ID: 1183623228

View in Genome Browser
Species Human (GRCh38)
Location 22:38986833-38986855
Sequence GCTATTCCTCCCTCCAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 2, 1: 1, 2: 0, 3: 6, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183623215_1183623228 19 Left 1183623215 22:38986791-38986813 CCCATGGCATCCTGGGGGGACAT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1183623228 22:38986833-38986855 GCTATTCCTCCCTCCAATGGTGG 0: 2
1: 1
2: 0
3: 6
4: 81
1183623219_1183623228 9 Left 1183623219 22:38986801-38986823 CCTGGGGGGACATCTGAGGGCCA 0: 1
1: 0
2: 6
3: 15
4: 184
Right 1183623228 22:38986833-38986855 GCTATTCCTCCCTCCAATGGTGG 0: 2
1: 1
2: 0
3: 6
4: 81
1183623216_1183623228 18 Left 1183623216 22:38986792-38986814 CCATGGCATCCTGGGGGGACATC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1183623228 22:38986833-38986855 GCTATTCCTCCCTCCAATGGTGG 0: 2
1: 1
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183623228 Original CRISPR GCTATTCCTCCCTCCAATGG TGG Intronic
900579034 1:3399214-3399236 GCTTTTCCTCTCTCCAAAAGAGG + Intronic
902686307 1:18079889-18079911 CCAATTCCTCCCTCCCAGGGTGG - Intergenic
902950889 1:19882256-19882278 TCTATTCCGCCCTCTAGTGGTGG - Intergenic
908581044 1:65517512-65517534 CCAATTCTTCCCTCCAAAGGTGG - Intronic
910155461 1:84213288-84213310 GCTATTCCTTCATCCTTTGGTGG + Intronic
913045679 1:115071959-115071981 GCTCTTCCTCCCTGCCATAGAGG + Intronic
914950259 1:152107858-152107880 GCTGTTCCTCCCTCTCCTGGCGG + Exonic
919142450 1:193589575-193589597 GCTTTTCCTGACTCCACTGGAGG - Intergenic
1073082867 10:100871072-100871094 GCTCCTCCTCCCTTCAAGGGAGG + Intergenic
1074511073 10:114112567-114112589 TCTAGACCTCCCTCCAAGGGAGG + Intergenic
1076623891 10:131810036-131810058 GCTGTGCCTCCCTCCTATGCAGG - Intergenic
1080684271 11:34502514-34502536 GCTAATCCTCCCACCTGTGGAGG + Intronic
1086608141 11:88722204-88722226 GCTATTCCACCCTCCAGTAAAGG - Intronic
1089858379 11:121567168-121567190 GCTATCCCTCCCTCCCCTGGCGG - Intronic
1093851696 12:24047061-24047083 GTTATTCGTACCTCCAAAGGGGG - Intergenic
1097052408 12:56231259-56231281 GCTATTCCCCTCACCAATGATGG + Exonic
1097920853 12:65071364-65071386 GCTTTTGTTCCCTGCAATGGTGG - Intronic
1102439543 12:112950674-112950696 GCTGTTCTTCCCTCCACAGGGGG + Exonic
1103202631 12:119100817-119100839 CCTAAACCTCCCTCCTATGGGGG - Intronic
1104380892 12:128307039-128307061 GTTATTCCTTCCAGCAATGGTGG - Intronic
1109395404 13:61751961-61751983 GATATTCCTCAATCAAATGGTGG + Intergenic
1113058405 13:106295005-106295027 GCTATTTCTCCCACCACTCGAGG + Intergenic
1114183111 14:20381760-20381782 CCTATTCCCCCCTCAAATAGCGG + Intronic
1115195951 14:30799523-30799545 GCTGTTCCTCCATCAAAAGGTGG + Intergenic
1119437522 14:74607244-74607266 GCTAGTCCCCCTTCCAATAGAGG + Intronic
1119740890 14:77013087-77013109 GATATTCCTCCTTCCCAGGGAGG + Intergenic
1120314927 14:82879503-82879525 GCTACTCCTACCTCTAATGTGGG - Intergenic
1121291396 14:92778816-92778838 GCTCTTTCTCCCTACAATGGGGG - Intergenic
1121410303 14:93744749-93744771 CCAATTCCTCCCTCCAATCACGG + Intronic
1129168336 15:73792393-73792415 ACTGTTCCTGCCTCCAGTGGGGG - Intergenic
1141993150 16:87621674-87621696 TTTATTCCTCCCTGCAATGAGGG + Intronic
1143064092 17:4229937-4229959 GCTATTTCTCCCTGCAAAGGTGG - Intronic
1146085884 17:29829235-29829257 ACTAATCCTCCCTCCAAGGTAGG + Intronic
1146721374 17:35126415-35126437 GCAAGTCCTCCCTCCAAAGTGGG - Intronic
1147605259 17:41770699-41770721 GCTATTCCTCTCTCCCAGAGGGG + Intronic
1156672651 18:39489378-39489400 TGTATTACTCCTTCCAATGGTGG - Intergenic
1160226330 18:77014290-77014312 GCTCTTCCTCCCTCCCCTTGAGG - Exonic
938383322 2:130848640-130848662 TCTCTTCCTCCCTCCAGTGCCGG + Intronic
946315681 2:218910056-218910078 GTCATTCCTCTCTCTAATGGTGG - Intergenic
948214636 2:236219686-236219708 GCTATTTCTTCTTCCACTGGTGG - Intronic
1179771889 21:43626122-43626144 GCTATTCCTTACTCCAGTGCAGG - Intronic
1183304859 22:37077168-37077190 GCAATTCCTCCCTCCCTGGGTGG - Intronic
1183623228 22:38986833-38986855 GCTATTCCTCCCTCCAATGGTGG + Intronic
1183628711 22:39020622-39020644 GCTGTCCCTCCCTCCCACGGTGG + Intronic
1183630041 22:39027307-39027329 ACTATTCCTCCCTCCAATGGTGG + Intronic
1183632190 22:39040381-39040403 GCTGTCCCTCCCTCCCACGGTGG + Intergenic
1183633477 22:39047172-39047194 GCTATTCCTCCCTCCAATGGTGG + Intronic
1183638011 22:39076782-39076804 GCTGTCCCTCCCTCCCACGGTGG + Intronic
949469368 3:4378455-4378477 GCTATTCCTCCTTCAACTGCAGG + Intronic
950107840 3:10399457-10399479 TCTATACCTCACTACAATGGTGG + Intronic
950932645 3:16805942-16805964 GCTGCTCCTCCATCCAAAGGTGG + Intronic
954393397 3:50279319-50279341 GCTTTTCCTCCCTGCACAGGGGG - Intronic
955246815 3:57232481-57232503 GATATTCCTTTCTCAAATGGTGG - Intronic
963907988 3:150789620-150789642 CTTATTCCACCCTCCAAGGGTGG - Intergenic
969184592 4:5465840-5465862 GCAAGTCCTCCCTACAGTGGTGG - Intronic
972228386 4:37041684-37041706 TCTATTCCTCCTTCTAATGGTGG + Intergenic
976629227 4:87220142-87220164 CCTGCTCCTCCCGCCAATGGGGG + Intronic
979266980 4:118715093-118715115 GCCATTCATCTATCCAATGGGGG + Exonic
980422328 4:132579864-132579886 GCTATTCCGCCAACCCATGGTGG - Intergenic
984302337 4:177937835-177937857 GCCATTCCTCCCTCTCATGCTGG + Intronic
985994959 5:3592659-3592681 ACTTTTCCTGCCTCCAAAGGGGG - Intergenic
989859912 5:46358432-46358454 GATATTCCTCTTTCCAATGAAGG + Intergenic
990330334 5:54719431-54719453 GCTGCTCCTCCCTCCTGTGGAGG - Intergenic
991186286 5:63812317-63812339 GGTAATCCACCCTCCAATGAGGG - Intergenic
993607919 5:90016974-90016996 CTCATTCCTCCCTCCCATGGTGG - Intergenic
994393236 5:99208768-99208790 GATATTACTCCCTACATTGGGGG - Intergenic
998046735 5:138993084-138993106 GCCATACCTCCCTGCAAAGGAGG - Intronic
999777604 5:154823488-154823510 TCTATCCCTTCCTCAAATGGTGG - Exonic
1002187131 5:177459598-177459620 TCTCTTCCTCCCTCCCATGTAGG - Intronic
1002475957 5:179466294-179466316 GATAGTCTTCCTTCCAATGGTGG - Intergenic
1004525390 6:16402629-16402651 GCTGTTCCTCCTTTCAAGGGAGG + Intronic
1010359947 6:74981391-74981413 GATATTCCTACCACCAATGTGGG + Intergenic
1030114798 7:106054971-106054993 TCTATTCCTCCCTCCATTGCGGG - Intergenic
1032190047 7:129759668-129759690 CCTATTCCTGCCTCCTAAGGAGG - Intergenic
1040816440 8:51512919-51512941 GCTTTTCCTCCCACCAACAGGGG + Intronic
1041632733 8:60106209-60106231 GCTATTCCTCCAATCAAAGGTGG - Intergenic
1041756859 8:61323396-61323418 GCAATTCCTCCCTCAAGAGGTGG - Intronic
1041929188 8:63268532-63268554 GCTCTTACTCCCTTCAAAGGTGG + Intergenic
1044811552 8:96068844-96068866 GCTCTTCCTCTCTTCAATGCTGG - Intergenic
1048164135 8:132047163-132047185 GTTATTCCTCTCACCAGTGGTGG - Intronic
1055574309 9:77647025-77647047 CCTATGCCTGCCTCCCATGGGGG - Intronic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1057705971 9:97395408-97395430 GCAATTCCACCTTCCAATGCTGG - Intergenic
1059094644 9:111399643-111399665 GCTTTTCCTCCCTCCAAGTGTGG - Intronic
1190979544 X:55443757-55443779 GCTATGCCTGCCTCCAGAGGTGG - Intergenic
1192620280 X:72672332-72672354 GCTATTCCTCAAGACAATGGAGG - Intronic
1195038702 X:100993865-100993887 GTTATTCCTGCCTTCACTGGGGG - Intergenic
1195054410 X:101129368-101129390 GCATTTCATTCCTCCAATGGTGG + Intronic
1196322224 X:114354926-114354948 CCTATTCCTCCATGTAATGGTGG + Intergenic
1196765283 X:119236782-119236804 GCCATTCCTCCCTCCACTCAGGG - Intronic