ID: 1183623976

View in Genome Browser
Species Human (GRCh38)
Location 22:38990618-38990640
Sequence GAATTCCACCAAAAGTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183623976_1183623983 18 Left 1183623976 22:38990618-38990640 CCCCACTACTTTTGGTGGAATTC 0: 2
1: 0
2: 1
3: 5
4: 112
Right 1183623983 22:38990659-38990681 ATCACATTTGGGCTCAGCACAGG 0: 2
1: 0
2: 1
3: 9
4: 125
1183623976_1183623984 24 Left 1183623976 22:38990618-38990640 CCCCACTACTTTTGGTGGAATTC 0: 2
1: 0
2: 1
3: 5
4: 112
Right 1183623984 22:38990665-38990687 TTTGGGCTCAGCACAGGTTGTGG 0: 2
1: 0
2: 0
3: 18
4: 188
1183623976_1183623980 6 Left 1183623976 22:38990618-38990640 CCCCACTACTTTTGGTGGAATTC 0: 2
1: 0
2: 1
3: 5
4: 112
Right 1183623980 22:38990647-38990669 GCCTAAGTCTATATCACATTTGG 0: 2
1: 0
2: 0
3: 8
4: 85
1183623976_1183623982 7 Left 1183623976 22:38990618-38990640 CCCCACTACTTTTGGTGGAATTC 0: 2
1: 0
2: 1
3: 5
4: 112
Right 1183623982 22:38990648-38990670 CCTAAGTCTATATCACATTTGGG 0: 2
1: 0
2: 1
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183623976 Original CRISPR GAATTCCACCAAAAGTAGTG GGG (reversed) Intronic
902734334 1:18390343-18390365 TAATTCCAGAAAAAGGAGTGGGG - Intergenic
908643015 1:66246000-66246022 GAATTCAACCAAAAGTAATTTGG - Intronic
909261604 1:73496404-73496426 TAATTCCTTCTAAAGTAGTGAGG - Intergenic
910148928 1:84117387-84117409 GAATTCTACCAAATGTACTAAGG - Intronic
911809283 1:102253351-102253373 GTATTCCACCTAAGGGAGTGAGG + Intergenic
917189764 1:172402569-172402591 GAAGTCCAGCATAAGTAGTTAGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
920095038 1:203481048-203481070 GGCTTCCAGCAAAAGCAGTGAGG - Intronic
921914428 1:220591218-220591240 GAATTCCTCCAAAAGTATTGGGG - Intronic
1066048408 10:31614234-31614256 GAATTCCACCCAAAGGAGCGTGG + Intergenic
1073173772 10:101537229-101537251 AAATTCAAACAAAAGTAGTCTGG + Intronic
1080157899 11:29134235-29134257 AAATGTTACCAAAAGTAGTGTGG - Intergenic
1085462957 11:76706347-76706369 GAATTCCACCTGAAGAAGGGGGG - Intergenic
1086311663 11:85542248-85542270 AAATTACACCAAAAGAAATGGGG + Intronic
1089568432 11:119385672-119385694 GAATTCCCACAAATGCAGTGTGG + Intergenic
1090197581 11:124830118-124830140 GAATTCCAAGAGAAGTAGAGTGG - Intergenic
1095284297 12:40389822-40389844 GAGCTCCACCAATAGTAGGGAGG + Intergenic
1101450603 12:104774962-104774984 CAATTCTACCAAATGTAATGAGG - Intergenic
1104244291 12:127022679-127022701 TTATACCACCAAAAGAAGTGGGG - Intergenic
1106977558 13:35238762-35238784 TGATGCCACCAAAAGTAGAGTGG - Intronic
1110430782 13:75420737-75420759 AAGTTACACCAAATGTAGTGGGG + Intronic
1111310445 13:86477199-86477221 GAATTCCAAGAATAGTATTGAGG + Intergenic
1116426035 14:44792542-44792564 CAATTCCACCAAAGGAAGTCAGG + Intergenic
1125178328 15:36851788-36851810 CATTTCCACCAAAAGTGCTGGGG - Intergenic
1127250542 15:57232340-57232362 GAATTCCACCAAAACCAGGCTGG - Exonic
1128432752 15:67614244-67614266 GATTTCCACAAAAATTTGTGAGG - Intronic
1130262328 15:82365816-82365838 GCATTCCTGTAAAAGTAGTGTGG + Intergenic
1130278900 15:82503191-82503213 GCATTCCTGTAAAAGTAGTGTGG - Intergenic
1130623238 15:85486064-85486086 GCATTCCTGTAAAAGTAGTGTGG + Intronic
1133204393 16:4224315-4224337 GCACTCCATCAATAGTAGTGGGG - Intronic
1138494813 16:57401772-57401794 AAAATCAACCAAAAGGAGTGGGG - Intergenic
1141949380 16:87330848-87330870 GGCTTCCCCCAAAAGGAGTGGGG + Exonic
1145892167 17:28424766-28424788 GAATTCCATCAAAGGAAGGGTGG - Intergenic
1146360482 17:32171892-32171914 AAGTGCCACCAAAAGTAGTAAGG + Intronic
1147310796 17:39595247-39595269 GAATCCCACTCTAAGTAGTGAGG - Intergenic
1149042199 17:52203337-52203359 GAATTCCAGTAGAAGTAGTTTGG - Intergenic
1150822769 17:68448972-68448994 TAAGTCCACCTAAAGCAGTGCGG - Intronic
1151011067 17:70497018-70497040 GAATTCTACCTAAACTTGTGAGG - Intergenic
1151171776 17:72252672-72252694 GCATTTAACCAAAAGAAGTGGGG + Intergenic
1151575726 17:74951807-74951829 GAAGTCCACCATAGGTGGTGGGG + Intronic
1155014547 18:21819657-21819679 GAATTGCACCTAAAATAGTAAGG - Intronic
1156925719 18:42575556-42575578 GAAATCAAACAAAAGTAATGTGG + Intergenic
1157150819 18:45216122-45216144 CACTTCTACCAATAGTAGTGGGG + Intronic
1166106624 19:40601030-40601052 GAAATCCATTAAGAGTAGTGGGG - Intronic
925812970 2:7719203-7719225 GAATTCACCAAAAAGCAGTGGGG + Intergenic
933999524 2:87696103-87696125 GAATTTCACCTAGAATAGTGAGG + Intergenic
934057144 2:88260995-88261017 AAATTCCATCAAAAGGAATGTGG + Intergenic
937636016 2:124156198-124156220 GAATTCCAGCAAGACCAGTGTGG + Intronic
940889539 2:159022103-159022125 GAATACCACCAAAGGTTGTTGGG - Intronic
941091314 2:161179747-161179769 GAATTACAGCAAAAGGTGTGTGG + Exonic
941654473 2:168128157-168128179 CACTTCCAGCAAAAGAAGTGTGG + Intronic
942228540 2:173837991-173838013 AATTTCCAGCAAAACTAGTGTGG + Intergenic
943159466 2:184229025-184229047 GAATTGAACAAAAAGTTGTGTGG + Intergenic
943532585 2:189102962-189102984 GCCTTTCTCCAAAAGTAGTGTGG - Intronic
946521432 2:220468979-220469001 AAGTTCCACCACAACTAGTGAGG + Intergenic
948382716 2:237561992-237562014 GAATTCCATCAGAATTTGTGGGG - Intergenic
1172890875 20:38263056-38263078 GAATTCCACTGAGAGTTGTGGGG + Intronic
1183618773 22:38960673-38960695 GAATTCCACCAAAAGTAGTGGGG - Intronic
1183623976 22:38990618-38990640 GAATTCCACCAAAAGTAGTGGGG - Intronic
1185229362 22:49671220-49671242 GGATTCCCCCAAAAGGAGGGCGG + Intergenic
949507667 3:4742184-4742206 GAATTCCAGCACAAATATTGTGG - Intronic
951227651 3:20139874-20139896 AAATTTCTCCAAAAGTGGTGAGG - Intronic
954530414 3:51314006-51314028 CATTTCCACCAAAAGAAATGAGG - Intronic
955486839 3:59443008-59443030 GGTTTCCACCAACAATAGTGTGG - Intergenic
956653289 3:71525214-71525236 TAATTTCACCAAAACTAGGGTGG + Intronic
964632753 3:158830653-158830675 GCCTTCCAGCAGAAGTAGTGTGG - Intergenic
965144392 3:164881515-164881537 GAATTCAACCAAAAGGAGCTGGG + Intergenic
965946807 3:174252654-174252676 GAATTCCAACAAAAATATTAGGG - Intronic
970073437 4:12190124-12190146 GAACTCCACTAAAAGGAGAGAGG + Intergenic
970079643 4:12265910-12265932 AAATTCCACCAAATTTTGTGGGG - Intergenic
970363494 4:15334168-15334190 GCAGTCCAGCAAAAGTGGTGTGG + Intergenic
970717922 4:18949109-18949131 GAATTCCACAAGAAGAAGTGGGG + Intergenic
970874769 4:20856775-20856797 GAAATACAGCAAAAGTAGAGGGG + Intronic
971301407 4:25445224-25445246 GATTTCCACTAAAAGCACTGGGG - Intergenic
971968031 4:33587400-33587422 GAATTCAAATAAAAGTTGTGAGG - Intergenic
972654620 4:41052547-41052569 GAATTCCAGCAACAGCACTGAGG + Intronic
973088786 4:46105059-46105081 GAAATCAACCAAAAGTAGCAAGG + Intronic
976194421 4:82519164-82519186 GATTTACAACAAAAGAAGTGAGG - Intronic
977538939 4:98291452-98291474 GAATTACACAAAAAGTAATTTGG + Intronic
983695202 4:170519461-170519483 GAATTCCACCCAACTTATTGAGG - Intergenic
985281613 4:188292161-188292183 GGATTTGACAAAAAGTAGTGGGG + Intergenic
986624466 5:9710374-9710396 TAATTCCCCCAATAGTAGTGAGG + Intronic
988729852 5:33961287-33961309 GAGGTCCATCAAAACTAGTGGGG - Intronic
992663913 5:78987159-78987181 GAATACCACAAAAAGTGATGTGG + Intergenic
993128800 5:83870094-83870116 GAATACCACAAAGACTAGTGTGG + Intergenic
993315552 5:86401557-86401579 GTATTGCACCAAAACTAGAGAGG + Intergenic
993839771 5:92863758-92863780 AAATTCTACCAGAAGTTGTGCGG + Intergenic
994083634 5:95734715-95734737 ATATTCCACAAAAAGCAGTGAGG + Intronic
995223779 5:109681031-109681053 AAATGCCACCAAAAGTGGTCAGG - Intergenic
997422372 5:133779664-133779686 GAATTCTTCCAAGAGCAGTGGGG - Intergenic
998297210 5:140982952-140982974 GAAACCCACCCAAAGTAGTAAGG + Intronic
1002307793 5:178293970-178293992 GAATTCACCCAGAAGTACTGTGG + Intronic
1003267473 6:4578860-4578882 GAATACCACAAAAGGTAATGTGG - Intergenic
1007397297 6:41585197-41585219 GAGATCCACCAAAAGCAGGGAGG + Intronic
1011388403 6:86822809-86822831 GAACTCCACCAAAACAAGTCAGG + Intergenic
1012733035 6:102905629-102905651 GAATTCCTACAAAAATAGTTAGG - Intergenic
1016036461 6:139388456-139388478 GAATTCCACGAAAAGAAGGCAGG + Intergenic
1016037137 6:139394945-139394967 TAATTCTAACAAATGTAGTGAGG - Intergenic
1016263660 6:142206360-142206382 GCATTCCACCAAAAATATTCAGG + Intronic
1017753190 6:157507852-157507874 GTTTTCCACCAAAAGCAGGGAGG - Intronic
1020546065 7:9532905-9532927 CAATCCCATCAAGAGTAGTGTGG + Intergenic
1020804389 7:12770424-12770446 GAATTCCAGCAAAAGAAGACGGG - Intergenic
1021547670 7:21833367-21833389 GAATTCAACCCAAGGTAGAGTGG + Intronic
1022680742 7:32543127-32543149 GAATTCAACCTAAAATAGTAAGG - Exonic
1023597907 7:41852118-41852140 GAGTTCCTCCAAAAGCAGAGTGG - Intergenic
1029996222 7:105011226-105011248 GAAATCCACAAAAACTAGTGAGG + Intergenic
1030581970 7:111368242-111368264 AAATTCCCCCAAAAGAAGTAGGG - Intronic
1033954272 7:146825178-146825200 CAATTTCACCAAAAGCATTGTGG - Intronic
1035699204 8:1625814-1625836 GAATTTCATCAAAAGTAATAGGG - Intronic
1038991824 8:32876771-32876793 GACTTCCCACAACAGTAGTGGGG - Intergenic
1046937510 8:119898970-119898992 GAATTTCACCAAAAGGAATATGG - Intronic
1047313946 8:123715303-123715325 GAATTTGATCAAAAGTAGGGTGG - Intronic
1056205483 9:84315691-84315713 GATTTCCAACAGAATTAGTGGGG + Intronic
1056427741 9:86493982-86494004 GAATACCACTAATAGGAGTGCGG - Intergenic
1060583721 9:124772709-124772731 GAAGTCCACCAGAAGTGATGGGG + Intergenic
1186178605 X:6950824-6950846 GAAGTCCACCCACAGTAGAGTGG - Intergenic
1187490503 X:19747336-19747358 GAATTCCCCCCAAAGGAGTAAGG + Intronic
1189117543 X:38358601-38358623 AAATTCCACCACAGCTAGTGAGG - Intronic
1192562384 X:72135671-72135693 GAAATATACCAAAAGGAGTGAGG + Intronic
1195215433 X:102695875-102695897 GGATTCCAGCAAAAGGGGTGGGG - Intergenic