ID: 1183639226

View in Genome Browser
Species Human (GRCh38)
Location 22:39083170-39083192
Sequence TTACAAAACCACAATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183639226_1183639229 -7 Left 1183639226 22:39083170-39083192 CCTTTATAATTGTGGTTTTGTAA 0: 1
1: 0
2: 3
3: 46
4: 418
Right 1183639229 22:39083186-39083208 TTTGTAAGGACAGGTATTTTTGG 0: 1
1: 0
2: 1
3: 13
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183639226 Original CRISPR TTACAAAACCACAATTATAA AGG (reversed) Intronic
902113414 1:14101706-14101728 TTACATAAACCCAATTATAAGGG + Intergenic
902640996 1:17766087-17766109 TTTCAAAGCCTCAATTACAAGGG - Intronic
902686919 1:18083765-18083787 TTACAAAACACCAATCATACTGG + Intergenic
903367317 1:22813013-22813035 TTACAAATCATCAATTAAAAGGG - Intronic
908279696 1:62519189-62519211 TTACAAAACCACAATTGTAGTGG + Intronic
908984557 1:70001173-70001195 TTACTATACAACAACTATAATGG - Intronic
909336108 1:74475874-74475896 TGTAAAAACCACAAATATAAAGG + Intronic
909368028 1:74851010-74851032 TTACAAAACTATAATAATTAAGG - Intergenic
909401645 1:75239342-75239364 TTTTAAAACCACAATTTTAAAGG + Intronic
909856541 1:80539986-80540008 TTCCAAAACCATAATTATAAGGG - Intergenic
909865581 1:80665205-80665227 TTACAAAACAAAAATTCCAAAGG - Intergenic
910894901 1:92058784-92058806 ATACAAAACCTCTATTAAAATGG + Intronic
911016258 1:93336241-93336263 TTACATAACCAAGCTTATAAAGG + Intergenic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
911956258 1:104239121-104239143 TTATAAAACCACAATTACAGTGG + Intergenic
912114091 1:106383049-106383071 TTACACAGCAACATTTATAATGG + Intergenic
913367808 1:118061630-118061652 TTAAAAAACCACAATGCAAATGG + Intronic
916401676 1:164455895-164455917 TAACAAATCAACAATAATAATGG + Intergenic
918551756 1:185750424-185750446 TAACAAAACCATAATTACAATGG - Intronic
919011077 1:191963964-191963986 CTACTAATTCACAATTATAAGGG + Intergenic
919083766 1:192896001-192896023 TTACAAACCCACAATATGAAAGG + Intergenic
919313132 1:195937179-195937201 TTACATAAAAACAATTATTAAGG - Intergenic
919364999 1:196649000-196649022 ACACAAATCCACATTTATAATGG + Intergenic
919449135 1:197749362-197749384 TTTGAAAACCACAATAAAAAGGG + Intronic
920886529 1:209934538-209934560 TTTAAGAACTACAATTATAAAGG + Intergenic
921223887 1:212997508-212997530 TTTAAAAACCACATTTATAATGG - Intronic
921551070 1:216536251-216536273 GTAAAAAACCAGAAATATAAAGG - Intronic
921624831 1:217368131-217368153 TTACAAAAACTCAAATATACAGG - Intergenic
922439654 1:225643122-225643144 TCATAAAACCAAAATTATTAAGG - Intronic
922655938 1:227383425-227383447 ATACAAAACCAAAATTAGACAGG - Intergenic
922990020 1:229899056-229899078 AGACAAATTCACAATTATAATGG + Intergenic
923028866 1:230230788-230230810 TTACAAAATCCGAATTACAAGGG + Intronic
923969711 1:239186166-239186188 ATAAAAAACCCAAATTATAATGG - Intergenic
924689407 1:246331407-246331429 TTACAATACCCAAGTTATAAAGG + Intronic
1063087809 10:2835510-2835532 TTTCAAAACCACAAGCATCATGG + Intergenic
1063297234 10:4818989-4819011 TTACAAAACTAAAAAAATAAAGG + Intronic
1063843719 10:10102010-10102032 TTCCATAACCCAAATTATAATGG + Intergenic
1063910379 10:10823128-10823150 TTAAAAAATCACAATTAGAAAGG + Intergenic
1064814134 10:19237238-19237260 TTATGAAATCACAATTATATAGG - Intronic
1066356454 10:34688945-34688967 TTACAAAACCACAGCTTTAATGG - Intronic
1067934474 10:50597551-50597573 TTACAAAGAAAAAATTATAAAGG + Intronic
1069656052 10:70089541-70089563 TCACAGAACCACACTTATCAAGG + Intronic
1070266957 10:74912686-74912708 TTTCAAAATCACAAATACAAAGG + Intronic
1071115680 10:82216790-82216812 TTCCAAAAACACAATAATACTGG - Intronic
1072216841 10:93294480-93294502 TTTCAAAACCTAATTTATAATGG - Intergenic
1073814738 10:107194356-107194378 TTACCAAAACACAAGAATAAGGG - Intergenic
1073902691 10:108242223-108242245 TTACAAACACACTATTTTAATGG - Intergenic
1074796002 10:116944587-116944609 TTACAAAACAAAAATTCAAAAGG + Intronic
1075239723 10:120767205-120767227 TAGAAAAACCACAATTAAAAAGG - Intergenic
1075539648 10:123301346-123301368 TTAAAAAGCCACAATTGCAAAGG - Intergenic
1076085912 10:127631450-127631472 TAACAAAACCAGAAATACAAAGG - Intergenic
1077779074 11:5305202-5305224 TTACAAAAAAACAATGAAAAGGG + Intronic
1079836229 11:25337551-25337573 TTACTAAACACCAATTAAAAGGG + Intergenic
1079990082 11:27237506-27237528 TTTCTAAAGCACAAATATAAAGG + Intergenic
1080128061 11:28761066-28761088 TTACAAATCCACAAGAAAAAAGG - Intergenic
1081134785 11:39426751-39426773 ATACAAAACTACAATTAGACAGG + Intergenic
1081701201 11:45153974-45153996 TAAGAAAACCACATTGATAAAGG + Intronic
1082195666 11:49301682-49301704 TTAAAATACCACAAATATAAAGG + Intergenic
1082738171 11:56880381-56880403 TTAAAAAAACACAATTTAAATGG - Intergenic
1082938474 11:58678837-58678859 ATACAGACCCACAATAATAATGG - Intronic
1085436728 11:76511002-76511024 TTATAAAACCACCATTGAAAGGG - Intronic
1085986744 11:81796981-81797003 TAACAAATTCACAATTATACTGG - Intergenic
1086660270 11:89407890-89407912 TTAAAATACCACAAATATAAAGG - Intronic
1087014803 11:93544337-93544359 TGACAATACCACACATATAAAGG - Intergenic
1087250585 11:95894483-95894505 TTACATAAATAAAATTATAACGG + Intronic
1087619153 11:100522569-100522591 TTACAAAACCATCATGAGAATGG + Intergenic
1087858927 11:103129354-103129376 TTAAATAACCACAAATAAAAAGG - Intronic
1091186459 11:133652098-133652120 TTTAAAAACCTCAATTATGAAGG + Intergenic
1091518049 12:1206227-1206249 TGGCAAAACCACAATTAAAATGG - Intronic
1091730241 12:2875402-2875424 TTACAAAACCTCACATAAAATGG + Intronic
1093393924 12:18656762-18656784 CAACAAAAACACAATTATACAGG + Intergenic
1093434005 12:19114846-19114868 TTCTAAAACCACACTTTTAATGG + Intergenic
1094097672 12:26726026-26726048 TTATAATACCACAATTACATGGG - Intronic
1094417787 12:30235660-30235682 AGACAAAAACAAAATTATAAAGG - Intergenic
1094699590 12:32856041-32856063 GAACAAAACCAAAATGATAATGG + Intronic
1096729103 12:53592233-53592255 TTACCAAAGCACAAATACAAAGG + Intronic
1098011728 12:66060540-66060562 AAACAAAACCACAGTCATAATGG - Intergenic
1098034861 12:66291375-66291397 ATAAACAACAACAATTATAATGG - Intergenic
1098520887 12:71434355-71434377 TTACAAAAACAGAAATGTAAAGG + Intronic
1098631276 12:72725249-72725271 TTACAAAACCAGACTGACAAGGG - Intergenic
1098742781 12:74195366-74195388 TCACAAAACCAGTATTCTAATGG + Intergenic
1100492235 12:95092415-95092437 TAACAAATCCACAATTAAACAGG - Intronic
1100671429 12:96817207-96817229 TTGCAAAAGCACAATAAAAAAGG - Intronic
1100852387 12:98726729-98726751 TTAAAATAACACAATTTTAATGG - Intronic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1104792149 12:131490142-131490164 TATCAAAACCACATTTATTAAGG - Intergenic
1104865052 12:131948738-131948760 TTACAACATAACAATTAAAAGGG - Intergenic
1105277078 13:18941251-18941273 TTACAAAAATGCAATAATAATGG + Intergenic
1105662237 13:22510005-22510027 TGAAAAAACCACAATTTTTAAGG + Intergenic
1105682361 13:22742360-22742382 TTACAAAGCTACAACTAGAAAGG + Intergenic
1105887535 13:24654640-24654662 TCACAAATCCTCAACTATAACGG + Intergenic
1106292720 13:28379976-28379998 TTAAAAAATAACAATGATAATGG + Intronic
1107059523 13:36142712-36142734 TTATAAAAAGACAAATATAAGGG + Intergenic
1107499912 13:40963281-40963303 TTAGAAAACCAGAATAATTAAGG + Intronic
1107510615 13:41080303-41080325 CAACAGAGCCACAATTATAAAGG + Intronic
1108683405 13:52798702-52798724 TTAAAATAACACAATTAAAATGG - Intergenic
1108950103 13:56081707-56081729 TTATAAATCCACAATTAGCAAGG - Intergenic
1109073062 13:57794106-57794128 TTACAGAACCACAGTCAGAAGGG - Intergenic
1109173797 13:59129659-59129681 TTACAGAAGCACACTTACAAAGG + Intergenic
1109803663 13:67408050-67408072 TTACAAAACCCAGTTTATAATGG - Intergenic
1110064256 13:71083190-71083212 TTAAAAAAGAAAAATTATAAAGG - Intergenic
1111043162 13:82778410-82778432 GTAGAAAACCACAAATCTAAGGG - Intergenic
1111881642 13:93965042-93965064 TTACAAAAACATAATAATTAAGG - Intronic
1112292439 13:98156700-98156722 TTAAAAAACCCAGATTATAATGG - Intronic
1113087539 13:106583686-106583708 TTACATAATCATAATTATCATGG - Intergenic
1113272434 13:108688158-108688180 TTACAAGACCCTAATTACAAGGG + Intronic
1114250228 14:20953390-20953412 AAAAAAAACCACAATTTTAAAGG + Intergenic
1115775641 14:36711899-36711921 TTAGAAAAACATAATTAGAAAGG - Intronic
1115901901 14:38161020-38161042 TTTTAAAACCACAAATTTAAAGG + Intergenic
1116234511 14:42261143-42261165 AAACAAAACAACAATAATAAAGG - Intergenic
1117648570 14:57878912-57878934 TTAAGAAACAACAAGTATAAAGG + Intronic
1117709794 14:58515588-58515610 TTTCAAAACCATAGTTATAAGGG + Intronic
1117722438 14:58640609-58640631 TTAGAAAACCAAAATTTTACTGG - Intronic
1119957932 14:78821020-78821042 TTATAAAACTAAATTTATAAAGG - Intronic
1120354390 14:83412048-83412070 TTACCAAAACACAAATATACTGG + Intergenic
1120871124 14:89338471-89338493 ATACAAAACCATATATATAAGGG + Intronic
1122229948 14:100301473-100301495 TTACAAATTAACAATTAGAAAGG - Intronic
1122992629 14:105244680-105244702 CTTCAAAACCACAATAATAGGGG + Intronic
1125038626 15:35156995-35157017 TTACAAATCCAAAATTATAGTGG - Intergenic
1126483434 15:49153357-49153379 AATCAAAACCACAATTAGAATGG + Intronic
1126512801 15:49499650-49499672 TTATAAAACTACAGTTTTAAAGG + Intronic
1126549878 15:49916643-49916665 TAACCAAAGCACAATTTTAAAGG + Intronic
1127654163 15:61040073-61040095 TTACAAGAACATAATTCTAATGG + Intronic
1129083156 15:73059709-73059731 ATACAGAACCAAAATTATGAGGG - Intronic
1130776127 15:86985410-86985432 TTACTAAACTAAAATTAAAAAGG - Intronic
1131917236 15:97281327-97281349 TTATAAAACCACCAATATTATGG + Intergenic
1132364154 15:101243934-101243956 CTAGAAAACCACAATTTCAATGG + Intronic
1133408220 16:5543805-5543827 TTACAGAGCCACAAAGATAAGGG + Intergenic
1134280223 16:12810496-12810518 TGATAAAGCCAAAATTATAAAGG - Intergenic
1135290379 16:21231741-21231763 AAACAAAACCACAATCATAAGGG - Intergenic
1135819613 16:25671334-25671356 TAAGAAAACCAGAATTAGAAGGG + Intergenic
1137376945 16:47960018-47960040 TGCTAAAACCACAATTATCAAGG + Intergenic
1140492278 16:75347702-75347724 ATACAAAACCATAAATTTAAAGG + Intronic
1140598794 16:76449784-76449806 TTAGAAAATCTCTATTATAATGG + Intronic
1140766249 16:78160886-78160908 AGACAAATTCACAATTATAATGG - Intronic
1141322326 16:83023135-83023157 AGACAAAACCACAATTGAAATGG - Intronic
1141463039 16:84189267-84189289 TTACAAAAGCAAATTGATAATGG - Intergenic
1143240091 17:5436709-5436731 TTACAACCCAACAATTAAAAAGG + Intronic
1144073115 17:11692316-11692338 TTACATAACAACAATCATAATGG - Intronic
1145982726 17:29023470-29023492 TCCTAAAACCACAATAATAAAGG - Intronic
1146496321 17:33325639-33325661 TTTTAAAACCACAAGTATAAGGG - Intronic
1148449151 17:47763314-47763336 AGACAAATCCACAATTATATTGG - Intergenic
1148948598 17:51288221-51288243 TTAAAAAATAACAATAATAAAGG - Intronic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1150430722 17:65114261-65114283 TGACAAATCCACAATCATTATGG - Intergenic
1153134657 18:1901397-1901419 TTACAAAACCTTAATTTAAAAGG - Intergenic
1153351603 18:4086873-4086895 AAACAAATCCACAATTATAATGG - Intronic
1155122218 18:22832973-22832995 ATATAAAACCACAATAATAATGG + Intronic
1155849247 18:30750275-30750297 TTTCAAAAACACATTTATTATGG + Intergenic
1156598876 18:38580090-38580112 CTACAAAACTTCAATTATCAGGG + Intergenic
1157125062 18:44948809-44948831 CTACAAAACCACAATGAGAATGG - Intronic
1158752444 18:60278897-60278919 TACCAAAACCACATTTGTAAGGG + Intergenic
1159190700 18:65038039-65038061 TTACAAACTCACAATTTCAAAGG + Intergenic
1159235603 18:65669037-65669059 GTACAAAGCCACAATTATGCAGG - Intergenic
1159253591 18:65915335-65915357 ATACAATACCACATTTAGAAGGG - Intergenic
1159834283 18:73318610-73318632 TTAAAAAAAGACAATTAAAATGG - Intergenic
1160440497 18:78886474-78886496 TTAGACAACTACAATAATAATGG + Intergenic
1163888079 19:19986541-19986563 ATACAACAACACAACTATAATGG + Intergenic
1164852750 19:31498375-31498397 TCAGAAAAACACAATTTTAATGG - Intergenic
1165046839 19:33111535-33111557 TTAAAAAAGCACAATTTTGAAGG + Intronic
1168584267 19:57579919-57579941 TTCCAAAACCAAAAGTATTATGG - Intronic
924985790 2:268420-268442 TTACTACAGCACAATTATGAAGG + Intronic
925936727 2:8770511-8770533 ATACAACTCCAAAATTATAATGG + Intronic
925940098 2:8808940-8808962 TTACAAAACCACCATTTCAGAGG + Intronic
927447969 2:23182274-23182296 AGACAAATCCACAATTATATTGG + Intergenic
928527082 2:32152089-32152111 TTATCAAACCAAAATAATAAAGG - Intronic
928794168 2:34996460-34996482 TTAAAAACCCATAATGATAAAGG - Intergenic
929164815 2:38871135-38871157 TTAAAAATCCACATTTATATTGG + Intronic
930184726 2:48401672-48401694 TGACAAAATCGCAATTAGAATGG + Intergenic
930492649 2:52094490-52094512 TTACCAATCAACAATTATAGTGG - Intergenic
931494455 2:62787328-62787350 ATACAAAACAACAATTAATATGG + Intronic
932125886 2:69145281-69145303 ATACAAATGCAAAATTATAAGGG - Intronic
932974989 2:76589358-76589380 TGACAAATCCACCGTTATAATGG - Intergenic
933099660 2:78237103-78237125 TAACAAAATCACACTTATGAAGG + Intergenic
933634397 2:84691835-84691857 TTAAAAAACCACATTGTTAAGGG + Intronic
933826441 2:86165522-86165544 TTTTAAAACTACAATTATGATGG + Intronic
934092488 2:88565014-88565036 TTTTAAAAACACAATTAAAAAGG + Intronic
935422986 2:102889276-102889298 TTACATCACCACAATTCTGAAGG - Intergenic
936747020 2:115589676-115589698 TTTTAAAAACATAATTATAAAGG + Intronic
936936826 2:117846954-117846976 TTGCAAAACCACAATTAATTTGG + Intergenic
937618666 2:123959171-123959193 TTACAAAGCCTCAGTTATACAGG - Intergenic
937628746 2:124074490-124074512 TTAAAAAACCATTATTTTAAAGG + Intronic
937796344 2:126026661-126026683 TTACAAAATCAGAATTAAAAGGG - Intergenic
937844337 2:126562760-126562782 TTACAAAAATACTATTATTAAGG - Intergenic
940247572 2:151636080-151636102 TTTCAAAACCTCAGTTTTAAGGG - Intronic
940641808 2:156352710-156352732 TTTCAAAATCACAGTTAAAAAGG - Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
940759664 2:157723828-157723850 TTACAAAATGACAAATGTAAAGG + Intergenic
941383736 2:164827375-164827397 TTACAAAACTGCAAATATTATGG - Intronic
942179268 2:173364602-173364624 TTACAAAAGCAAAATTAAGATGG + Intronic
942270143 2:174266225-174266247 TTAGAAAACCACTATTATGTGGG + Intergenic
942335106 2:174875255-174875277 CTACAAAACAATAATTATACAGG - Intronic
942409988 2:175699171-175699193 TGACAAAACCTCAATTAAAATGG + Intergenic
942410629 2:175705598-175705620 TGACAAAACCTCAATTAAAATGG + Intergenic
942458619 2:176154235-176154257 TTAAAAAACCACTATTCTCAAGG - Intronic
942516527 2:176759366-176759388 GTACAAAATCACAATTATACAGG - Intergenic
942838213 2:180327156-180327178 TTAGAAAACCACTCTGATAATGG + Intergenic
943013322 2:182478929-182478951 TCTCAAAACTAAAATTATAATGG + Intronic
943166166 2:184328352-184328374 TTACAAAACACCAGTTATAAAGG - Intergenic
943400930 2:187410134-187410156 TTACAAAACCAAAATCTCAAAGG - Intronic
945096589 2:206225430-206225452 AAACAAAACCAAAATTATTATGG + Intergenic
945615932 2:212066607-212066629 TAAAATAACCACAATTATGATGG - Intronic
945665066 2:212730856-212730878 CTATAAAACCTCAAATATAAAGG + Intergenic
946715554 2:222551788-222551810 TTACAAATCAGCAATTACAAAGG + Intronic
946780063 2:223185475-223185497 ATACAAAACCACTAATATCACGG + Intronic
947305726 2:228744426-228744448 TCTCCAAACCATAATTATAAAGG + Intergenic
947925387 2:233917053-233917075 TTTAAAAACCACAAATAAAATGG - Intergenic
948719164 2:239886430-239886452 ATACAAAACAAAAATTAAAATGG + Intergenic
1169639692 20:7736880-7736902 TTAAAAAACCAGAAATAAAAGGG - Intergenic
1171008895 20:21495951-21495973 GTACAAAACCACATTTACAAAGG + Intergenic
1171951226 20:31424290-31424312 TTAGAAATCCACCATTATCATGG + Intergenic
1172017583 20:31887190-31887212 TTGCAGAACCAAAATTACAAGGG + Exonic
1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG + Intronic
1173242251 20:41307432-41307454 ATAGAAAACCAGAATGATAATGG - Intronic
1173482404 20:43413350-43413372 TTAGCAAACCAGAATTAAAAGGG + Intergenic
1174230286 20:49040752-49040774 TTACAAAGGTACATTTATAAAGG - Intergenic
1175728538 20:61335931-61335953 TTAAAAAACCACATAAATAAGGG - Intronic
1177601779 21:23324975-23324997 TTTGAAAACCACTATTAGAATGG - Intergenic
1178106561 21:29325615-29325637 CTACAAAAGCAGAATTTTAAAGG - Intronic
1179110222 21:38439747-38439769 TTACAGAAACTCTATTATAATGG + Intronic
1179659780 21:42866805-42866827 TCACAAACCCACAATTCTAAAGG + Intronic
1180118724 21:45730646-45730668 AGATAAATCCACAATTATAATGG - Intronic
1180633432 22:17245623-17245645 CTACAAAACCACAATCAGGAAGG + Intergenic
1182245633 22:28955347-28955369 TTAAAAAACTACCATTTTAAAGG - Intronic
1182248122 22:28976898-28976920 TTACAAACCCTCACTTAGAATGG - Intronic
1182707304 22:32292881-32292903 AGACAAAATCACAATTATACTGG - Intergenic
1183174561 22:36213238-36213260 TTACAAAACTGCAATCAAAAGGG - Intergenic
1183639226 22:39083170-39083192 TTACAAAACCACAATTATAAAGG - Intronic
1183651243 22:39154813-39154835 AGACAAATCCACAATTATAGTGG + Intergenic
1184395646 22:44236266-44236288 AGACAAAATCACAATTATACTGG - Intergenic
949134596 3:548795-548817 TTATCAAACCATAATTTTAAAGG + Intergenic
949243510 3:1898354-1898376 TCACAAAACCATAATGAGAAGGG + Intergenic
949572162 3:5303967-5303989 TTACAAAAACAGAGTTATATGGG + Intergenic
949633281 3:5953049-5953071 TTTCAAAATGACAAATATAAAGG + Intergenic
950971824 3:17196835-17196857 TTTCAAAACAAGCATTATAACGG - Intronic
951968032 3:28410237-28410259 TGACAAATCCACAATTACTATGG + Intronic
953189099 3:40666970-40666992 TTTTAAAACCACAATTTTAAAGG - Intergenic
953508833 3:43514508-43514530 AGACAAAGCCACAATTATAACGG + Intronic
953592417 3:44271859-44271881 GTACAAAACCTCAATTAAACAGG - Intronic
954596375 3:51829130-51829152 CTACAAAAGCAGAATTGTAAAGG + Intronic
954598418 3:51847691-51847713 TTACAAAAACTGAATTGTAAAGG + Intergenic
954640763 3:52096456-52096478 TTTTAAAAACATAATTATAACGG - Intronic
955430287 3:58836793-58836815 TTAAAAAAGCACTATTACAAAGG + Intronic
955634444 3:61011186-61011208 TTCCACAACCACAGTTATAAAGG - Intronic
955837898 3:63077778-63077800 TTAGAGAACCACTGTTATAAAGG + Intergenic
955949130 3:64224604-64224626 TTAAAAAACCATAATAATATGGG - Intronic
956445208 3:69319410-69319432 TTAAAAAAACACATTTTTAATGG + Intronic
957109631 3:75936468-75936490 TTACAAGACTACAATTTAAATGG - Intronic
957117085 3:76040547-76040569 TTACAAAAATAAAATTATCAGGG - Intronic
957602866 3:82360597-82360619 TTTCACAACCACTATTAGAAGGG + Intergenic
957678985 3:83406847-83406869 TTACCCAACCAAAATTGTAAGGG + Intergenic
957748655 3:84379804-84379826 ATAAAAAATCACAATTAAAATGG + Intergenic
958420608 3:93926137-93926159 TAACAAAACAAAAATTAGAATGG + Intronic
958915131 3:100041289-100041311 TTAGAAAAGCAAAATTATGATGG + Intronic
959225069 3:103570080-103570102 TTACTAAACCATACTTTTAATGG + Intergenic
959926598 3:111928853-111928875 TTATAAAACCACAAACAGAATGG - Intronic
960413565 3:117357695-117357717 TTACCAAACCTCTATTAAAAAGG - Intergenic
961122810 3:124387413-124387435 TTAAAAAACGAGAATTATCATGG - Intronic
961354649 3:126329104-126329126 CCACAAACACACAATTATAAAGG - Intergenic
962050184 3:131805442-131805464 CTACAAAACAACAAATTTAAAGG + Intronic
962246377 3:133797811-133797833 TAACAAAAGGACATTTATAAAGG - Intronic
962612302 3:137089031-137089053 AGACAAATCCACAATTATAGTGG - Intergenic
963535791 3:146526529-146526551 TTTCAAAACAAAAATTTTAAAGG + Intronic
964460876 3:156925858-156925880 TTACTAAATGGCAATTATAATGG - Intronic
964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG + Intronic
964540820 3:157777677-157777699 TTACAAAGCCATAATTATCAGGG + Intergenic
964580434 3:158228407-158228429 TTATATAAACAAAATTATAAAGG - Intronic
964678363 3:159309145-159309167 TTAAAAAAAAACAATTATAATGG + Intronic
965503779 3:169488090-169488112 GGACAAATTCACAATTATAATGG + Intronic
966556422 3:181266280-181266302 TTATAAACCCACAAGGATAAAGG - Intergenic
966643604 3:182217847-182217869 ATACAAAACCATGAGTATAAAGG + Intergenic
968020312 3:195380705-195380727 TTACAAAGCCACAACTTAAAGGG + Intronic
968832719 4:2941445-2941467 TTGCAAAATCACAAATATGAAGG - Intronic
971507469 4:27381775-27381797 TTACCAAACCACAATTTGACAGG - Intergenic
971792453 4:31185948-31185970 TAACAAAACAAGAATTTTAAGGG + Intergenic
972018142 4:34272342-34272364 TTAGAAAACCAAAATTCTATAGG + Intergenic
972581117 4:40396515-40396537 TTAGAAAGCCACAATAAAAATGG + Intergenic
972887936 4:43515891-43515913 TTATAAAATAAAAATTATAATGG - Intergenic
973116640 4:46468450-46468472 TTACAGGACCACCATCATAAAGG + Intronic
974180672 4:58380448-58380470 TTAAAAGACCACTATTGTAAAGG + Intergenic
974737405 4:65954732-65954754 TTACAAAAACATAAATAAAATGG + Intergenic
975052086 4:69878208-69878230 TTAGATAACCACTATTATTAGGG + Intergenic
975197511 4:71542752-71542774 TTATAAAACCACAGTGTTAAAGG - Intronic
977153426 4:93542966-93542988 TTACAAGCCAACAATTTTAAGGG + Intronic
978631420 4:110750908-110750930 TTACAAATACATAATTTTAATGG - Intergenic
978668322 4:111213425-111213447 TTTCTAAACAAAAATTATAATGG - Intergenic
979175180 4:117653677-117653699 TTACTAAAACACAATAAAAATGG - Intergenic
979452507 4:120889403-120889425 TTATACAACCAGATTTATAAAGG - Intronic
979684069 4:123491902-123491924 CAACAAAACCACAATCATAGTGG - Intergenic
980733910 4:136857523-136857545 TTACAAAACTAAAACTTTAAAGG - Intergenic
981013149 4:139947059-139947081 TTAAAAAACAACAATTGGAAAGG - Intronic
981267922 4:142808894-142808916 TAACAAATCCACAATTATTTAGG - Intronic
981390642 4:144186775-144186797 TTCCAACACTACAATTACAAAGG - Intergenic
981568652 4:146129199-146129221 TGTCAAAACCACAATCATAATGG - Intergenic
982471618 4:155798329-155798351 TTACAAAACTTAAATCATAACGG - Intronic
982703357 4:158680760-158680782 CAACAACACGACAATTATAATGG + Intronic
982881041 4:160716410-160716432 TTTCAAAACCTTAATTTTAAAGG + Intergenic
982882525 4:160737925-160737947 TTACAAAACCAAAAATCTCAAGG - Intergenic
983411992 4:167411814-167411836 TTTCTAAATCACAAATATAAAGG - Intergenic
983613591 4:169678097-169678119 AAACAAAACCACAACTCTAAGGG + Intronic
983614062 4:169681355-169681377 TTCCAACACCAAAATTATATAGG - Intronic
985044748 4:185929121-185929143 TTTTAAAACCACTGTTATAAGGG - Intronic
985192565 4:187391823-187391845 TTATAAAACCAAAATCATAGTGG + Intergenic
985996156 5:3598147-3598169 TTCCAAACACCCAATTATAATGG - Intronic
986499872 5:8387597-8387619 TTACAAGTCCAGAATTACAAAGG + Intergenic
986695047 5:10344338-10344360 TTAAACAAACAAAATTATAAAGG + Intergenic
987447330 5:18036089-18036111 TTACAAAACCAACATTTTAAAGG - Intergenic
987459918 5:18196992-18197014 TTGCAAAACCAAAATAAAAAAGG + Intergenic
987486125 5:18529532-18529554 TGACAAAACCAAAAATAGAATGG + Intergenic
988019140 5:25600684-25600706 TGTCAAAACAAAAATTATAAAGG + Intergenic
988109850 5:26806183-26806205 TTTCAAAACAACACTTACAAGGG + Intergenic
988209001 5:28178066-28178088 TTACAAAAAAATAATTATTAAGG + Intergenic
988227985 5:28438270-28438292 ATACAAAGCTACAATTAAAAAGG + Intergenic
989331064 5:40258986-40259008 TTACAAAAACAAGAATATAAAGG + Intergenic
990041061 5:51379151-51379173 TTTCAGAAGCACAATTTTAAAGG + Intergenic
990126313 5:52522502-52522524 TTCCAAAATCACAAATATATGGG - Intergenic
990332565 5:54742210-54742232 TTAAAAAAAGAAAATTATAAGGG - Intergenic
991309439 5:65219899-65219921 AAACAAATCCACAATTCTAATGG + Intronic
992417651 5:76567039-76567061 TTATAAACCTACAATTATCAAGG - Intronic
993158675 5:84259896-84259918 ATGCACAACCACAATCATAAAGG - Intronic
993434952 5:87881501-87881523 TTACAAAGCCCCTATTATGAAGG - Intergenic
993461966 5:88193278-88193300 ATACAAAACCAAGATTATAAGGG + Intronic
993693529 5:91032697-91032719 TTACAAATCCAAAACCATAATGG - Intronic
994334274 5:98546623-98546645 TTGAAAAACCATAAATATAAGGG - Intergenic
994712695 5:103284436-103284458 ATACAAAACCACAATCAAAATGG - Intergenic
994921947 5:106057532-106057554 TAAAAAAAACACAATTATAAAGG + Intergenic
995144922 5:108776700-108776722 TTAGAAAACAGCAATTTTAATGG + Intronic
995210797 5:109535675-109535697 TTACCAAACACCAGTTATAATGG + Intergenic
995561590 5:113387841-113387863 TTATAAAACAACCATAATAATGG - Intronic
995790848 5:115884659-115884681 TTACAATACCACATTTTTTAAGG + Intronic
996103788 5:119474106-119474128 TTAGAAAATCATAATTATACTGG - Intronic
997552836 5:134768617-134768639 TTAAAAAGCACCAATTATAAAGG + Intronic
998196155 5:140074042-140074064 TAACAAATCCACAATTACAGTGG - Intergenic
999111944 5:149129033-149129055 TTACAGAACCAGAATTTGAATGG - Intergenic
999960154 5:156745999-156746021 ACACAAAACCACAAGTTTAAAGG + Intronic
1000399403 5:160810669-160810691 TTATAAAACCACAATTTTGATGG - Intronic
1000472932 5:161668788-161668810 TTGCAAAATCTCACTTATAATGG - Intronic
1000880671 5:166693404-166693426 TTATAATAACACAATTATAGTGG + Intergenic
1001260182 5:170221885-170221907 TTACAAAACCAAAACCATCATGG - Intergenic
1003747235 6:9016331-9016353 TGCCAAAACCACAATTCTAAAGG + Intergenic
1004110585 6:12714703-12714725 CTCCAAAACAACACTTATAATGG - Intergenic
1004122310 6:12836051-12836073 CCACAAAACAACAATAATAATGG + Intronic
1005051978 6:21693226-21693248 TTACAAAGCTACAAGTATGACGG + Intergenic
1005910212 6:30302922-30302944 TTACAAAAGGAAATTTATAATGG + Intergenic
1006123912 6:31825220-31825242 TTCCAAATCCACAATTTAAAAGG - Intergenic
1008378938 6:50821396-50821418 TTACAAAAACAAAATAAAAAGGG - Intronic
1008811895 6:55512411-55512433 TTACAAAACCACAATCAAAAAGG - Intronic
1008840019 6:55891529-55891551 TTACAAATACACAATGAGAAAGG - Intergenic
1009351955 6:62691442-62691464 TTACTAAAGCAAAATTCTAAAGG + Intergenic
1009634052 6:66240756-66240778 TTACAACACCAAGATTATAAAGG - Intergenic
1011439787 6:87375717-87375739 GTTCAAAATCATAATTATAAAGG - Intronic
1013938132 6:115624388-115624410 ATAGAAATGCACAATTATAATGG - Intergenic
1013948773 6:115753957-115753979 TTACAAAATGAGAACTATAATGG - Intergenic
1014085578 6:117338963-117338985 TGAGAAAAACACAATTTTAATGG + Intronic
1014462866 6:121719003-121719025 TTGCAAAAACACAATTAGGATGG + Intergenic
1014469104 6:121793150-121793172 TGAAAATACCAAAATTATAAAGG + Intergenic
1014572127 6:123022638-123022660 TTCCAAAATCAAAATTCTAATGG + Intronic
1015244029 6:131057669-131057691 TTTTAAAACCACAATTATCCTGG + Intronic
1015464179 6:133529635-133529657 TAAGAAAACAACAATAATAAAGG + Exonic
1015585830 6:134775438-134775460 TTACTTTACCACAATTTTAATGG - Intergenic
1018444655 6:163844257-163844279 TTCCAAAACCTTAATTATCAAGG + Intergenic
1018591317 6:165426289-165426311 CTACAAAACCACAGTAATCAAGG + Intronic
1018613875 6:165667067-165667089 TTTTAAAACCAGAATTATAATGG - Intronic
1018647483 6:165961740-165961762 GAACAAAACCACAATTCTTAAGG + Intronic
1019046712 6:169155329-169155351 TTACAAAAAAACAGATATAAAGG + Intergenic
1020176998 7:5890043-5890065 TTTCAAAACTACAATTCAAAGGG + Intergenic
1020192581 7:6011416-6011438 TTACAAAAGCACAATCACAGCGG - Intronic
1021059638 7:16095188-16095210 TTACAAAACCTGAGTTACAAAGG + Intronic
1021156126 7:17212452-17212474 TTAAAAAATGAGAATTATAAGGG + Intergenic
1021158210 7:17238182-17238204 TCACAAAAACACAATAATTAAGG + Intergenic
1021593155 7:22286680-22286702 TTTCAAAGCCACAATTCTTAAGG - Intronic
1021814541 7:24434406-24434428 CAACATAACCACAATTATACTGG + Intergenic
1022749673 7:33211633-33211655 TTACAAAACCATAGTCATGATGG - Intronic
1023648774 7:42346943-42346965 TTTTAAAACCACATTTATATTGG + Intergenic
1024132514 7:46369055-46369077 TAGGAGAACCACAATTATAAAGG - Intergenic
1024662132 7:51507133-51507155 AATCAAAACCACAATTAGAATGG - Intergenic
1024986027 7:55193767-55193789 TTACAAAAGCAAAATTATTTGGG + Intronic
1026330571 7:69348668-69348690 TTACAATAACATAATAATAATGG + Intergenic
1026402062 7:70024140-70024162 TTAAGAATCCAGAATTATAATGG - Intronic
1026408267 7:70091335-70091357 CTATAAAACCACAAATCTAAAGG - Intronic
1027401791 7:77816671-77816693 TTACAAAATCACAGTTAGATAGG - Intronic
1027547451 7:79546340-79546362 CAACAAAACCAAAATTCTAAAGG - Intergenic
1028171668 7:87604442-87604464 TTACAATAACACAATAATAAGGG + Intronic
1028195638 7:87904215-87904237 TTAGAAAACCTTAATTAAAAAGG + Intronic
1028256748 7:88608434-88608456 CCACAAAAACACTATTATAAAGG + Intergenic
1028886063 7:95934494-95934516 TTACATATCCACAAATAAAATGG + Intronic
1028996949 7:97111172-97111194 TGACAAATCCACAATCATACTGG + Intergenic
1029033819 7:97497210-97497232 TTACAAAAACAAAATAAAAATGG + Intergenic
1029065735 7:97846516-97846538 CTGTATAACCACAATTATAATGG + Intergenic
1030308879 7:108048621-108048643 TCAGAAAACCATAAATATAAAGG - Intronic
1030387258 7:108879063-108879085 TTATAAAACTAAAATTATAATGG + Intergenic
1030545962 7:110895415-110895437 CTATAAAGCCACAATTATCATGG - Intronic
1030878049 7:114840303-114840325 TTACAAAAGCAAAATTGTGAAGG - Intergenic
1031240720 7:119235300-119235322 CTATAAAACCAAAATTGTAAGGG - Intergenic
1031655988 7:124356147-124356169 AGACAAAACCATAATCATAAAGG - Intergenic
1031910187 7:127508262-127508284 ATACAAAAATAAAATTATAAGGG + Intergenic
1031953136 7:127912761-127912783 ATACAAAACCACATATATAGTGG + Intronic
1033730751 7:144176560-144176582 TTTAAAAACCACATTTAGAAAGG - Intergenic
1033936032 7:146586688-146586710 TTACCAAACTGCACTTATAATGG - Intronic
1034519684 7:151610206-151610228 ATACAAAACCAAAATTATCCGGG + Intronic
1036065192 8:5372567-5372589 TTAGAAAACCACTATAATACAGG + Intergenic
1036924851 8:12894443-12894465 TTAGAAAAACACAACAATAATGG + Intergenic
1037136628 8:15470399-15470421 TTACTAACCCACATTTTTAATGG - Intronic
1037927515 8:22855664-22855686 TATCAAAATCAAAATTATAAAGG + Intronic
1038155716 8:24988305-24988327 TTACAAAATGAAAATTATAGTGG - Intergenic
1038694511 8:29794198-29794220 TAACAAAATCTCAACTATAAAGG - Intergenic
1039459275 8:37729734-37729756 TTCCAAAATCACAAATGTAAGGG + Intergenic
1040689576 8:49919293-49919315 TTACAAAACCACACTGATTGAGG + Intronic
1041339812 8:56832546-56832568 TTAAAAAACCACAAATTTTAAGG - Intergenic
1042294451 8:67204200-67204222 GGACAAAAGCATAATTATAATGG - Intronic
1043200378 8:77362404-77362426 TTATAAAAATACAATCATAAAGG - Intergenic
1043627403 8:82279200-82279222 TTACAAAAACAAAATCAAAATGG + Intergenic
1043792935 8:84496451-84496473 GTACCAAACCAGAATTACAAGGG - Intronic
1044285592 8:90409502-90409524 TTAAAAAATAAAAATTATAATGG + Intergenic
1044800665 8:95950998-95951020 TGACTACTCCACAATTATAAAGG - Intergenic
1044904300 8:96983645-96983667 TTATAAAATCACAATCCTAATGG - Intronic
1045940393 8:107731698-107731720 ATTTAAAACCACTATTATAAAGG + Intergenic
1046851622 8:118980557-118980579 TTAATAAACTACAAATATAATGG - Intergenic
1047261535 8:123265443-123265465 TTACAAATCCACAAAAATCACGG + Intronic
1047389652 8:124439861-124439883 TCTCAAAACCACAAAAATAAAGG + Intergenic
1048057253 8:130879377-130879399 TCACAAAAGGAGAATTATAAAGG + Intronic
1048146048 8:131844769-131844791 TTCCTAAACCAACATTATAAAGG - Intergenic
1048489657 8:134880793-134880815 TAACAAAACCACAAATTTAGTGG - Intergenic
1050186183 9:2976871-2976893 AATCAAAACCACAATTAAAATGG + Intergenic
1050534099 9:6616371-6616393 TTGCAAGACAACAATTTTAAAGG - Intronic
1050818975 9:9854099-9854121 TTACAAGACTACAATTAGATAGG - Intronic
1050931548 9:11334503-11334525 TAACAAAACCACATTTTTATAGG + Intergenic
1051173148 9:14339826-14339848 TTCCAAAACCCCAAGTATCAGGG - Intronic
1051240328 9:15048430-15048452 AAACAAAACCACAACTCTAAGGG - Intergenic
1051797026 9:20883289-20883311 AGACAAACCCACAATAATAATGG + Intronic
1052184158 9:25570220-25570242 TTACAATACCATCATTAGAATGG - Intergenic
1052353752 9:27483629-27483651 TTTCAAAGGCCCAATTATAAAGG + Intronic
1055222883 9:73959255-73959277 TTTAAGAACCACAATTCTAAAGG + Intergenic
1057364717 9:94408657-94408679 TTACAGAAACAGGATTATAAGGG - Intronic
1057419206 9:94896219-94896241 TTACAAACAAACAGTTATAATGG + Intronic
1057538913 9:95946188-95946210 AGACAAATCCACAACTATAATGG + Intronic
1057658618 9:96979415-96979437 TTACAGAAACAGGATTATAAGGG + Intronic
1058008394 9:99945212-99945234 AAACAAATCCACAATCATAAGGG - Intronic
1058077452 9:100665399-100665421 GTACAAAATTACAATTAGAAAGG - Intergenic
1058349377 9:104003315-104003337 TAACAAAAGGACATTTATAAAGG - Intergenic
1058369085 9:104243905-104243927 TTATAAGAACACAATCATAATGG - Intergenic
1059046496 9:110874291-110874313 TTACAAAAACATAATTTTAATGG - Exonic
1060067442 9:120515126-120515148 TTACCAAACAAACATTATAATGG + Intronic
1060351440 9:122864492-122864514 TCATAAAACTAGAATTATAATGG - Intronic
1060620820 9:125064141-125064163 AGACAAATCCACAATCATAAGGG + Intronic
1061647504 9:132017127-132017149 TTACTGAACCACCTTTATAATGG + Intronic
1186439232 X:9570995-9571017 TTCCAAATTCATAATTATAATGG - Intronic
1188348959 X:29103456-29103478 TTACAAAAGCAAAATCAAAATGG + Intronic
1188358144 X:29218234-29218256 TTACAAAATAAAAATTATACCGG - Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1190773737 X:53536253-53536275 CTAGAAAAACACAATTATACAGG + Intronic
1190781820 X:53603976-53603998 TTAAAAAAGCACAAGTATAAAGG - Intronic
1191023739 X:55890804-55890826 AGACAAATCCACAATTATACTGG - Intergenic
1193103112 X:77637992-77638014 TTAAAAAACAAAAATTACAATGG + Intronic
1193439927 X:81527690-81527712 TTAAAGAACCACAATAATAGTGG - Intergenic
1196423792 X:115549326-115549348 TTGCAAAGCCACATTTAAAAAGG + Intergenic
1198406721 X:136320560-136320582 TTACAAAAGCAGAAATATAAAGG - Intronic
1198471128 X:136948208-136948230 ATAAAAAAAAACAATTATAATGG + Intergenic
1198690052 X:139272371-139272393 TTATAAATCCACAATTAGAGTGG + Intergenic
1199483390 X:148323274-148323296 TCAGAAAAACACAATTTTAATGG + Intergenic
1199652241 X:149957392-149957414 TGACAAATACACAATTATAATGG - Intergenic
1199835261 X:151583646-151583668 TTATAACTCCACAATTAGAAAGG - Intronic
1200324154 X:155220503-155220525 TTTCAAAACCACATTTAGACTGG - Intronic
1200421426 Y:2973481-2973503 TTACAAAAACAAAACTAAAATGG + Intronic
1201414917 Y:13738827-13738849 TTACAAAAGCAGATTTTTAACGG - Intergenic
1202301584 Y:23421302-23421324 TAACAAAACCACTCTTATCAAGG - Intergenic
1202569227 Y:26249296-26249318 TAACAAAACCACTCTTATCAAGG + Intergenic