTGG - Intergenic
917748416 1:178033200-178033222 CCCTCCTCCTCTCCATATGCAGG + Intergenic
919907142 1:202085800-202085822 GCCAGCCCTTCCCCAAATGTAGG - Intergenic
919931778 1:202225803-202225825 ACCAGCCCCTCCCCAAGTCCTGG + Intronic
920000943 1:202798382-202798404 ACCTGCACCTCCCCAAGTGCTGG + Intronic
920071004 1:203303220-203303242 ACCGGCTTCTCCCCAAATGCTGG - Intergenic
920746337 1:208632539-208632561 GCCTGAGCCTCCCCAAATGCTGG + Intergenic
923255684 1:232219491-232219513 CCCAGCTCCTCCCAGGGTGCTGG + Intergenic
924209059 1:241746081-241746103 CCCAGCTCCTACCACAGTGCTGG + Intronic
1063979303 10:11440910-11440932 CCCACCTCCTCCCGAGATGTGGG - Intergenic
1065073215 10:22049190-22049212 CCCAGCCCCTACCCAAAAACTGG + Intergenic
1065213980 10:23432182-23432204 CTCTCATCCTCCCCAAATGCTGG + Intergenic
1066975916 10:42367669-42367691 CCCAGCTCGGCCACAAATGTCGG - Intergenic
1067464745 10:46489410-46489432 ACCATCTCCTCCCCAATGGCCGG + Intergenic
1067578516 10:47423605-47423627 CCAGGCTCCTCCTCCAATGCTGG + Intergenic
1067622449 10:47895243-47895265 ACCATCTCCTCCCCAATGGCCGG - Intergenic
1069629468 10:69889017-69889039 CCCAGTTACTCCCCAACTGCAGG + Intronic
1069851375 10:71407381-71407403 CACATCCCCTGCCCAAATGCTGG - Intronic
1070194729 10:74146807-74146829 CCCACCTCCTACTCAAATGTTGG - Intronic
1070789038 10:79178826-79178848 CCCAGCCCCTCTCCAAGGGCAGG - Intronic
1071474783 10:86016800-86016822 CCCAGCTGCTCACCATTTGCGGG - Intronic
1072546131 10:96440977-96440999 CTGAGCTCCTCTTCAAATGCAGG - Intronic
1072743099 10:97922143-97922165 CCCAGCTCCACCCCACACTCTGG + Intronic
1073288669 10:102402793-102402815 ACCAGCTCAGCCCCAAATCCTGG + Exonic
1076197453 10:128529577-128529599 CCCATCTCCTCGCCAGAGGCAGG + Intergenic
1076711264 10:132336103-132336125 CCCAGCACCTCTGGAAATGCAGG - Intronic
1077184440 11:1229957-1229979 CCCACCTCCTCCCGACATGCCGG + Intronic
1077556580 11:3228905-3228927 CCCTGCTCCTCCCCACATCAGGG + Intronic
1078296571 11:10076919-10076941 CCAAGCTCTTCCTCAGATGCAGG - Intronic
1078568982 11:12441158-12441180 CCCACCTCCACCCCCAAGGCTGG - Intronic
1078876980 11:15408978-15409000 CTCATCTCCTCCCCAAACCCAGG + Intergenic
1080478799 11:32624085-32624107 CCCACAGCCTCCCAAAATGCTGG - Intronic
1080748235 11:35128134-35128156 CCTACCTCCTCCCCAACTGCTGG - Intergenic
1083470956 11:62883648-62883670 CCGGGGTCCTACCCAAATGCTGG - Intronic
1083802378 11:65053961-65053983 CCAAGCTCCTTCCCAAATCAGGG - Intronic
1083983302 11:66192229-66192251 CCCAACATCTGCCCAAATGCTGG - Intronic
1085341866 11:75736781-75736803 CCTAGGGCATCCCCAAATGCAGG - Intergenic
1085517118 11:77118135-77118157 CTCAGCCCCTCCCCACATCCAGG + Exonic
1085523229 11:77150173-77150195 CCCAGCTCCTCCCCTGAGACGGG - Intronic
1088882215 11:113981186-113981208 CCCTGCTCCTCCCCTAGTACTGG + Exonic
1089290624 11:117435942-117435964 CCCCTCTGCTCCCCAAATTCTGG + Intronic
1089395790 11:118135862-118135884 CCCTGCTCCTCCCCAACCCCAGG + Exonic
1089561088 11:119343573-119343595 CCCAGTTCCTCCCCACCGGCAGG - Intronic
1089897322 11:121943892-121943914 CCCAGGTGCTGCCCACATGCTGG + Intergenic
1089948957 11:122507877-122507899 CCCATCGCCTCCCAAAGTGCTGG - Intergenic
1090352511 11:126116290-126116312 CCCAGCTCATCCCCACACCCAGG - Intergenic
1091286512 11:134411536-134411558 ACCAGCTCTTCCCCTAATCCCGG + Intronic
1092262893 12:6961968-6961990 CCCAGCTCCTCCCCTCATCCAGG + Intergenic
1092283266 12:7113573-7113595 GCAAGCTCCTCTCTAAATGCTGG - Intergenic
1092577816 12:9808565-9808587 CCCGCATCCTCCCCAAAAGCAGG + Intergenic
1092630839 12:10374626-10374648 CTCAGGTCCTCCCAAAGTGCTGG + Intronic
1092968140 12:13665357-13665379 TCCAGCTCCACCCCAGATGCTGG + Intronic
1094718402 12:33035217-33035239 CCCAGCTCCCACGCAAATGGAGG + Intergenic
1095800603 12:46267724-46267746 CCCACCTCCTCCCCAACCCCCGG - Intronic
1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG + Intronic
1097300648 12:58015081-58015103 CCCAGCTGGTCCCCAATTCCTGG + Intergenic
1097587277 12:61530000-61530022 CCCAGCCCCTCCCAAATTTCAGG + Intergenic
1098141194 12:67451595-67451617 CCCACCTCCACCCCAAGTGCTGG + Intergenic
1102013525 12:109633250-109633272 ACCAGCACCTCCCAAAGTGCTGG - Intergenic
1102378197 12:112440823-112440845 CTCAGCTCTTCCCAAAGTGCTGG + Intronic
1102536738 12:113587249-113587271 TCCAACCCCTCCCCAACTGCTGG - Intergenic
1103700485 12:122846637-122846659 CGCAGCTCCTCCCCGACTACAGG + Intronic
1103961644 12:124612639-124612661 CCCAGCCCCTCCCCAAGCCCAGG + Intergenic
1104031690 12:125069400-125069422 ACCAGAGCCTCCCAAAATGCAGG - Intronic
1104603627 12:130171036-130171058 CCCATCTCCTTCCCAGATGCTGG + Intergenic
1104797681 12:131530872-131530894 CTCACCTCCTCCCAAAGTGCTGG - Intergenic
1104925154 12:132310178-132310200 CCCAGCTCCTCCCCTCCTGCTGG - Intronic
1107640641 13:42439871-42439893 CTCAGCTCCTCTCCACATGGGGG - Intergenic
1109513523 13:63410122-63410144 CCCAGCTACTCCAGAAGTGCAGG + Intergenic
1113382596 13:109817513-109817535 CCCACCTCCACCCCCAATTCAGG - Intergenic
1114271633 14:21103807-21103829 CCCGGCTCCTCCCCGAACGCGGG - Intronic
1114549465 14:23524708-23524730 CTCAGCTCCTCCCCATCTGGAGG + Exonic
1114898461 14:27025421-27025443 CCCTCGTCCTCCCCAAATGCTGG + Intergenic
1117084994 14:52191040-52191062 CCCCCCTCCTCCCAAAGTGCTGG - Intergenic
1117650945 14:57904799-57904821 CCCAGCACCAACCCAGATGCTGG + Intronic
1118323805 14:64768517-64768539 CACAGCTCCTCCCTGAATGGTGG + Intronic
1118567814 14:67161510-67161532 CCCACGGCCTCCCAAAATGCTGG - Intronic
1118820679 14:69343697-69343719 CCCAGCTCCTGCCCTAGGGCTGG - Intronic
1121049503 14:90811305-90811327 CCCAACTCCTCCCAGAATGTGGG - Intronic
1121318645 14:92977540-92977562 ACCAGGTCCTCCCCCGATGCTGG - Intronic
1121809267 14:96866608-96866630 CCCAGTGACTCCCCAAAAGCAGG - Intronic
1122728779 14:103779510-103779532 CCCAGCACCTCCCAAAGTGCTGG - Intronic
1122742623 14:103880962-103880984 GCCAGCTGCCCCCGAAATGCTGG - Intergenic
1122848749 14:104515283-104515305 CCCAGTTCCTACCCAGCTGCCGG - Intronic
1122923299 14:104888775-104888797 CACAGCCCCACCCCAACTGCTGG + Intronic
1123071951 14:105646341-105646363 CCCAGCTCCTGCCAAAATCTAGG + Intergenic
1123996189 15:25719507-25719529 CCCAGCCCCTCACCTCATGCTGG - Intronic
1124495832 15:30186299-30186321 CCCAGCCCCTCCCCAATCTCAGG + Intergenic
1124747742 15:32352348-32352370 CCCAGCCCCTCCCCAATCTCAGG - Intergenic
1125180896 15:36880283-36880305 CCCACCTGCTACCCAAATCCCGG - Intergenic
1125581530 15:40789225-40789247 GCCTGCTTCTCCCCAAATGATGG + Intronic
1127585352 15:60372902-60372924 CCCAGGCCCTCCCAAAGTGCTGG + Intronic
1127829507 15:62737949-62737971 CCCACCTGCTCCCCAAAGCCAGG - Intronic
1127960617 15:63887771-63887793 CCCAGCTCCTCTTCCAGTGCTGG + Intergenic
1128413653 15:67423651-67423673 GCCTGCGCCTCCCAAAATGCTGG - Intronic
1128874773 15:71193119-71193141 CCCAGCTCCTGATCAAAAGCAGG - Intronic
1129066403 15:72907987-72908009 CCCAGCTCCTCCCCACAAACTGG - Intergenic
1129373675 15:75114101-75114123 ACCTTCGCCTCCCCAAATGCTGG + Intronic
1129682637 15:77666461-77666483 CCCAGCCCCTCACCCAGTGCCGG - Intronic
1132055669 15:98648962-98648984 GCGAGCTCCTTCCCAAATCCAGG - Exonic
1132604687 16:788790-788812 CGCAGCTCCTCCCCAACGGCCGG - Intronic
1132745321 16:1433943-1433965 GCCGTCTCCTCCCCAGATGCCGG + Intergenic
1132897758 16:2237022-2237044 CGCCGCTCCTCCCCAGATCCTGG + Exonic
1132948384 16:2545884-2545906 ACCTGCTCCTCCCAAAATGCTGG + Intronic
1133538284 16:6723047-6723069 CCCATCCCCTCCCCAAAGCCTGG - Intronic
1133855412 16:9544821-9544843 CCCAGCTCTGCCACAAATACGGG + Intergenic
1134068332 16:11244681-11244703 CCCAGCCCCTCCCTAAGTGCAGG - Intergenic
1135718818 16:24796666-24796688 CACAACTTCCCCCCAAATGCAGG - Intronic
1136084763 16:27877045-27877067 CCCAGCTCCTCCAAAAATTGAGG - Intronic
1136181436 16:28555105-28555127 ACCAAAGCCTCCCCAAATGCTGG + Intronic
1139428630 16:66899312-66899334 TCCACCTGCTCCCCAAAGGCCGG + Intergenic
1139949786 16:70663274-70663296 CTCAGCTCCTCCTGGAATGCTGG - Exonic
1140591841 16:76362972-76362994 TCCTCCTCCTCCCAAAATGCTGG - Intronic
1141262628 16:82467710-82467732 GCCTGATCCTCCCAAAATGCTGG + Intergenic
1141725388 16:85784758-85784780 CCAAGTTCCTCAGCAAATGCAGG - Intronic
1141927047 16:87176926-87176948 CCCACCGCCTCCCCCAATGGAGG + Intronic
1142156946 16:88536908-88536930 CCCAAGTCCTCCCCAGGTGCGGG + Exonic
1142171648 16:88625568-88625590 GCCGGCTCCTCCCCAGGTGCAGG - Intronic
1142263226 16:89052100-89052122 CCCAGATGGTCCCCAAATGTTGG - Intergenic
1142696148 17:1634969-1634991 CCCAACTCAGCCCCAAAAGCTGG - Exonic
1143199072 17:5099466-5099488 CCCAGGTCCTTCCCACATTCAGG - Intergenic
1143595035 17:7909082-7909104 CCCAGCCCCTCACCCACTGCTGG + Intronic
1143614717 17:8042875-8042897 CCAAGCTCCTCACCAGCTGCTGG - Exonic
1144250419 17:13410979-13411001 CCCTGCTCTTCCCCAGCTGCTGG + Intergenic
1144440542 17:15277276-15277298 GCCTGCTCCTCCCAAAGTGCTGG + Intergenic
1144624742 17:16838935-16838957 CCCAGCTCCTCCCCCACCTCAGG - Intergenic
1144730978 17:17526186-17526208 CAGGTCTCCTCCCCAAATGCCGG + Intronic
1144881688 17:18433786-18433808 CCCAGCTCCTCCCCCACCTCAGG + Intergenic
1144952205 17:19000380-19000402 CCCAGCTCCTCTCCAAGCCCCGG - Intronic
1145150545 17:20510600-20510622 CCCAGCTCCTCCCCCACCTCAGG - Intergenic
1146269814 17:31477386-31477408 CCCAGCTTCTCCCCAAGCCCAGG - Intronic
1147235501 17:39054570-39054592 CCCCCCTCCTCCCAAAGTGCTGG - Intergenic
1148789536 17:50165750-50165772 CCCAGCTCATCCCCAGTTGGTGG - Intronic
1149764935 17:59267914-59267936 CCCACCTCCTCCCAAAGTGCTGG + Intronic
1150283025 17:63940419-63940441 GCCAGCTCCTCCTCAAGTGAGGG + Exonic
1150642431 17:66958613-66958635 CCCAGCACCTGCCCTAATGCTGG - Intergenic
1151228108 17:72661648-72661670 CCCAGCCCCTTCCCACCTGCAGG - Intronic
1152145190 17:78564180-78564202 CCCAGCTCCCTCCCCACTGCCGG + Intronic
1152157771 17:78646140-78646162 CCCAGCTGCTCCTCAGTTGCAGG + Intergenic
1152489799 17:80622649-80622671 CCCAGGGCCTCCCAAAGTGCTGG - Intronic
1152796680 17:82310999-82311021 CCCAGGGGCTCCCCACATGCGGG + Intergenic
1152863612 17:82709689-82709711 CCCAGCTCCTCCGGCCATGCAGG - Intergenic
1153147772 18:2053023-2053045 CCCGCCTCCTCCCAAAGTGCTGG - Intergenic
1153235297 18:2980453-2980475 CTCAGCCCCACCCCAAATCCTGG + Intronic
1153302997 18:3608074-3608096 CCCGCATCCTCCCAAAATGCTGG - Intronic
1153626976 18:7030836-7030858 CCCCACCCCACCCCAAATGCTGG + Intronic
1153965925 18:10182055-10182077 CCTAGCTCCACCCCACCTGCTGG - Intergenic
1153974788 18:10259223-10259245 CCCAGCTCCTCCGGCAATACTGG - Intergenic
1155041877 18:22071640-22071662 CCCAGAACTTCACCAAATGCAGG + Intergenic
1156373808 18:36494621-36494643 CCCAGCTTCTCCCCAGCTGCTGG + Intronic
1157851936 18:51062746-51062768 CCCATCGGCTCCCAAAATGCTGG + Intronic
1158213217 18:55073069-55073091 CCAAGGTCCTTCCCAACTGCTGG + Intergenic
1158847811 18:61463254-61463276 CCCAGCTCCTCACCCCATCCCGG + Intronic
1159434048 18:68392924-68392946 GCCTGGTCCTCCCAAAATGCTGG + Intergenic
1160265654 18:77339349-77339371 CCCAGCTCCTTCACAAGTGGGGG + Intergenic
1160865975 19:1256077-1256099 CCCAGCTACTCCCAAACGGCGGG + Intronic
1161537915 19:4831392-4831414 CCCAGATCCTCCCCCACTGTCGG - Intronic
1162598695 19:11649933-11649955 CCCACCTCATCCCTAAGTGCTGG + Intergenic
1162720338 19:12658208-12658230 CCCGGCTCCTACCCACCTGCAGG + Exonic
1163135441 19:15307863-15307885 GCCAGGGCCTCCCAAAATGCTGG - Intronic
1163149839 19:15404651-15404673 CACAGTTCCTCCCCAAAGGAGGG + Intronic
1163155353 19:15437182-15437204 CCCAACCCCTCCCCATATTCAGG + Intronic
1163641769 19:18466196-18466218 CTCAGCACCTGCCCAGATGCAGG + Intronic
1164144808 19:22505395-22505417 CCCACCTTCTCCCCAGGTGCAGG + Intronic
1164574465 19:29397676-29397698 CCCAGCTCCTCCCCATCTGGAGG + Intergenic
1165005328 19:32800943-32800965 CCTGGCTCCTCCCCAGATCCAGG - Intronic
1165062235 19:33210611-33210633 CCCAGGTCCTCTCCCAGTGCGGG - Exonic
1165555657 19:36629685-36629707 CCCAACACCTCCCAAAGTGCTGG - Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166292088 19:41869760-41869782 CCCAGCCCCACCCCAAACGCAGG - Intronic
1166503703 19:43358759-43358781 CCCTCCTCTTCCCCAAATCCAGG - Intronic
1166506751 19:43375999-43376021 CCCTCCTCTTCCCCAAATCCAGG + Intergenic
1166769028 19:45269478-45269500 CCCAGCTCCTGCCCCAATAAAGG - Intronic
1166855570 19:45781309-45781331 CCCACCTCCTCCCCAAGCCCAGG - Intronic
1167121788 19:47521551-47521573 CTCAGCTCCAGCCCAAATGCAGG - Exonic
1168044208 19:53782419-53782441 CCCTTCACCTCCCAAAATGCTGG + Intergenic
1168112339 19:54200492-54200514 CCCACCTCCTCCCCAGTAGCTGG - Intergenic
925293363 2:2762820-2762842 CCCACCTCCTACCCAGATCCAGG + Intergenic
925918717 2:8625029-8625051 CCCAACTTCTCCCCAGAGGCTGG + Intergenic
925918915 2:8626032-8626054 CCCAGCTCCTTTCCAGAAGCTGG + Intergenic
926310048 2:11668846-11668868 CTCACCTCCTCCCCAACTCCAGG - Intronic
926691125 2:15734560-15734582 CGCAGCTTCTCCCCACAAGCAGG + Intronic
926759188 2:16262233-16262255 CCCTGCTCCTCCCCAAGGCCAGG - Intergenic
926908557 2:17828576-17828598 ACCAGCTCCTCCCCAAAGCCAGG - Intergenic
928400787 2:30977338-30977360 ACCAGGTCCTCCCAAAGTGCTGG + Intronic
929625600 2:43403615-43403637 CCCAGTTCCTCCCCATTTCCTGG + Intronic
929857038 2:45646220-45646242 CCCAGGGCCTCCCAAAATGCTGG + Intergenic
930726962 2:54692034-54692056 CCCAGCTCCAGCCAAATTGCCGG - Intergenic
931666198 2:64610987-64611009 CCCACCTCCTTCCAAAGTGCTGG - Intergenic
932836329 2:75041423-75041445 CCCAGCTCCTAACCACATGCTGG + Intergenic
933785587 2:85838692-85838714 CCCTCCTCCTCACCATATGCAGG - Intergenic
934692457 2:96372194-96372216 CCCAGCTCTTCCCCAACCCCAGG - Intronic
934749948 2:96787606-96787628 ACCATGGCCTCCCCAAATGCTGG - Intronic
935259737 2:101344042-101344064 CCCGGCTCCTGCCCACATCCAGG + Intergenic
936408868 2:112235996-112236018 CCCACCACCTCCCTAAGTGCTGG - Intronic
936521708 2:113215750-113215772 CCCAACACCACCCCAAATGCCGG + Intergenic
937403256 2:121604417-121604439 GCCTCCTCCTCCCAAAATGCCGG - Intronic
937649411 2:124303199-124303221 CCTCCCTCCTCCCCATATGCTGG - Intronic
938058170 2:128232735-128232757 CACAGCGCCTCCCAAAGTGCTGG + Intergenic
938378767 2:130825193-130825215 CTCACCTCCTCCCCACAGGCAGG + Intergenic
938380199 2:130832154-130832176 CCCTTCTCCTCCTCAAATCCTGG + Intergenic
939045012 2:137239679-137239701 CCCAACTCCTCCCAGAATGTTGG + Intronic
939782788 2:146469908-146469930 CCCAGCTTCTCCCCATCTGCTGG + Intergenic
940317038 2:152336320-152336342 CCCTGCTCCTCGCCAAGGGCCGG - Intronic
940896261 2:159084292-159084314 CCTAGCTCCCCCCCCAATACAGG + Intronic
941543443 2:166815716-166815738 CCCATCTCCTCCCAGAATGTTGG - Intergenic
942393061 2:175516507-175516529 CCCAGCTCCTCCAGTAATGGAGG - Intergenic
943334683 2:186599617-186599639 CCCAGCTCCACCCCCAAAGTTGG + Intronic
943736330 2:191359591-191359613 CTAAACTCCTCCACAAATGCTGG + Intronic
945248913 2:207746728-207746750 ACCAGATCCTCCCAAAATGTTGG - Intronic
945470630 2:210224830-210224852 ACCACCTCCTCCCAAAACGCAGG + Intronic
945682745 2:212933716-212933738 CTCAGATGCTCCCCAAATCCTGG + Intergenic
945884792 2:215363692-215363714 CCCAGCAACTCCCCAAATCCTGG - Intronic
945969659 2:216223227-216223249 CCTAGCTTTTCCCCAAATGCAGG + Intergenic
947865631 2:233396598-233396620 CCCAGCCCCTCCCCAAGGCCAGG - Intronic
948460349 2:238127347-238127369 CCCAGCTCCTCCCCTGCTGCAGG + Intronic
948653101 2:239461298-239461320 CCCAGCTCCTCCCCAAGCTTTGG - Intergenic
948754694 2:240152006-240152028 CCCCCATCCTCCCTAAATGCAGG - Intergenic
948832501 2:240605070-240605092 CCCATCTCTTACACAAATGCTGG + Intronic
1168878576 20:1186882-1186904 CCCAGCTCCACCCCCACAGCTGG + Intronic
1171999004 20:31757155-31757177 CCTCCCTCCTCCCAAAATGCTGG + Intronic
1172027340 20:31957560-31957582 CCCTCATCCTCCCAAAATGCTGG - Intergenic
1172190486 20:33059427-33059449 CTCAGCTGCACCCCAAATCCCGG - Exonic
1172697436 20:36832300-36832322 GCCAGCTCCTCTCCACCTGCGGG + Intronic
1172961838 20:38805647-38805669 CTCGGCTCCTCCCCCAAGGCGGG - Intergenic
1173226648 20:41166116-41166138 CCAAGTTCCACCCCAAATGAGGG - Intronic
1173647840 20:44644590-44644612 CCCAGCTCATCACCAAAAGCAGG - Intronic
1173791411 20:45830083-45830105 GCCTGCACCTCCCAAAATGCTGG - Intronic
1174283800 20:49458010-49458032 CCCTGCTCCACCACTAATGCCGG - Intronic
1174470100 20:50751948-50751970 CCCATCTCCTCCCAAAGTGCTGG + Exonic
1175070546 20:56329953-56329975 CCCAGGTCCTGCTGAAATGCAGG - Intergenic
1175401926 20:58705721-58705743 GCCAGCTCCTTCCCAATTGCAGG - Intronic
1175501666 20:59455264-59455286 CCTATCTCCTCCCCAATTGCGGG + Intergenic
1176076511 20:63250822-63250844 ACCAGCTCCTTCCCACGTGCTGG + Intronic
1176342605 21:5712902-5712924 CCCAGTTCCTCCCCAGCAGCTGG + Intergenic
1176474859 21:7145053-7145075 CCCAGTTCCTCCCCAGCAGCTGG + Intergenic
1176502222 21:7611554-7611576 CCCAGTTCCTCCCCAGCAGCTGG - Intergenic
1176536926 21:8110971-8110993 CCCAGTTCCTCCCCAGCAGCTGG + Intergenic
1177330397 21:19652636-19652658 GCCTTCTCCTCCCAAAATGCTGG - Intergenic
1177638483 21:23816065-23816087 CCCAGGACCTGCCCAAATCCAGG + Intergenic
1177739507 21:25136682-25136704 GCCAGGCCCTCCCCAAATCCAGG + Intergenic
1177942324 21:27425826-27425848 CCCAGCTGCTTCCCACGTGCTGG - Intergenic
1178009110 21:28262345-28262367 GCCTGCTCCTCCCAAAATGCTGG - Intergenic
1179034128 21:37745370-37745392 CCCTTGGCCTCCCCAAATGCTGG + Intronic
1180694603 22:17743767-17743789 CCCACCTCCTTCCCCAAAGCTGG - Intronic
1181751942 22:24994974-24994996 CACAGCTTCTGCACAAATGCAGG - Intronic
1181769258 22:25113502-25113524 CAGGGCTCCTCCCTAAATGCTGG - Intronic
1181897254 22:26121441-26121463 CCTAGCTCCTGCCCAAAGCCAGG + Intergenic
1182101348 22:27659782-27659804 CCCTGGTCCTCCCAAAGTGCTGG + Intergenic
1182317547 22:29458046-29458068 CCCAGCCACTGCCCAAAGGCTGG - Intergenic
1182361122 22:29747090-29747112 CCCATCCCCTCCCCAGAGGCAGG - Intronic
1182747387 22:32616185-32616207 CCCACCTCCTGCCCCCATGCAGG - Intronic
1182783850 22:32890322-32890344 ACCATAGCCTCCCCAAATGCTGG + Intronic
1183178614 22:36243469-36243491 CCCAGCACCAACCCAAAGGCTGG - Intergenic
1183618673 22:38960148-38960170 CCCAGCTCCTCCCCAAATGCTGG - Intronic
1183623872 22:38990071-38990093 CCCAGTTCTTCCCCAACTGCTGG - Intronic
1183639573 22:39084792-39084814 CCCAGCTCTTCTTCAAATGCTGG - Intronic
1184272939 22:43395225-43395247 CCCAGCTCCTCCTGAATCGCAGG + Intergenic
1184602514 22:45552031-45552053 CCCAGCTCCACCCCTCATGTTGG + Intronic
1184725191 22:46340531-46340553 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184725197 22:46340562-46340584 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184725204 22:46340593-46340615 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184725211 22:46340624-46340646 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184725218 22:46340655-46340677 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184725225 22:46340686-46340708 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184725232 22:46340717-46340739 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184725239 22:46340748-46340770 CCCAGCTCCGCTCCTAATTCTGG - Intronic
1184951355 22:47844657-47844679 CCCAGATGCTCCCCAAGGGCCGG + Intergenic
1185052206 22:48559763-48559785 CCCCTCTGCTCCCCAAAGGCAGG - Intronic
1203241875 22_KI270733v1_random:27375-27397 CCCAGTTCCTCCCCAGCAGCTGG + Intergenic
949648858 3:6131358-6131380 GCCACCGCCTCCCAAAATGCTGG + Intergenic
950886369 3:16366308-16366330 CCCAACTCCTCCACAACAGCTGG + Intronic
952923151 3:38301066-38301088 CCCTCAGCCTCCCCAAATGCTGG + Intronic
952926331 3:38322669-38322691 CCCACCGCCTCCCAAAGTGCTGG - Intergenic
952969276 3:38640820-38640842 CCCAGCCCCACCCCCAAAGCAGG - Intronic
953131562 3:40144330-40144352 CCCAGCTCAACCCCAATGGCAGG + Intronic
953240811 3:41147917-41147939 CCAACTTCCTCCCCACATGCAGG + Intergenic
953400483 3:42610253-42610275 CCCACCGCCTCCCAAAGTGCTGG + Intronic
953531529 3:43744386-43744408 CCCTGCTCCGCCCCATAGGCTGG + Intergenic
954105845 3:48409555-48409577 CCCAGCTCCACCCCACCTGTTGG + Exonic
956218267 3:66872952-66872974 ACCACCGCCTCCCAAAATGCTGG - Intergenic
957348373 3:78991464-78991486 GTCATCCCCTCCCCAAATGCAGG + Intronic
957366377 3:79229666-79229688 TCAAACCCCTCCCCAAATGCTGG + Intronic
957749075 3:84388635-84388657 GCCTCCACCTCCCCAAATGCTGG + Intergenic
958526378 3:95265427-95265449 ATCAACTCCTCCTCAAATGCAGG - Intergenic
958754769 3:98237808-98237830 CTCAGCTCCTCCCATAGTGCTGG - Intergenic
958913930 3:100026511-100026533 TCCAGCTCCTCTCAAAATACTGG - Intronic
959193151 3:103141553-103141575 ACCAGTTGCTCCCCAAATCCAGG - Intergenic
960082598 3:113557055-113557077 CCCACCTCCTCCCAAAGTGCTGG + Intronic
960911932 3:122657930-122657952 GCCCACTCCTCCCAAAATGCTGG - Intergenic
961404524 3:126668765-126668787 CCCAGCTCCTCCCCACCTCAGGG - Intergenic
961465788 3:127080740-127080762 CTCAGCTCCTCCCTCAAAGCTGG - Intergenic
961810684 3:129519927-129519949 TCCACATCCTCCCCAAATCCTGG + Intronic
962009645 3:131381266-131381288 CCCAGCTCTTCCTCACCTGCCGG + Intergenic
963202838 3:142602228-142602250 CACAGCTCCACCCCAAAAGAGGG - Intronic
963917820 3:150875998-150876020 ACCAGCTACTCCCCAAAAGCAGG + Intronic
964108500 3:153064654-153064676 CCCGCCTCCTCCCAAAGTGCTGG + Intergenic
965345215 3:167540381-167540403 CCCAGCACCAGCCCAAAGGCTGG + Intronic
965682429 3:171265132-171265154 CCCGGGTACTCCCCAAATGTAGG + Intronic
967881794 3:194306705-194306727 CCCAGCATCCCCTCAAATGCTGG + Intergenic
968007197 3:195251178-195251200 CCCACCTCCACCCCACCTGCTGG + Intronic
968080107 3:195839953-195839975 CCCAGCTCCTCCCCAGGAGGAGG - Intergenic
969252102 4:5974673-5974695 CCCAGCTTCTCCTCAGATCCAGG + Intronic
969437738 4:7198490-7198512 CCAGCCTCCACCCCAAATGCTGG - Intronic
969686892 4:8680617-8680639 CCCATTTCCTCCCCAAAAGGAGG + Intergenic
971370699 4:26016507-26016529 CCCAACTCCTCCCCAAACTCAGG + Intergenic
974051143 4:56943145-56943167 CCCACGGCCTCCCAAAATGCTGG + Intergenic
976628168 4:87208585-87208607 CCCTGGGCCTCCCAAAATGCGGG + Intronic
978616653 4:110603580-110603602 CCCAGCTCCTCCCCCCTTTCTGG - Intergenic
980120295 4:128720940-128720962 CCCACCGCCTCCCAAAGTGCTGG + Intergenic
984865111 4:184274586-184274608 CCCAACTCCACCCCAAAGCCTGG + Intergenic
986132354 5:4943040-4943062 ACCAGCTCCTCCCGCAGTGCGGG - Intergenic
987266106 5:16256676-16256698 CCCTGCTTCTCCCCACATCCGGG - Intergenic
991063756 5:62404265-62404287 GCAAGCTCATCCCCAAATCCCGG - Intronic
992436829 5:76762665-76762687 CTGACCTCATCCCCAAATGCAGG + Intergenic
992627760 5:78649580-78649602 CCCAGCTCCGCCCCCAGGGCTGG + Intronic
993426062 5:87765391-87765413 TCCAGCTCATACCCAAATTCAGG + Intergenic
994006586 5:94844659-94844681 CCCAGCAGCTCCCCAACTGCTGG + Intronic
996294107 5:121890917-121890939 CACATCTCCTCCCCAAAGTCAGG + Intergenic
997858019 5:137390816-137390838 ACCAGCTACTCCCTAACTGCAGG - Intronic
999108792 5:149096866-149096888 GCCTGGGCCTCCCCAAATGCTGG - Intergenic
1000635272 5:163636912-163636934 CCAAGCGCCTCCACAAATGTTGG - Intergenic
1000998224 5:167980476-167980498 CCAAGCTCCTCCCCATGTCCAGG - Intronic
1002177437 5:177409258-177409280 CCCATCTCCCCCAGAAATGCAGG + Intronic
1004606765 6:17202189-17202211 CCCACCTCCTCCCAAAGTGCTGG + Intergenic
1005516346 6:26558166-26558188 CCCTCGTCCTCCCAAAATGCTGG + Intergenic
1005805980 6:29474976-29474998 CTCAGCTCCTCCACAAAGGCAGG - Intergenic
1005819460 6:29585680-29585702 CCCAGCTCCTAACACAATGCTGG + Intronic
1006077773 6:31545420-31545442 CCCAGGTCCACCCCAACTACCGG - Exonic
1006376284 6:33673355-33673377 CCCAGCTCCTGCCCCAGTGATGG - Intronic
1006441493 6:34056392-34056414 CCCAACTCCACCCCAGGTGCAGG + Intronic
1006768931 6:36535200-36535222 CCCGCCTCCTCCCAAAGTGCTGG - Intronic
1008654412 6:53596964-53596986 CACCTCTCCTCCCAAAATGCTGG + Intronic
1009820473 6:68793776-68793798 GCCTGCTCCTCCCAAAATACTGG + Intronic
1009897107 6:69765178-69765200 GCCAGGGCCTCCCCAAGTGCTGG + Intronic
1011099778 6:83708669-83708691 CCCGGCTCCTCTCCAAAGCCAGG - Intronic
1011624620 6:89272885-89272907 CTCAGCTCCCGCCCAAATGCAGG + Intronic
1013797442 6:113903580-113903602 GCCACCTCTTCCCCAAGTGCAGG + Intergenic
1014670850 6:124301952-124301974 CCCAGCCCCTCCCAAAACTCAGG - Intronic
1015122016 6:129710227-129710249 GCCAGCTCCTCCCCGCAGGCTGG + Intergenic
1015740295 6:136446544-136446566 CCCTGCACCTCCCCAACTTCTGG - Intronic
1015789128 6:136948733-136948755 ACCTCCTCCTCCCAAAATGCTGG - Intergenic
1018183233 6:161242819-161242841 CCCACCCCCTCCCAAAGTGCTGG - Intronic
1018310408 6:162502405-162502427 CCCAACGCCTCCCAAAATGCTGG + Intronic
1019037282 6:169072356-169072378 CCCAGCGCCTCCCCAAGGACGGG - Intergenic
1020282820 7:6658962-6658984 GCCAGCACCTCCTTAAATGCAGG - Intergenic
1021301720 7:18981510-18981532 CCCAGAGCCTCCACAAATGAAGG - Intronic
1022980849 7:35603525-35603547 CCTAGCACCTCCCAAAGTGCTGG + Intergenic
1023040611 7:36169741-36169763 CCAGGCTCCTTCCCAGATGCGGG - Intronic
1023048134 7:36229152-36229174 CCCAGCACCTCCAGCAATGCTGG - Intronic
1023364543 7:39450744-39450766 ACCAGCTCCTCCGCACTTGCTGG + Intronic
1023601311 7:41884220-41884242 CCATGCTCCTCCCCAAAAGGAGG - Intergenic
1023736824 7:43242752-43242774 CCCAGCTCTGCCCCATCTGCAGG - Intronic
1024000017 7:45183858-45183880 CCCAGCTCCTGCCTACATCCAGG + Exonic
1025176095 7:56803219-56803241 CCCAGCTCCTGCCCAGCTCCTGG - Intergenic
1025695699 7:63773203-63773225 CCCAGCTCCTGCCCAGCTCCTGG + Intergenic
1025976941 7:66377294-66377316 CCCAGCTCCTGCCCAGCTCCTGG - Intronic
1026045551 7:66903619-66903641 CCCAGCTCCTGCCCAGCTCCTGG + Intergenic
1026113390 7:67476290-67476312 GTCAGCTCCTCATCAAATGCTGG - Intergenic
1026871962 7:73858207-73858229 GCCAGCGCCTCCCAAAGTGCTGG - Intergenic
1026872017 7:73858507-73858529 GCCAGCGCCTCCCAAAGTGCTGG - Intergenic
1027202229 7:76071570-76071592 CCCAGCTCCTGCCCAGCTCCTGG - Intergenic
1027224035 7:76232932-76232954 CCAAGCTCCTCCCTCCATGCAGG - Intronic
1027399698 7:77794904-77794926 GCCTTCTCCTCCCCAAATACTGG - Intronic
1028303086 7:89227401-89227423 CCCAGCACCATTCCAAATGCTGG + Intronic
1028916807 7:96268448-96268470 CCCACCTCCTCCTCAAATGCTGG + Intronic
1029356527 7:100056188-100056210 CTCAGCACCTCCCAAAGTGCTGG + Intronic
1029514281 7:101016182-101016204 GCAAGCTCCTTCCCAACTGCAGG - Intronic
1029714360 7:102317899-102317921 CCCAGCTCCTCCTCCCCTGCTGG - Intronic
1030020448 7:105270339-105270361 CCCTGCTCCTTCCAAAATGAGGG - Intronic
1030116534 7:106065886-106065908 CCCAGCCCCTCCCCGACTCCAGG + Intergenic
1030354289 7:108525876-108525898 GCCAGCTCCTCCCCAAAGCCTGG + Intronic
1032348077 7:131135367-131135389 CCCTCCTCCTCCCAAAGTGCTGG + Intronic
1034185958 7:149177345-149177367 TCAACCTCCTCCCAAAATGCTGG - Intronic
1035010802 7:155713605-155713627 ACCAGCCCCGCCCCAAGTGCAGG - Intronic
1035079675 7:156205441-156205463 CCCACGGCCTCCCAAAATGCTGG + Intergenic
1035224549 7:157426101-157426123 CCCAGCCCCTCCCCAACCCCTGG - Intergenic
1035278072 7:157759857-157759879 TCCAGCTCCTCCCCAAGAGAGGG - Intronic
1035288441 7:157821430-157821452 CCCACATGCTCTCCAAATGCTGG - Intronic
1035715218 8:1748779-1748801 CCCAGCTCTGCCCCAATTCCAGG + Intergenic
1036621065 8:10424740-10424762 CCCAGCACCTCCCCTAACCCAGG - Intronic
1036773402 8:11593818-11593840 ACCAGCTCTTCCTCAAGTGCAGG + Intergenic
1037194378 8:16170098-16170120 CCCTGCGCCTCCCAAAGTGCTGG - Intronic
1038541675 8:28395127-28395149 CCCACCGCCTCCCAAAGTGCTGG - Intronic
1039403751 8:37295116-37295138 ACCAGCTCCTGCTGAAATGCTGG - Intergenic
1039477218 8:37845685-37845707 ACCTGATCCTCCCAAAATGCAGG - Intronic
1039809259 8:41030440-41030462 GCCTGGGCCTCCCCAAATGCTGG - Intergenic
1041171100 8:55142426-55142448 CCCAGGTCCTCCTGAAAAGCAGG + Intronic
1042067759 8:64897667-64897689 CCAAGTTCCTGCACAAATGCAGG - Intergenic
1042344840 8:67716873-67716895 GCCAACTGCTCCACAAATGCAGG + Intronic
1042561821 8:70077671-70077693 CCCAGCACCTCCCAAAGTGCTGG + Intergenic
1043275580 8:78388403-78388425 AGCAGCTCCTCCCTAAATGGTGG + Intergenic
1045326564 8:101121812-101121834 GCCTGGGCCTCCCCAAATGCTGG + Intergenic
1045497213 8:102718805-102718827 CCAAGCTCGTCCCGAAATCCTGG - Intergenic
1045582410 8:103496423-103496445 CCCAGGTCCTCCCAAAGTGCTGG + Intergenic
1047626336 8:126659916-126659938 TCCAGGGCCTCCCCAAGTGCTGG - Intergenic
1048465067 8:134658814-134658836 CCCAACTCGTCCCTAAATGCTGG + Intronic
1048474009 8:134726849-134726871 TCCACCGCCTCCCAAAATGCTGG + Intergenic
1048881876 8:138878007-138878029 CGCAGCTTCTCCCCACACGCCGG - Exonic
1050549817 9:6739320-6739342 CCCTGCACCTCCCAAAGTGCTGG + Intronic
1050720365 9:8581839-8581861 GCCTCCACCTCCCCAAATGCTGG - Intronic
1051631309 9:19143580-19143602 CCCCACTCCTCCCAAAGTGCTGG + Intronic
1052434262 9:28406187-28406209 CCCACCTCCTCCCTAAGTGCTGG - Intronic
1053274204 9:36771049-36771071 TCCAGCTCCTCCCCAAGAACTGG + Intergenic
1053489192 9:38487087-38487109 CCCAGCTCCTCCTCCGATGAAGG - Intergenic
1054825150 9:69566045-69566067 CCCTGCTCCTGCACACATGCAGG + Intronic
1055595906 9:77864058-77864080 CTGAGGTCCTCCCCAGATGCAGG - Intronic
1055694966 9:78873682-78873704 ACCTCCGCCTCCCCAAATGCTGG - Intergenic
1056483044 9:87025388-87025410 CCCATCTCCTCCCCCAAGTCAGG + Intergenic
1056852829 9:90098468-90098490 CCCAGCTCCTCTCCATGTGACGG + Intergenic
1057669546 9:97076401-97076423 CCCAGCTCCTCCTCCAATGAAGG - Intergenic
1057805673 9:98218098-98218120 GCCACAGCCTCCCCAAATGCTGG + Intronic
1058058766 9:100473979-100474001 CCCACCGCCTCCCCACACGCCGG - Intronic
1058447355 9:105065817-105065839 TCCATCTCCTCCCAAAGTGCTGG - Intergenic
1058781922 9:108346250-108346272 CCCAGCACCTACCTAAAGGCTGG - Intergenic
1059603935 9:115812703-115812725 GCCCGCTTCTCCCAAAATGCTGG - Intergenic
1060184927 9:121558514-121558536 ACCACCGCCTCCCTAAATGCGGG + Intergenic
1060211721 9:121714682-121714704 CCCAGCTCCTCCCCTAGTGGAGG + Intronic
1060936923 9:127521473-127521495 CCCAGCTGCTCCAGGAATGCAGG + Intronic
1060944651 9:127562799-127562821 CCCAGCTTTTTCCCTAATGCTGG - Intronic
1060990556 9:127846490-127846512 CCCAGTTCCTCCCGGATTGCTGG + Intronic
1061056608 9:128226013-128226035 CCCACCTCCTCCCCGGGTGCAGG + Intronic
1061335850 9:129935236-129935258 ACCTGAGCCTCCCCAAATGCTGG + Intronic
1061798631 9:133102625-133102647 CCCAGCACCTGCCCAGAAGCTGG + Intronic
1061848145 9:133399624-133399646 CTCAGCCCCTCCCAAAGTGCTGG - Intronic
1062215086 9:135384691-135384713 CCCAGCCCCTCCCCACCTGAAGG + Intergenic
1062232767 9:135491343-135491365 CCCAGCACCTCCGCAGATCCGGG + Intergenic
1062306518 9:135910007-135910029 CCCTGGGCCTCCCAAAATGCTGG + Intergenic
1062398144 9:136360836-136360858 CCCTGGACCTCCCCACATGCTGG + Intronic
1062458704 9:136653834-136653856 CCCAGCCCTTCCCCGTATGCGGG + Intergenic
1062587042 9:137254115-137254137 CCCAGGTCCTCCCCAGACCCAGG + Intergenic
1203458194 Un_GL000220v1:10452-10474 CCCAGTTCCTCCCCAGCAGCTGG + Intergenic
1185521808 X:745832-745854 CCCAGCTTCTGCCCACATGATGG + Intergenic
1187181562 X:16947322-16947344 CTCAGCTCCTCGCCCAGTGCTGG + Intronic
1189356678 X:40314910-40314932 CCCTGCCCCTCCCCAAAAGCTGG - Intergenic
1190063982 X:47227874-47227896 CCCAGCCCCTTCCCAAAGGGTGG + Intronic
1192369750 X:70503633-70503655 TCCAGCCCCTCCCCAACAGCTGG + Exonic
1192451151 X:71245881-71245903 CCCAACTTCCCCCCAACTGCTGG - Intronic
1195001175 X:100644761-100644783 CCCAGCTTCTCCCCAATCTCAGG - Intronic
1195384019 X:104296639-104296661 GCCTCCTCCTCCCAAAATGCTGG + Intergenic
1195993116 X:110702880-110702902 CCCAGCACTGCCCCAGATGCTGG - Intronic
1196376179 X:115035153-115035175 GCCAGCACCTCCCAAAGTGCTGG + Intergenic
1198410101 X:136358122-136358144 TCCAGCTCCTCCTGGAATGCTGG + Intronic
1200254449 X:154572460-154572482 ACCTGGGCCTCCCCAAATGCTGG + Intergenic
1200263320 X:154631948-154631970 ACCTGGGCCTCCCCAAATGCTGG - Intergenic