ID: 1183620095

View in Genome Browser
Species Human (GRCh38)
Location 22:38967130-38967152
Sequence CAGGGGAATCAGCAGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183620086_1183620095 8 Left 1183620086 22:38967099-38967121 CCAAGGATGGGGGGTCTAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG 0: 1
1: 0
2: 4
3: 31
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183620095 Original CRISPR CAGGGGAATCAGCAGGACAG GGG Intronic
900032172 1:380047-380069 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
900052722 1:608233-608255 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
900461225 1:2802858-2802880 CAGGGGGGTCAGCAGGGCTGGGG + Intergenic
900935726 1:5765240-5765262 CAGGGGACTCAGCAGCTCAGAGG - Intergenic
902397504 1:16140325-16140347 CAGGTCATGCAGCAGGACAGAGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903098694 1:21007959-21007981 CAGGAGAAGCTGGAGGACAGAGG - Intronic
903341870 1:22659648-22659670 CATGGGATTTAGCAGGACACTGG + Intronic
903562236 1:24236609-24236631 CTGGGGAGACAGCAGCACAGAGG + Intergenic
904840743 1:33370370-33370392 CAGAGGCACCAGGAGGACAGAGG - Intronic
905492031 1:38352095-38352117 CAGGGGCAGCTGAAGGACAGTGG - Intergenic
905851768 1:41280036-41280058 CAGGGGCATCTGCAGGAGAAGGG - Intergenic
906267124 1:44440986-44441008 CATGGGACTCCGCAGGCCAGCGG - Intronic
906741458 1:48189296-48189318 CAGTGGAATAAGGAGGACAGGGG - Intergenic
907330340 1:53666783-53666805 CTGGGGAGCCAGCAGGGCAGGGG + Intronic
908706725 1:66964958-66964980 CAGGGCAAGCAGCAGGTCAGAGG + Intronic
912062012 1:105685894-105685916 CAGGGGTATCATCAACACAGAGG + Intergenic
912128405 1:106569829-106569851 CAGGGAAGTCACCAGGCCAGTGG + Intergenic
912931171 1:113963511-113963533 GAGGGGAATTACCAGTACAGCGG - Exonic
913112930 1:115672201-115672223 AAGTGGAATCAGCAGGACTTGGG - Intronic
913335677 1:117707345-117707367 CAGGGGGACCAGCAAGGCAGGGG - Intergenic
913671147 1:121097991-121098013 CAGCGGGATCAGCAAGCCAGCGG + Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916165497 1:161963675-161963697 CAGGCCAGTCACCAGGACAGAGG + Exonic
917328412 1:173857079-173857101 CATGGCAATCAGAAGGACACTGG - Intronic
917718335 1:177760244-177760266 CCTGGGTATCAGCAGAACAGTGG - Intergenic
918241719 1:182626164-182626186 TAGAGGAATCAGCAGGAAGGTGG - Intergenic
919927838 1:202201635-202201657 CAAGGGAATGAGCAGGACTCTGG + Intronic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
920965863 1:210700050-210700072 AAGGGGCAGTAGCAGGACAGAGG - Intronic
922200312 1:223394950-223394972 CAGGGGAGTCAGAGGAACAGAGG + Exonic
922331611 1:224581869-224581891 CAGGGGGATAAGGAGGACTGTGG + Intronic
922481489 1:225942602-225942624 CAGGCGGATCACCAGGTCAGGGG - Intergenic
923310228 1:232727940-232727962 CATAGCAATCAGAAGGACAGTGG - Intergenic
923732003 1:236560615-236560637 CAGTGGAAGGGGCAGGACAGTGG + Intronic
924260448 1:242224647-242224669 CATGGGAATCAGCAGCTCACAGG + Intronic
924291427 1:242540612-242540634 CAGGGGAATCAGTAAAAGAGAGG + Intergenic
924712472 1:246541332-246541354 CGGGAGAATCAGCAGGGAAGAGG + Intronic
1063979680 10:11443682-11443704 CAGGGGGATCAGCGGGCCTGGGG - Intergenic
1064577613 10:16762010-16762032 CAGGGGGAACAGCAAGACCGGGG - Intronic
1066158555 10:32704302-32704324 CAGCGGAAGCTGCAGAACAGTGG + Intronic
1066389562 10:34967819-34967841 CGGGGGAATCGGGAGGCCAGAGG + Intergenic
1066984686 10:42454555-42454577 CAGGGGAGTCAGCAGGGCACGGG - Intergenic
1067794339 10:49309907-49309929 AAGGGGAAACAGGAAGACAGTGG - Intronic
1068421165 10:56795372-56795394 CATGGGAGTGAGCAGGAGAGAGG - Intergenic
1069289682 10:66762643-66762665 AACGGGAATGAGGAGGACAGTGG - Intronic
1069524320 10:69154197-69154219 CAGGGGATTCAGCAGGTAAATGG + Intronic
1069537354 10:69264716-69264738 CAGGGGATTCAGCAGGTAAATGG - Intronic
1070795802 10:79215678-79215700 CAGGGCTATCAGCACCACAGGGG - Intronic
1070802539 10:79251976-79251998 CAGGAGCAGCATCAGGACAGGGG + Intronic
1071251486 10:83823995-83824017 CAGGGCAATCAGCTGAGCAGGGG - Intergenic
1074359116 10:112811153-112811175 CAGGTGCATCTCCAGGACAGTGG + Intronic
1075064827 10:119282379-119282401 CAGGGGGAACAGCAGCACTGGGG - Intronic
1075465319 10:122646615-122646637 CAGGGGAAACCCCAGGACAAGGG + Intergenic
1075985186 10:126779119-126779141 AAGGGGAAGCACCAGGAAAGGGG - Intergenic
1076898337 10:133325111-133325133 TCGGGGAACCAGCAGGACAAGGG + Intronic
1077010910 11:378923-378945 CAGGGGACTCCTCAGGACAAAGG + Intronic
1077271596 11:1684521-1684543 CAGAGGATCCAGGAGGACAGGGG + Intergenic
1077271624 11:1684582-1684604 CAGGGGGTCCAGGAGGACAGGGG + Intergenic
1077271672 11:1684694-1684716 CAGGGGGTCCAGGAGGACAGGGG + Intergenic
1077271714 11:1684789-1684811 CAGGGGGTCCAGGAGGACAGGGG + Intergenic
1078410337 11:11109841-11109863 GAGGGGAATCTTCATGACAGCGG - Intergenic
1078430948 11:11288057-11288079 CAGGTGGATCAGAAGGAAAGAGG - Intronic
1080774811 11:35375706-35375728 CAGTGGCATCAGCAGGTCACTGG + Intronic
1082934172 11:58639297-58639319 CAGGGGGAACTGCTGGACAGCGG - Intergenic
1083307466 11:61768852-61768874 CAGGGCATTCAGCAGGTCATGGG - Intronic
1083476709 11:62920138-62920160 CAGGGTAATCAGCTGTTCAGTGG - Intronic
1083880208 11:65544663-65544685 TAGGGGACTCAGGAGAACAGTGG - Intronic
1084285398 11:68127944-68127966 CAGGGGCACAGGCAGGACAGCGG + Intergenic
1084766018 11:71308978-71309000 CAGGGGAATCACCTGGACCTGGG + Intergenic
1085202378 11:74709293-74709315 CAGGGGAGGCAGCAGGACACAGG + Intronic
1086134976 11:83436043-83436065 CAGAGCAAAGAGCAGGACAGGGG + Intergenic
1086301054 11:85426475-85426497 CAGTGGAAGCTGCAGAACAGCGG - Intronic
1087230241 11:95653048-95653070 CAGGGGAATGGGGAGGAGAGTGG + Intergenic
1088945103 11:114504070-114504092 CAGGGGAAGCTGCAGTATAGGGG - Intergenic
1089290248 11:117433309-117433331 AAGGGGGCTCTGCAGGACAGTGG + Intronic
1089422462 11:118342116-118342138 CAGGGGTGTCAGGAGGGCAGGGG - Intronic
1090206022 11:124884905-124884927 CAGGAGAAGCTGAAGGACAGTGG + Exonic
1090333992 11:125950819-125950841 CAGGGGAGTCTGGAGGCCAGGGG - Intergenic
1090431836 11:126652778-126652800 CAGGCAATTCACCAGGACAGAGG + Intronic
1091067362 11:132528458-132528480 CAAGGGAACCAGAAGGACAGTGG - Intronic
1091205387 11:133817588-133817610 CAGGGGAGTAAGGAGAACAGGGG - Intergenic
1091596670 12:1883163-1883185 CAGGGGCAGCCGCAGGCCAGTGG + Intronic
1092171486 12:6376229-6376251 GCGAGGAATCAGCAGGAAAGAGG - Intronic
1092589377 12:9936632-9936654 CACGGGTCTCAGAAGGACAGAGG - Intergenic
1093483492 12:19628721-19628743 GAGGGGCATCAGCAAGCCAGAGG - Intronic
1094058267 12:26287721-26287743 CAGCTGAATCAGAAGGGCAGCGG - Intronic
1094789467 12:33894892-33894914 CGGGGGGATCAGGAGGTCAGGGG + Intergenic
1095395776 12:41760976-41760998 AAGGAAAATAAGCAGGACAGAGG + Intergenic
1095953791 12:47795469-47795491 CAGGGCAATGCGCAGGACAGGGG + Intronic
1096048511 12:48585819-48585841 AAGAGGAATCAACAGGTCAGAGG - Intergenic
1096628583 12:52910765-52910787 CAGGGGAATCCTCAGGGCTGGGG - Intronic
1097023699 12:56038224-56038246 GAGGGGAATCAGAAGAAGAGAGG - Exonic
1097996722 12:65896004-65896026 CAGGAAACTCAGCAGGACAAAGG + Intronic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1101678638 12:106943023-106943045 CAGGGTAATCAGCCTTACAGTGG + Intergenic
1101851014 12:108402335-108402357 CAGGGGCTTCAGGGGGACAGTGG - Intergenic
1102573257 12:113840530-113840552 CCGGGGATGGAGCAGGACAGAGG - Intronic
1103936730 12:124481105-124481127 AAGGGGAGTGAGCAGGACAGGGG + Intronic
1104981702 12:132575896-132575918 CAGCGCAGTCACCAGGACAGTGG + Intronic
1105221911 13:18338095-18338117 CAGGGAAATAAGGAGGACTGAGG - Intergenic
1105914965 13:24905850-24905872 GAGGGGCATCAGCAGCAGAGAGG - Exonic
1105937684 13:25117332-25117354 CAGGGGCATCAGCAAAACAGGGG - Intergenic
1106208491 13:27620788-27620810 CAGGGGAATCAGGCGGGCGGCGG - Exonic
1106665043 13:31842890-31842912 CAGGAGAATGAGCAGGACAGTGG + Intergenic
1106759883 13:32858078-32858100 CAGGGGAAGCATCAGGTCTGTGG + Intergenic
1106940901 13:34778115-34778137 CTGGTGAGTCAGCAGTACAGAGG - Intergenic
1108322622 13:49302864-49302886 CAGGGGCATCAGCAGAGCTGGGG + Intergenic
1109677315 13:65694659-65694681 CAGGTGAATCACAAGGTCAGGGG + Intergenic
1111403079 13:87766808-87766830 CAGTGGCATCATCAGGACAAGGG + Intergenic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1113061476 13:106326699-106326721 CAGGGAAATCAGAAGTATAGAGG + Intergenic
1113424707 13:110198494-110198516 CAGGGGAACCAGGAGGACCCGGG + Exonic
1113469542 13:110534530-110534552 CAGGGGAAGTGGCATGACAGGGG + Intronic
1114857403 14:26465960-26465982 AAAGGGAATCAGGAGTACAGGGG + Intronic
1115191763 14:30754383-30754405 CAGGGGTTGCAGCTGGACAGTGG + Intergenic
1115553917 14:34528907-34528929 CAGGTGAATCACGAGGTCAGGGG + Intronic
1115990617 14:39146037-39146059 CAGGAGAATCAGCTGGACCTGGG - Intergenic
1116658954 14:47683183-47683205 CAGGGGAATGCTGAGGACAGGGG - Intergenic
1117891472 14:60426772-60426794 CAGGGGAGGCTGCAGAACAGTGG + Intronic
1117936540 14:60913620-60913642 CAGGGGAGGCTGCAGAACAGTGG + Intronic
1119664878 14:76478271-76478293 CATGGGGATGAGGAGGACAGAGG + Intronic
1121007718 14:90500935-90500957 CAGAGGAGACAGCAGGACTGGGG + Intergenic
1121437871 14:93930811-93930833 CAGGGGACTCCCCAGGCCAGGGG - Intergenic
1122309121 14:100783522-100783544 CAGGGGCATGAGCAGGCCAGAGG - Intergenic
1122578747 14:102757989-102758011 CTGGGGAAAGGGCAGGACAGAGG + Intergenic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1123115130 14:105891087-105891109 CATGGGAACCGGCAGGACATGGG + Intergenic
1123938981 15:25207642-25207664 CAGGGCAGCCAGCAGGGCAGTGG + Intergenic
1124412955 15:29451746-29451768 CACTGGGATGAGCAGGACAGTGG - Intronic
1124595874 15:31091157-31091179 CCGAGGAAGCAGCAGGCCAGTGG + Intronic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125522221 15:40354630-40354652 GCGGGGAAGCAGCAGGAGAGAGG - Intronic
1126055570 15:44726725-44726747 GAGGGTAATCTGCAGGACTGAGG + Intergenic
1126735006 15:51722302-51722324 CAAGAAAATCAGCAAGACAGGGG + Intergenic
1127029567 15:54846991-54847013 CAGGTGGATCAGAAGGTCAGGGG - Intergenic
1127489380 15:59447904-59447926 CTGGGCACTCAGCAGGGCAGTGG + Intronic
1128251383 15:66166406-66166428 GAGGGGAAGCAGGAGGCCAGTGG - Intronic
1128644419 15:69364961-69364983 CAGGTGAATCACGAGGTCAGGGG - Intronic
1128979370 15:72175367-72175389 AAGGAGCATCAGCAGGAGAGTGG - Intronic
1129286504 15:74529507-74529529 CAGGTGAATCATGAGGTCAGAGG - Intergenic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1130014208 15:80174780-80174802 AAGGGGCATCAGCAGGTCAAAGG - Intronic
1130145156 15:81268492-81268514 CAGAGGAAGCAGCAGGGCATGGG - Intronic
1130558830 15:84943301-84943323 CTGGGGAAGCGGCAGCACAGAGG + Intronic
1130789159 15:87133648-87133670 CATGGGAATCAGAGGAACAGAGG - Intergenic
1130904227 15:88228567-88228589 CAGGGGAATCAGGAAGGCTGTGG - Intronic
1131065818 15:89434404-89434426 GGGGAGACTCAGCAGGACAGGGG + Intergenic
1131827215 15:96331338-96331360 CGGGGGAATCAGCATGAAAGTGG - Exonic
1132014035 15:98300303-98300325 CTGGGGAATAAGCAGGACTCAGG - Intergenic
1132102297 15:99032959-99032981 AAGGGAAATCAGCAAGAAAGGGG + Intergenic
1132376611 15:101332335-101332357 CAGTGAGATCAGCAGGGCAGAGG - Intronic
1132843328 16:1989233-1989255 GAGGGGACTCAGCGGGACACAGG + Intergenic
1132948997 16:2549857-2549879 TAGGGGAATGGGCAGGTCAGAGG + Intronic
1132965590 16:2652270-2652292 TAGGGGAATGGGCAGGTCAGAGG - Intergenic
1133901432 16:9978857-9978879 CAGGTTACTCAGCAAGACAGAGG + Intronic
1135616095 16:23912416-23912438 CAGGGCAAGCATCAGGACACGGG - Intronic
1137860440 16:51841456-51841478 CAGGGAAGTCAGGAGGTCAGGGG + Intergenic
1137980475 16:53064874-53064896 CAGGAGAATCAGCTGAACACAGG + Intronic
1138412934 16:56853950-56853972 CAGGAGAAACAGCAGGACTCAGG + Intergenic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1138929040 16:61630159-61630181 GAGGAGAGTCAGCAAGACAGTGG + Intergenic
1139392802 16:66615739-66615761 CAGGGGAAGGAGCCGGACACCGG + Exonic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139669576 16:68483509-68483531 CAGGGGCATTAGCAGTCCAGGGG + Intergenic
1139903921 16:70349606-70349628 CAGGAGAAGGAGCAGGTCAGAGG + Intronic
1140052307 16:71492905-71492927 CAGGGGAAAGTGCAGGGCAGAGG + Intronic
1141381027 16:83577232-83577254 CAGTGGACACAGTAGGACAGGGG - Intronic
1141739815 16:85883755-85883777 CAGGAGAATAAGGAGGACACAGG - Intergenic
1142069905 16:88086427-88086449 CAGGGGAGACGGCAGAACAGGGG - Intronic
1143809819 17:9462156-9462178 CAGGGGAACAAACATGACAGTGG + Intronic
1143986873 17:10922320-10922342 CAGGGGAATGATCAGATCAGTGG - Intergenic
1144421269 17:15101363-15101385 GAGGGGATTCAGCAGGAGACCGG - Intergenic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1146232860 17:31129654-31129676 CAGGCGAATCATGAGGTCAGGGG - Intronic
1146821499 17:35986508-35986530 CAGGGAAATAAGCAGGAGTGAGG - Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147632343 17:41940210-41940232 CAGGGGAAGCAGCAGGACTCAGG - Intronic
1147854581 17:43469419-43469441 CATGGGAATCAACAGCACAAAGG - Intergenic
1148622935 17:49048343-49048365 CAGGAGAATCACTAGAACAGGGG - Intronic
1148870820 17:50658005-50658027 CAAGGGACTCCGCAGGGCAGGGG + Intronic
1148907606 17:50921152-50921174 CAGGGCAGCCTGCAGGACAGAGG - Intergenic
1149378240 17:56067094-56067116 CAGGAGAATCAGCAGAACCCGGG + Intergenic
1149627274 17:58088791-58088813 CAAGGGAATCAAGAGGCCAGTGG - Intronic
1149783292 17:59415207-59415229 CAAGGGAAACAGCAGAAGAGAGG + Intergenic
1152390877 17:80003011-80003033 CTGGGGATTCAGCAGGAGAGAGG + Intronic
1153224340 18:2886957-2886979 CAGGGAATTCAACAGGAGAGGGG - Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1156555130 18:38059117-38059139 AAGAAGAATGAGCAGGACAGTGG - Intergenic
1157420877 18:47546658-47546680 CAGGTGAATGCCCAGGACAGGGG + Intergenic
1157452517 18:47799372-47799394 CATCTCAATCAGCAGGACAGTGG + Intergenic
1158220760 18:55148369-55148391 CAGGGGCATCTGCACCACAGAGG + Intergenic
1158532993 18:58280271-58280293 CAGTGGAATGGGCTGGACAGTGG - Intronic
1158964625 18:62611837-62611859 CAGGGGAATCTGTGGGTCAGCGG + Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1160188160 18:76692034-76692056 GAAGGGAATCTGCAGGACAACGG + Intergenic
1160350455 18:78174099-78174121 TGGGGGAATGGGCAGGACAGAGG - Intergenic
1160607751 18:80065185-80065207 CAGGTGAATCACGAGGTCAGGGG - Intronic
1160817558 19:1043142-1043164 CAGGGGACCTAGCAGCACAGTGG + Exonic
1161126867 19:2562767-2562789 CTGGGAACTCAGCAGGGCAGAGG - Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1162059124 19:8084100-8084122 CAGTGGCATCAACAGGACTGGGG - Intronic
1162217754 19:9150413-9150435 GAGGGGAATGAGCAGAACTGTGG + Intronic
1162725402 19:12687570-12687592 CAGGAGATCCAGCAGGCCAGGGG + Intergenic
1163500706 19:17674532-17674554 CAGGGGAAGAGGGAGGACAGAGG + Intronic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1166231046 19:41425999-41426021 CAGGTGAGCCAGCAGGGCAGGGG + Exonic
1166898246 19:46037510-46037532 CAGGGCCATCAGCAGGACCAGGG + Intergenic
1167295767 19:48648414-48648436 CAAAGGAATCAGAAAGACAGAGG + Intergenic
1167522124 19:49961218-49961240 CAGGGGAAGCAGCAGGGCAGAGG + Intergenic
1167523257 19:49969507-49969529 CAGGGGAAGCAGCAGGGCAGAGG - Intergenic
1167748131 19:51364744-51364766 CAGAGGCATCATTAGGACAGGGG + Intronic
924964728 2:65268-65290 CAGGGGAAAGAGGAAGACAGTGG + Intergenic
925236068 2:2278795-2278817 TATGGGAAACAGTAGGACAGTGG + Intronic
925284588 2:2707392-2707414 CAGGCGGCTCAGCAGGACACAGG + Intergenic
925812336 2:7712732-7712754 TAGGGGAAAGAGCAGGACACAGG + Intergenic
925871949 2:8279180-8279202 CAGGGGCACCAGCAGTTCAGTGG + Intergenic
927199208 2:20568051-20568073 CTGGGCAGTCAGCAGGTCAGGGG - Intronic
927215464 2:20666074-20666096 CAGGGGAACGCGCAGGAGAGGGG - Intergenic
927856104 2:26528908-26528930 CAGTGGCATCTGCAGGGCAGTGG + Intronic
928381333 2:30821321-30821343 CAGCGGAATCACCTGGAAAGAGG + Intergenic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930028497 2:47044225-47044247 CAGGGGAAGAAACAGGAAAGGGG - Intronic
931117140 2:59177162-59177184 ATGGGGAATCAGCAGGAAAGAGG - Intergenic
931351108 2:61489779-61489801 CAGGCGGATCACCAGGTCAGGGG - Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931526875 2:63166290-63166312 CAGGCGAATCACGAGGTCAGGGG - Intronic
932446350 2:71784071-71784093 CAGGGGAAGGTGGAGGACAGGGG - Intergenic
932459166 2:71871498-71871520 AAGGAGAATGAGCAGGAAAGAGG + Intergenic
934182120 2:89634298-89634320 CAGGGAAATAAGGAGGACTGAGG + Intergenic
934292419 2:91708506-91708528 CAGGGAAATAAGGAGGACTGAGG + Intergenic
934546280 2:95219347-95219369 CAGCAGAATCAAAAGGACAGAGG - Intronic
934987757 2:98900001-98900023 GAGGGGAGGCAGGAGGACAGAGG + Intronic
937121985 2:119446849-119446871 GAGGGGGATCAGCAGGAGAGTGG + Exonic
937466008 2:122133685-122133707 CAGGGGAATAACAAGGACAAAGG + Intergenic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938862271 2:135381693-135381715 CAGCGGAGTCTGCAGAACAGTGG - Intronic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939143070 2:138378912-138378934 CAAGGACATCAGCAGGATAGTGG + Intergenic
940146509 2:150550952-150550974 CAGGTGGATCAGCAGGTCAGAGG + Intergenic
940188741 2:151015665-151015687 CAGGGACATCAGTAGGACAGCGG - Intronic
940268854 2:151869701-151869723 CAGAGGGATGAGCAGGAGAGTGG - Intronic
941650122 2:168083570-168083592 CATGGGAATCTGCAGAAGAGAGG + Intronic
942160156 2:173176635-173176657 CAGGAGACTAAGAAGGACAGGGG + Intronic
942668168 2:178344425-178344447 CAGTGGCACCATCAGGACAGGGG - Intronic
942915865 2:181305702-181305724 CACAGGAATCAGCAGGTGAGAGG + Intergenic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
945126087 2:206511562-206511584 TAGGGGCATAATCAGGACAGTGG + Intronic
946391201 2:219418057-219418079 CAGGGGAGACAGCAGAAGAGAGG - Intergenic
946862586 2:224014280-224014302 CAGGGGAATCACTAGAACCGAGG + Intronic
947730027 2:232422778-232422800 AATGGGAATAAGCAGGCCAGAGG - Intergenic
948525874 2:238570492-238570514 AAGGGGACACAGCAGCACAGGGG + Intergenic
948669693 2:239559873-239559895 CTGGGGTCACAGCAGGACAGTGG + Intergenic
948807804 2:240460493-240460515 CAAGGGTATTAGCAGGAGAGGGG - Intronic
1169449128 20:5696400-5696422 CAAGGGAAACATGAGGACAGTGG + Intergenic
1169663616 20:8007970-8007992 AAGGTGAATAAGGAGGACAGAGG - Intronic
1171074672 20:22110545-22110567 CAGGGGAAAGAGCAGGCAAGGGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171904300 20:30888176-30888198 CAGTGGAAGCTGCAGAACAGTGG + Intergenic
1172705748 20:36880872-36880894 CAGGGGAATGAGCAGGGCAGTGG + Intronic
1172840491 20:37900308-37900330 CTGGGGACTCAGCTAGACAGAGG + Intergenic
1173118576 20:40269552-40269574 CAGAGCAAAGAGCAGGACAGGGG - Intergenic
1174005608 20:47408431-47408453 CAGGTGAATCACCAGGTCAGGGG - Intergenic
1175547219 20:59786150-59786172 CTGGGGAATGAGCAGGGCAAAGG - Intronic
1175571644 20:60027227-60027249 CAGGTGAAAAAGAAGGACAGTGG + Intronic
1175761787 20:61566212-61566234 GGTGGGAAACAGCAGGACAGCGG - Intronic
1176730348 21:10488935-10488957 CAGGGAAATAAGGAGGACTGAGG - Intergenic
1178286860 21:31333146-31333168 CAGGGAAATCAGGACCACAGAGG + Intronic
1178412687 21:32378591-32378613 CAAAGGAATCAGCAACACAGTGG + Intronic
1179512626 21:41884003-41884025 CTGGGGACTGAGCAGGACACTGG - Intergenic
1179885446 21:44312354-44312376 CGTGGGAATGGGCAGGACAGAGG + Intronic
1179932523 21:44579755-44579777 CAGAGGCCTCAGCAGGCCAGGGG + Exonic
1180165866 21:46028322-46028344 AAGGGGAATCTGCTGGATAGAGG + Intergenic
1180280160 22:10686249-10686271 CAGGGAAATCAGCAGGGGATGGG + Intergenic
1180745766 22:18087958-18087980 AAGGGGAAGCTGCAGGGCAGAGG - Exonic
1181502133 22:23322066-23322088 CGGGCGAATCACGAGGACAGGGG - Intergenic
1181676790 22:24459804-24459826 CAAGGGAATCCCCTGGACAGTGG + Intergenic
1183295377 22:37026149-37026171 CAGGGGAATGAGCAACACAGGGG + Intronic
1183618014 22:38956729-38956751 CAGGGGAGCAGGCAGGACAGGGG + Intronic
1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG + Intronic
1183662234 22:39227987-39228009 CTGGGCCATCAGCAGGACACTGG + Intronic
1183981814 22:41544858-41544880 AAGGAGAATTAGCAGGAAAGGGG + Intergenic
1184113779 22:42410214-42410236 TCGGGCAAGCAGCAGGACAGAGG + Intronic
1184263624 22:43334033-43334055 CAGTGAGATCTGCAGGACAGGGG + Intronic
1184639039 22:45859255-45859277 CAGGTGCCCCAGCAGGACAGCGG + Intergenic
1185246570 22:49776167-49776189 GAGGGGCGTCAGCAGGACACAGG + Intronic
949344699 3:3065998-3066020 CAGGGAAATCATCAGCACATTGG + Intergenic
949965829 3:9355448-9355470 CAGAGGAGTGAGCAGGATAGAGG - Intronic
952188462 3:30996619-30996641 CAGTGGAATCAGCAAAACAATGG + Intergenic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
953750836 3:45607267-45607289 CAGGGAAACCAGCTGGACACAGG + Intronic
954336743 3:49922934-49922956 CAGGCGGATCACCAGGTCAGGGG - Intronic
954386838 3:50248565-50248587 CAGGGGGAACAACGGGACAGAGG - Intronic
955407615 3:58635495-58635517 CAGGGGAACCGGCAAGACAGAGG - Intronic
956433327 3:69208916-69208938 CAGGCGGATCAGGAGGTCAGGGG + Intronic
959064710 3:101644710-101644732 CAGGCGAATCATGAGGTCAGGGG - Intergenic
959952273 3:112193458-112193480 CAGGGCATTCAGCAGGCCAGAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
963063072 3:141240841-141240863 CAGATGACTCAGTAGGACAGTGG + Intronic
967472509 3:189878852-189878874 CAGGGGGATCACAAGGTCAGGGG - Intronic
967681830 3:192372552-192372574 CAGGGGCATATGCAGGGCAGTGG + Intronic
967942348 3:194775972-194775994 TAGGGGAATTGGCAGGAAAGGGG - Intergenic
967968190 3:194979083-194979105 CAGGTGGATCAGCTAGACAGAGG + Intergenic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968739831 4:2321878-2321900 CAGGGCAGTCAGCAGGAGTGGGG + Intronic
968985698 4:3873340-3873362 CTGGGGAAGCAGCAGGGCAGTGG - Intergenic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969337053 4:6517209-6517231 CTGGGGAGTCAGCATCACAGGGG - Intronic
969873655 4:10120225-10120247 CAGAGAAATCAGCAGGGAAGGGG - Intergenic
971495607 4:27261232-27261254 CAGGGGAATCAGAAGAATAATGG + Intergenic
971839934 4:31837927-31837949 CAGGTGGATCACGAGGACAGGGG - Intergenic
973279013 4:48340959-48340981 CAGGGGAAGAAACAGGACACAGG + Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974028171 4:56752392-56752414 CAGGGGAATCACTTGGACATGGG - Intergenic
974094937 4:57352424-57352446 CCGAGAAATCAGCATGACAGGGG - Intergenic
974540953 4:63234476-63234498 CAGGAGAATCAGTTGGACACGGG + Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
976745897 4:88402691-88402713 AAGGGGAGTGACCAGGACAGTGG + Intronic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
977943721 4:102886259-102886281 CAGGTGGATCACCAGGTCAGGGG + Intronic
980175298 4:129337242-129337264 CAGAGGTATAATCAGGACAGAGG + Intergenic
982333027 4:154203229-154203251 CAGGTGAATCACAAGGTCAGGGG + Intergenic
983966641 4:173820555-173820577 CGGGTGAATCAGGAGGTCAGGGG + Intergenic
985534563 5:456729-456751 CAGGGGAAAGTGCAGGGCAGGGG - Intronic
986311131 5:6551857-6551879 CCGGGGAGTCAGCCAGACAGCGG - Intergenic
986570287 5:9157278-9157300 TAGGGTAATCATGAGGACAGGGG - Intronic
987242414 5:16014143-16014165 CATGGGAATCTGAAGAACAGTGG + Intergenic
987781718 5:22445726-22445748 CTGCTGAATCACCAGGACAGGGG - Intronic
989046054 5:37274818-37274840 CAGGTGGATCAGGAGGTCAGTGG + Intergenic
990903535 5:60779139-60779161 CAGTGAAAGCAGCAGGAAAGGGG - Intronic
991368911 5:65897513-65897535 CAGAAGAATCAGGAGGGCAGAGG + Intergenic
991369030 5:65899002-65899024 CAGGAGAATCAGGGGGGCAGAGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992425754 5:76655672-76655694 CAGGTGAATCATGAGGTCAGGGG - Intronic
992448027 5:76851192-76851214 CAGAGGAATGGGCAGCACAGTGG + Intronic
992471725 5:77063321-77063343 CAAAAGAATCAGCAGCACAGGGG + Exonic
993189543 5:84663726-84663748 AAAAAGAATCAGCAGGACAGCGG + Intergenic
993714049 5:91256720-91256742 CAGGAGAATCACGAGGTCAGGGG + Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
995306596 5:110658206-110658228 CACGGGTATCAGGATGACAGAGG - Intronic
995921441 5:117318823-117318845 CAGTGCGGTCAGCAGGACAGAGG - Intergenic
996012998 5:118502063-118502085 CAGTGGAAGCTGCAGAACAGCGG + Intergenic
998025837 5:138815479-138815501 CAGGGCACCCAGCAGGAAAGAGG - Intronic
998563480 5:143194043-143194065 CAGTGAAATCAGCAGGACACTGG + Intronic
1001747999 5:174106989-174107011 CAGGTGAATCAGCCAGATAGAGG + Intronic
1001933379 5:175688355-175688377 CAGGAAAGGCAGCAGGACAGGGG - Intergenic
1002326128 5:178407712-178407734 CAGGAGAATGAAGAGGACAGTGG + Intronic
1002688497 5:181034230-181034252 CAGGTGGATCACCAGGTCAGGGG + Intergenic
1002715338 5:181223587-181223609 AAGGGGGAGTAGCAGGACAGCGG + Exonic
1002741648 5:181438821-181438843 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1002762008 6:209616-209638 CGGGGATATCAGCAGGGCAGTGG + Intergenic
1003400972 6:5790519-5790541 CAAGGGAATCACCCGGACACAGG - Intergenic
1003666106 6:8112719-8112741 CAAGGGAGTCAGGAGGAGAGAGG + Intergenic
1004180556 6:13377484-13377506 CAGGGCACACAGCAGGAAAGTGG - Intronic
1005518433 6:26576724-26576746 CAGACAAAACAGCAGGACAGAGG + Intergenic
1007666038 6:43513536-43513558 CGGGGGAAGCACCAGGGCAGAGG - Intronic
1010587521 6:77671761-77671783 AAGGGGAATGAACAGGGCAGGGG + Intergenic
1010599269 6:77803765-77803787 CAGCGGAGTCTGCAGAACAGCGG + Intronic
1010602544 6:77848391-77848413 CATGGGAAGCAGAAGGAAAGAGG + Intronic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1014253698 6:119140670-119140692 CAAGGGCACCAGCAGAACAGAGG + Intronic
1015185896 6:130415159-130415181 CAAGGGAAGCAGAAGGAAAGGGG + Intronic
1015626489 6:135183990-135184012 CACGGGAATCAACAGGACTAGGG - Intronic
1018258867 6:161949789-161949811 CTGTGGAATCAGGAGGACAGAGG - Intronic
1018729798 6:166640151-166640173 GAAGGGAGTCAGCAGGAAAGAGG + Intronic
1019041049 6:169106339-169106361 CAGAGGCATCCGCAGGGCAGAGG - Intergenic
1019246788 6:170714586-170714608 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1020549601 7:9585863-9585885 CAGGTGAATCACGAGGTCAGGGG - Intergenic
1021517868 7:21507042-21507064 AAGGGGAATGATCAGGAGAGTGG - Intronic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022182109 7:27930882-27930904 CACAGCCATCAGCAGGACAGTGG + Intronic
1022257576 7:28674603-28674625 CAGAGGAATCAGGAGAACAGAGG - Intronic
1023966774 7:44966958-44966980 AAGGGAAATCAGCAGAACAAGGG + Intronic
1024366133 7:48522337-48522359 CAAGGCCAGCAGCAGGACAGTGG - Intronic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1025888540 7:65622548-65622570 ATGGGGAGTCAGCAGGACAAAGG + Intergenic
1029414113 7:100432295-100432317 CAGGGGACTCTGCAGGGCACAGG - Intronic
1030602522 7:111608956-111608978 CAGGAGAATCACAAGGTCAGGGG - Intergenic
1031353123 7:120760021-120760043 TTTGGGAATCAGCAGCACAGAGG + Intergenic
1031853903 7:126899414-126899436 ATGGGGAGTCAGCAGGACAAAGG - Intronic
1031985598 7:128162830-128162852 CAGGGGCATCAGCATGGCAGAGG + Intergenic
1032168602 7:129565562-129565584 CAGGGGGATCACAAGGTCAGGGG - Intergenic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1034599218 7:152232593-152232615 CAGGGAAATAAGAAGGACTGAGG + Intronic
1034699350 7:153083119-153083141 CAGGGGAATCCCCAGGCCAGGGG + Intergenic
1034840562 7:154391632-154391654 CAGGGGCTTCATCAGGACAGAGG - Intronic
1035016151 7:155768044-155768066 CAGGAGGACCAGCAGGACACTGG - Intronic
1035067946 7:156121722-156121744 CAGGTGAGGCTGCAGGACAGAGG - Intergenic
1035205617 7:157292196-157292218 CAGAACAGTCAGCAGGACAGGGG - Intergenic
1035501354 8:93375-93397 CTGGGGAACCAGCTGGCCAGAGG + Intergenic
1035702682 8:1648636-1648658 CTGGGGCATGATCAGGACAGGGG + Intronic
1035732981 8:1865595-1865617 CAGGGCCATCACCAGGACACGGG + Intronic
1036244034 8:7101559-7101581 CAGGGGTAGCAGGAGGAAAGGGG - Intergenic
1036591447 8:10172432-10172454 CAGTGGAAGTAGCAGGGCAGGGG + Intronic
1036897809 8:12649868-12649890 CAGGGGTAGCAGGAGGAAAGGGG + Intergenic
1037916641 8:22777191-22777213 GAGGGGAAGCAGAAGGAAAGAGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038546055 8:28426583-28426605 CTGGGGAATGACCAGCACAGCGG - Intronic
1040894805 8:52355034-52355056 GAGGGAACTCAGCAGCACAGGGG + Intronic
1041531859 8:58877930-58877952 CAGGGTAATGAGGATGACAGAGG + Intronic
1041710398 8:60889143-60889165 CAGGTGGATCACCAGGTCAGGGG + Intergenic
1041860833 8:62510863-62510885 CACAGGAAAAAGCAGGACAGAGG - Intronic
1042189572 8:66172006-66172028 CAGGGGATTCTGCATGGCAGAGG + Intronic
1044371354 8:91415175-91415197 TAGGGGAAGCAGCTGGACATGGG + Intergenic
1044540047 8:93398637-93398659 CTTGGGAAGCAGCAGGAAAGAGG - Intergenic
1044728553 8:95212532-95212554 CAGGGGAAGGAGCAGGTGAGGGG + Intergenic
1045011086 8:97958890-97958912 CAGGGGAAGTAGCAGAAGAGAGG - Intronic
1047933156 8:129750304-129750326 CAGGGGAATGAGAAAGACTGGGG - Intronic
1048466476 8:134668451-134668473 CAGCGGAAGCTGCAGAACAGCGG - Intronic
1048632830 8:136262704-136262726 CAGGGGAGTCAGCGGGCAAGGGG - Intergenic
1048978755 8:139691501-139691523 TAGTGGGATCAGCAGGTCAGGGG - Intronic
1052117601 9:24668163-24668185 CAGCGGAGTCTGCAGAACAGCGG + Intergenic
1052513516 9:29451232-29451254 CAGGGGTGTCTGCAGAACAGTGG - Intergenic
1053543592 9:38999486-38999508 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1053808022 9:41822991-41823013 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1054622570 9:67364437-67364459 CTGGGTAAGCAGCAGGATAGGGG + Intergenic
1055588290 9:77781179-77781201 TAGGGGAAACATCAGGACATAGG - Intronic
1055598182 9:77886881-77886903 CAGGGGGATCATGAGGTCAGGGG + Intronic
1055667007 9:78563002-78563024 GAGGGGAATGAGGAGCACAGCGG + Intergenic
1056861940 9:90193022-90193044 CAGCGGAGGCTGCAGGACAGTGG - Intergenic
1057220367 9:93254443-93254465 CAGGGCAGCCAGCAGGACAGAGG - Intronic
1058437322 9:104974970-104974992 CAGGAGCATCATCTGGACAGAGG + Intergenic
1058862372 9:109128647-109128669 CAGGGGCATCACCAAGAAAGGGG - Intergenic
1059219887 9:112605378-112605400 CAGTGGAAGCAGGAGGTCAGAGG - Intronic
1059777086 9:117486968-117486990 CGTGGGAGACAGCAGGACAGAGG + Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1061206948 9:129170074-129170096 CAGGTGAATCACAAGGTCAGGGG - Intergenic
1061493353 9:130958225-130958247 CAGGGGATTGGGAAGGACAGAGG + Intergenic
1061614907 9:131773273-131773295 CATGGGAATGAGCAGGATTGGGG - Intergenic
1061864613 9:133485842-133485864 CAGGAGGAACAGCAGGACAAGGG - Intergenic
1062394180 9:136346090-136346112 CAGGGGCCTGAGCAGGACACTGG - Intronic
1203583935 Un_KI270746v1:45132-45154 CAGGGAAATAAGGAGGACTGAGG + Intergenic
1203607560 Un_KI270748v1:70037-70059 CTGGGGAACCAGCTGGCCAGAGG - Intergenic
1186137596 X:6535017-6535039 CAGAGGAATCTGTAGGAGAGAGG - Exonic
1186437710 X:9557371-9557393 CAGGGGAAACAGGCGGTCAGAGG + Intronic
1187275664 X:17814621-17814643 CAGGGGAATCAGCTCAAAAGGGG + Intronic
1187337013 X:18390285-18390307 CAGGAGAATCAGCAGAACCTGGG - Intergenic
1187356121 X:18573581-18573603 CAGGGAAAAGAGCATGACAGTGG - Intronic
1187838338 X:23458740-23458762 CAGGGGAGGCTGCAGAACAGCGG + Intergenic
1194715457 X:97282534-97282556 CAGGCGAATCATGAGGTCAGGGG - Intronic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1199853037 X:151738890-151738912 AAGGGGAAGCAGCAGGGTAGTGG - Intronic
1200979331 Y:9247810-9247832 GAGGGGAAACAGCATGTCAGGGG + Intergenic
1201347924 Y:13005062-13005084 CAGCGGAAGCTGCAGAACAGCGG - Intergenic
1201769173 Y:17601391-17601413 CAGGAGAATCAGCTGAACTGTGG - Intergenic
1201832381 Y:18304594-18304616 CAGGAGAATCAGCTGAACTGTGG + Intergenic
1201989218 Y:20006666-20006688 CAGACCAATCAGCAGGACATGGG - Intergenic
1202378867 Y:24259795-24259817 GAGGGGAAGCAGCAGGACCTGGG - Intergenic
1202491915 Y:25410326-25410348 GAGGGGAAGCAGCAGGACCTGGG + Intergenic