ID: 1183639403

View in Genome Browser
Species Human (GRCh38)
Location 22:39083929-39083951
Sequence CAGGGACACCCATGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 305}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183639382_1183639403 25 Left 1183639382 22:39083881-39083903 CCAGGTGACCAACCCAGCCACCC 0: 1
1: 0
2: 3
3: 26
4: 286
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305
1183639386_1183639403 12 Left 1183639386 22:39083894-39083916 CCAGCCACCCGCATCCAGGCAGG 0: 1
1: 1
2: 2
3: 35
4: 342
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305
1183639392_1183639403 -2 Left 1183639392 22:39083908-39083930 CCAGGCAGGGCCCTCCCAACCCA 0: 1
1: 1
2: 3
3: 50
4: 407
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305
1183639383_1183639403 17 Left 1183639383 22:39083889-39083911 CCAACCCAGCCACCCGCATCCAG 0: 1
1: 1
2: 4
3: 35
4: 389
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305
1183639389_1183639403 8 Left 1183639389 22:39083898-39083920 CCACCCGCATCCAGGCAGGGCCC 0: 1
1: 1
2: 3
3: 40
4: 344
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305
1183639391_1183639403 4 Left 1183639391 22:39083902-39083924 CCGCATCCAGGCAGGGCCCTCCC 0: 1
1: 0
2: 3
3: 46
4: 445
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305
1183639390_1183639403 5 Left 1183639390 22:39083901-39083923 CCCGCATCCAGGCAGGGCCCTCC 0: 2
1: 0
2: 2
3: 55
4: 370
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305
1183639385_1183639403 13 Left 1183639385 22:39083893-39083915 CCCAGCCACCCGCATCCAGGCAG 0: 1
1: 1
2: 0
3: 37
4: 241
Right 1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG 0: 1
1: 0
2: 5
3: 34
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183639403 Original CRISPR CAGGGACACCCATGGGCAGA AGG Intronic
900639930 1:3683856-3683878 CAGGGACCCCCAAAGGAAGATGG + Intronic
901194552 1:7433126-7433148 CAGGGACCTCCATGAGCAGGAGG - Intronic
901599637 1:10413169-10413191 CAGGGACAGCGCGGGGCAGAAGG + Exonic
902109550 1:14066876-14066898 CAGGAACACACAAGGACAGAGGG - Intergenic
902649826 1:17829843-17829865 CAGGGGCAGCCAGGTGCAGAGGG + Intergenic
902709186 1:18227045-18227067 CAGGCACTCCCAGGGGCAGCTGG + Intronic
903864798 1:26390191-26390213 CAGGGGAACCCCTGGTCAGATGG - Intergenic
904252383 1:29234398-29234420 TAGGGAAAGCCATGGGCAGATGG - Intergenic
904359775 1:29963823-29963845 CAGGGATGGTCATGGGCAGAGGG + Intergenic
904439614 1:30521848-30521870 AAGGGACACCCCTGTGCAGGGGG - Intergenic
905656159 1:39687270-39687292 CTGGAACACCCATAGGCAAAAGG + Intronic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
906069398 1:43006443-43006465 CAGGGCAATCCAGGGGCAGATGG - Intergenic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
906209990 1:44007412-44007434 CTGGGGAACCCCTGGGCAGAGGG - Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
908234530 1:62137336-62137358 GGGGGAAACCCATTGGCAGAAGG + Intronic
908390512 1:63679402-63679424 CATGGACACCTGTGGGCATAAGG + Intergenic
909263544 1:73526862-73526884 CAGGGAGACACATAGGCAGCTGG + Intergenic
913471610 1:119193091-119193113 CAGGGACGGCCATGAGCAGGGGG + Intergenic
915776372 1:158492088-158492110 CAGGAACAACGATGTGCAGATGG + Intergenic
916452676 1:164935998-164936020 CAGGGACTTCCCTGGGCAGGAGG + Intergenic
917493342 1:175517353-175517375 AAAGTACACCCATGTGCAGATGG + Intronic
917638340 1:176958486-176958508 CAGGGACACCCAGTGCCAGGTGG + Intronic
917836847 1:178947857-178947879 AAGGAACAGCCATGGGCAGGGGG - Intergenic
919815579 1:201436496-201436518 CAAGGACACACATGGGAAGGAGG + Intergenic
919861658 1:201742698-201742720 CAGAGACTCCCTGGGGCAGAGGG + Intronic
921407974 1:214801686-214801708 CAGGGACAGGCATGCACAGAAGG + Intergenic
922198674 1:223382428-223382450 CAGGGACCCCTATGTGCTGAGGG + Intergenic
922789019 1:228299693-228299715 CAGGGACATGCATGAGCAGGAGG - Intronic
923545842 1:234922836-234922858 TTGGGAAACCCATGGACAGAAGG - Intergenic
1063890655 10:10624866-10624888 CAGGGACACAAAGAGGCAGATGG + Intergenic
1065968686 10:30788800-30788822 AAGAGAGACCCATGGGCAGAGGG + Intergenic
1067064737 10:43097340-43097362 CACGGCCACCCAAGGGCAAATGG + Intronic
1069634987 10:69919662-69919684 AAGGGAGACCCAGGAGCAGAAGG + Intronic
1069926182 10:71852316-71852338 CAGGGGCAGCCACAGGCAGAGGG - Intergenic
1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG + Intronic
1070919255 10:80173724-80173746 CAGAGACACCCAATGGCAGGCGG + Intronic
1071570891 10:86696256-86696278 CGGGGGCACCCATTGGCAGGAGG - Intronic
1072197802 10:93131579-93131601 CAGGGAAACGCCTGGGCAGGTGG - Intergenic
1073816450 10:107213128-107213150 CAGGGACACCAATGAGCTGTAGG + Intergenic
1074689400 10:115990808-115990830 CTGGGATTCCCATGGGCAGCTGG + Intergenic
1075003091 10:118812194-118812216 CAGGGACACCCCTAGGCAAATGG + Intergenic
1075436910 10:122451315-122451337 CAGGGACTCCAATGAGCAGCAGG - Intergenic
1076316575 10:129546230-129546252 CAGGGGCAGACAGGGGCAGACGG + Intronic
1076680513 10:132169117-132169139 CAGCGTCACGCATGTGCAGACGG - Intronic
1076842766 10:133054402-133054424 CAGGGGGTCACATGGGCAGATGG + Intergenic
1077084757 11:743731-743753 CAGGAACACCCATGCGCTGCTGG - Intergenic
1077155536 11:1089340-1089362 CAGGGCCAACCTTGGGGAGAGGG - Intergenic
1077365715 11:2160757-2160779 CAGGGGCAGCAATGGGCAGTTGG + Intronic
1078670823 11:13363767-13363789 CAGGGTCACTCTTGGGAAGATGG - Intronic
1078946443 11:16073211-16073233 CAGTGACACCCATAGGCTAAAGG + Intronic
1078960453 11:16261222-16261244 CAGGCACAGCCATTGGCATATGG + Intronic
1079830577 11:25262615-25262637 CAGGGACAACCATGCACACATGG + Intergenic
1080575514 11:33595621-33595643 CAGAGACTCCCATGGTCAGCTGG - Intronic
1082753153 11:57044557-57044579 CAGGCACATCTATGGGGAGAGGG + Intergenic
1083221735 11:61257222-61257244 CAGGAACACCTGTGGGCAGCGGG - Intergenic
1083398816 11:62410052-62410074 CAAGGACACACAGGAGCAGATGG + Intronic
1083411022 11:62492426-62492448 CAGGGAATCCCATGGCCAGGTGG - Intronic
1083781968 11:64923431-64923453 CAGGGACACCAAGGGCCGGATGG + Intronic
1084149719 11:67282432-67282454 CAGGGGCACCCACGGGTACATGG + Exonic
1084363218 11:68682749-68682771 CTGGGCCAGCCGTGGGCAGAAGG - Intergenic
1084650844 11:70488380-70488402 CAGAGCCAACCGTGGGCAGATGG - Intronic
1084653326 11:70501545-70501567 CAGGGACACCTTTGGAAAGAGGG - Intronic
1085294679 11:75424452-75424474 CAGAAACACCCATGGGCATGTGG - Intronic
1087567098 11:99874854-99874876 AAGGGACTCCCATGGCCAAAAGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089576959 11:119451634-119451656 CAGAGACTCCCTTGGGCAGAGGG - Intergenic
1090254693 11:125275256-125275278 AAGTGACAGCCATGGGTAGATGG + Intronic
1091400216 12:176752-176774 CAAGGACACAGAGGGGCAGATGG - Exonic
1091807390 12:3366129-3366151 CAGGGCCACCCAGCGGCACACGG + Intergenic
1092508079 12:9124792-9124814 CAGGCAGACTCCTGGGCAGAAGG + Intergenic
1092918964 12:13213863-13213885 CAGAAACACCCATGGTAAGATGG - Intronic
1094818323 12:34206861-34206883 CACAGACACACATGGGCCGACGG - Intergenic
1094826727 12:34275291-34275313 CAGGGACACCCTTGGGAGGGTGG + Intergenic
1096562277 12:52444748-52444770 CACAGACAACCATGGGAAGAAGG + Intergenic
1096841218 12:54380051-54380073 GAGGGACGTCCAAGGGCAGAGGG + Intronic
1097242161 12:57582949-57582971 CAGGGAAACTCAAGGCCAGAGGG - Intronic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1100776870 12:97984845-97984867 TCAGGACATCCATGGGCAGAGGG + Intergenic
1101541818 12:105672313-105672335 CAGGCACATCCAAGGGGAGAAGG - Intergenic
1102466861 12:113135219-113135241 CCGGGACAGCCATGGGCATGCGG + Intronic
1102929735 12:116852988-116853010 GGGGGACACACAGGGGCAGATGG + Intronic
1102991833 12:117321540-117321562 CAGGGACACAGATGGGGAGAGGG + Intronic
1103699875 12:122843562-122843584 CAGGGGCACCCAGGGGCCCAGGG - Intronic
1105948118 13:25207033-25207055 CTGGGACAACCATGTGCAGAAGG - Intergenic
1107504663 13:41021395-41021417 TAGGGATACCCCTGGGCAGAGGG - Intronic
1107960751 13:45555908-45555930 CACGGACACCCATAGGCAAGTGG - Intronic
1108052122 13:46455941-46455963 CAGGTACACAGGTGGGCAGAGGG + Intergenic
1109539164 13:63750253-63750275 CAGGTACACAGGTGGGCAGAGGG - Intergenic
1109544680 13:63829580-63829602 CAGGTACACAGGTGGGCAGAGGG + Intergenic
1111800502 13:92974841-92974863 CAGGCAGATTCATGGGCAGAAGG - Intergenic
1112356599 13:98678871-98678893 CCGGGACACCCATAGGCAATAGG + Intergenic
1113544791 13:111139833-111139855 CTGGGAAGCCCATGGGCAGCTGG + Intronic
1113588218 13:111480249-111480271 AAGGGACACACATGGGGACATGG - Intergenic
1113768883 13:112896141-112896163 CAGGCACAGCCAGGTGCAGAGGG + Intronic
1117293244 14:54353838-54353860 CATGGGCACACAAGGGCAGAGGG - Intergenic
1118649460 14:67874579-67874601 CAGGGACTGCCTTGGGGAGAGGG + Intronic
1118899154 14:69972400-69972422 TGGGGACAGCCATGGGCAAAGGG - Intronic
1119197286 14:72726463-72726485 CAGGGAAGCTGATGGGCAGAGGG - Intronic
1119261750 14:73241826-73241848 CATGCACACCCGTGTGCAGACGG - Intronic
1119296574 14:73537903-73537925 CAGGAACAGGGATGGGCAGAGGG - Intronic
1121677600 14:95766825-95766847 AAGGGAAAACAATGGGCAGAAGG - Intergenic
1121855475 14:97265634-97265656 CAGGGGCACACATGCACAGAGGG - Intergenic
1123999290 15:25741223-25741245 CTGGCACACACATGGTCAGAGGG + Intronic
1124171199 15:27375460-27375482 CAGGGACAGCCGAGGGCATAAGG + Intronic
1126662772 15:51048667-51048689 CAGGGACACACAGGGACAGAGGG - Intergenic
1128780846 15:70357639-70357661 CTCGGACACCACTGGGCAGACGG + Intergenic
1130877704 15:88028707-88028729 CAAGGACACCCAAGGACAGAAGG + Intronic
1131055018 15:89369975-89369997 CAGAGATAATCATGGGCAGAAGG + Intergenic
1131085629 15:89573469-89573491 CAGAGACAGCCATGCACAGAGGG + Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1131260008 15:90883257-90883279 AGGGGGCACCCCTGGGCAGATGG - Exonic
1131419268 15:92290580-92290602 CAGGGAATGCCATGGGCACACGG + Intergenic
1132095966 15:98985135-98985157 CAGGGACAGCCATGAAGAGATGG + Intronic
1132372325 15:101307538-101307560 CAGAGACAGCCATGGCCAGTTGG + Intronic
1132575090 16:660486-660508 AGAGGACACCCAGGGGCAGACGG - Intronic
1132618778 16:854797-854819 CAGGGTCCCCCACGGACAGAGGG + Intronic
1132977119 16:2716425-2716447 CAGGGACACTCATGGCCAGAGGG - Intronic
1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG + Intronic
1133102225 16:3486419-3486441 GAGGAACAACCCTGGGCAGACGG + Exonic
1134089878 16:11385742-11385764 CAGGCACAGCCATGGACAGAAGG + Intronic
1134426220 16:14148787-14148809 CAGGGAGACACATGGGCTGGAGG - Intronic
1136590221 16:31214150-31214172 CAGGGACTCACAGGGGCAGCTGG - Exonic
1138024475 16:53511881-53511903 CAAGGTCACACATGGACAGAGGG + Intergenic
1139320067 16:66107121-66107143 CAGGGACTCCAACAGGCAGAGGG - Intergenic
1139967635 16:70754552-70754574 CAGGGACAGCCGCGGGGAGAGGG + Intronic
1140761780 16:78115675-78115697 CAGGGACTATCATGGGTAGATGG + Intronic
1142218596 16:88841855-88841877 CAGGGACACCCTTGGGGTGCAGG - Intronic
1142866722 17:2795942-2795964 CATGCACACGCATGGGCACAGGG - Intronic
1143095966 17:4478558-4478580 CAGGAACACCTGTGGACAGAGGG - Exonic
1143625560 17:8108704-8108726 CAGGGACCCCCAGGTGCAGCTGG + Intronic
1143639779 17:8189416-8189438 CAGGGCCGCGCAGGGGCAGAAGG + Exonic
1144782983 17:17817128-17817150 CAGGGCCATCTATGGACAGAGGG + Exonic
1145013524 17:19382841-19382863 CAGGCACACCAAAGGGCAGTGGG + Exonic
1145200632 17:20941749-20941771 CAGGGACAGACATGGGTACAGGG - Intergenic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146952035 17:36913479-36913501 TAGGGAGAGCCAGGGGCAGAAGG - Intergenic
1147776320 17:42904258-42904280 CACGGGCATCCATGGGCAAAGGG + Intronic
1147924961 17:43940593-43940615 CAGGGACTCCTCTGAGCAGATGG - Intergenic
1147993332 17:44348525-44348547 AGGGGACATTCATGGGCAGATGG + Intronic
1148235081 17:45963480-45963502 CAGCCACACCCATGGAAAGAAGG - Intronic
1148515750 17:48215485-48215507 AAGGAACACCATTGGGCAGACGG + Intronic
1149023194 17:51994030-51994052 CAGAGATACACATGGGCAGAAGG + Intronic
1149865873 17:60150745-60150767 GACGGAAACCCACGGGCAGACGG - Intronic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1151182280 17:72337916-72337938 CAGGGGCACACATGTTCAGAGGG - Intergenic
1151834231 17:76572884-76572906 CTGGTACTGCCATGGGCAGAAGG - Intronic
1152125879 17:78446364-78446386 CAGGGGCATCCCTAGGCAGAAGG - Intronic
1152191284 17:78889577-78889599 CAGGGGCACCCAAGGTCAGACGG - Intronic
1152410055 17:80118568-80118590 CAGGAACACCCATGAGAACAGGG - Intergenic
1153596352 18:6729369-6729391 CAGGCACACACATGGACACACGG + Intergenic
1154021727 18:10669096-10669118 CAGGGCCAGCCATGGGCATGTGG - Intronic
1157585214 18:48796673-48796695 CACAGCCACCCAAGGGCAGAAGG + Intronic
1157604961 18:48920617-48920639 CAGGGAGATCCAGGAGCAGATGG + Exonic
1159731405 18:72033013-72033035 TAGGCACACCCTTGGCCAGAAGG - Intergenic
1159904937 18:74081337-74081359 CAGGAGCAGCCATGGGCACAAGG + Intronic
1160445304 18:78922846-78922868 CAGGGTCACCCGTCAGCAGAGGG + Intergenic
1160532272 18:79572367-79572389 CAGGGAAACCCGTGGGCCGTGGG + Intergenic
1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG + Exonic
1160897479 19:1409401-1409423 CATGGACACCCTTGGGAAGTGGG + Intronic
1160915989 19:1496993-1497015 CATGGTCACCCATGCACAGATGG - Intronic
1161167813 19:2797797-2797819 CAGGGACAGCCATGGGGCTATGG - Intronic
1161246309 19:3254295-3254317 CATGTAGACACATGGGCAGATGG - Intronic
1162952931 19:14082498-14082520 TAGGGGCACCCATCGGCCGATGG + Exonic
1162966415 19:14158299-14158321 CAGGGACCCCCATGGAGGGAGGG + Intronic
1163274782 19:16276744-16276766 CAGGGACCCCAATGTGCAGGAGG + Intergenic
1163362765 19:16858266-16858288 CAGGGACAGGGATAGGCAGAGGG - Intronic
1164854551 19:31511071-31511093 CAGGGTCGCTCATGTGCAGAGGG + Intergenic
1165144668 19:33723789-33723811 CAGGGCCACCCCTTGGCAAAAGG - Intronic
1166159859 19:40944449-40944471 GGGGCACACCCATGGGGAGAAGG - Intergenic
1166168810 19:41012416-41012438 GGGGCACACCCATGGGGAGAAGG - Exonic
1167103691 19:47418917-47418939 CTGGGAGACCCAGGGGCGGAGGG + Intronic
1167715399 19:51139797-51139819 CAAGGACACCCGTGGCCAGCAGG + Intergenic
1168116253 19:54222677-54222699 GGGGGCCACCCATGGGCAGCTGG - Intronic
1168119239 19:54242449-54242471 AAGGGCCACACATGGGCAGCTGG - Intronic
1168130069 19:54312264-54312286 AAGGGCCACCCATGGGCAGCTGG - Intronic
1168181103 19:54663615-54663637 AGGGGCCACCCATGGGCAGCTGG + Intronic
925305673 2:2846635-2846657 CAGGGACAGTGATGGGCACAGGG + Intergenic
925544045 2:4999851-4999873 CAGGGAATCCCATGGCAAGAGGG - Intergenic
926113597 2:10197394-10197416 CAGGGAGACTCCTGGGCACAGGG + Intronic
927484226 2:23477859-23477881 CAGAGACACCCCAGGGCAGTGGG + Intronic
927854244 2:26517947-26517969 TATGGACACCCATGGGAAGGCGG - Intronic
930774552 2:55159304-55159326 CAGGGCCACACATGGGAAGCAGG - Intergenic
932435190 2:71699250-71699272 CAGGGGCACCCACTGGCAGGAGG - Intergenic
932488601 2:72104077-72104099 CAGGGACACAGAAGGGCAAAGGG + Intergenic
932815913 2:74861587-74861609 CAAGGTCACCTGTGGGCAGATGG + Intronic
935384421 2:102485896-102485918 CAGGGGCAGGCATGGGCAGAGGG + Intronic
936242805 2:110802478-110802500 AAGGGAAACCCATGGGGAGGTGG - Intronic
936938980 2:117863431-117863453 CAGAGACACCCATGAGCAGAGGG - Intergenic
938764164 2:134449402-134449424 CAGGGACAGCCATGGGGACCTGG + Exonic
945031014 2:205663734-205663756 CAGGGAAGTCCATTGGCAGAAGG - Intergenic
946408835 2:219506588-219506610 CAGGGGCACAGATGGGCAGGAGG + Intronic
948742153 2:240055187-240055209 CAGTGACAACCAAGAGCAGAAGG + Intergenic
1169229185 20:3875740-3875762 CAAGGACACCCAAGGGCAGAGGG - Exonic
1171186551 20:23127588-23127610 CAGGGAAACCCAGGGGCTGTGGG + Intergenic
1172274803 20:33673753-33673775 CAGGGCCACCCATGGCCCCATGG + Intronic
1173208443 20:41013076-41013098 CAGGAACACTCTAGGGCAGAGGG + Intergenic
1174400536 20:50273585-50273607 CAGGGACACCCAGCCGGAGATGG + Intergenic
1175341015 20:58228814-58228836 CAGGGAGACCGATGGGCGGGCGG + Intergenic
1175871758 20:62212609-62212631 CAGGGCCTCCCAGAGGCAGAAGG + Intergenic
1176164864 20:63667583-63667605 CAGGGACACCCCTGGACATCAGG - Intronic
1176176959 20:63733216-63733238 CAGGTTCTCCCATGGGCAGGTGG + Exonic
1176241193 20:64076710-64076732 CAGGGCTACCCATGGGAAGGTGG - Intronic
1177608095 21:23408189-23408211 CAGGGGCACACATGGCCAGAGGG + Intergenic
1177746523 21:25221891-25221913 CAGGCACAAACAAGGGCAGATGG - Intergenic
1178356467 21:31913675-31913697 CATTGGCACTCATGGGCAGATGG + Intronic
1178497453 21:33099336-33099358 TTGGGGCACCCTTGGGCAGAGGG + Intergenic
1179030935 21:37718958-37718980 CAGGTGCATCCATGGGGAGATGG + Intronic
1179837946 21:44049832-44049854 CAGGAAAACCCATGAGCAGTGGG - Intronic
1180261307 21:46670953-46670975 AAGGGAGACCCTTGGTCAGATGG - Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1181258271 22:21578594-21578616 CAGGCACACCCATGTACAGATGG + Intronic
1182517036 22:30864811-30864833 CAGTGACACCCATGAGGGGACGG + Intronic
1183618584 22:38959731-38959753 CAGGGACATTCATAGGTAGAAGG + Intronic
1183623786 22:38989655-38989677 CAGGGACACTCATAGATAGAAGG + Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1183738223 22:39655578-39655600 CAGGGACACGGATGTGAAGAAGG - Intronic
1183849192 22:40569856-40569878 CTGGGATGACCATGGGCAGAAGG + Intronic
1184493295 22:44823031-44823053 GAGGGAGACACAGGGGCAGAGGG - Intronic
1184683338 22:46084852-46084874 CAGGGATGCCCGTGGGAAGAAGG + Intronic
1185000930 22:48245086-48245108 CACGGACACTCCTGGCCAGACGG - Intergenic
1185096010 22:48806429-48806451 CCAGGACAGCCAGGGGCAGAGGG + Intronic
1185270227 22:49926573-49926595 CAGGGCCAGCCCAGGGCAGAGGG - Intronic
1185337945 22:50279106-50279128 CAGCGGCACCCTTGGGCAGCAGG + Intronic
950173081 3:10852685-10852707 CAGGGAGACCCATGTGCACGGGG - Intronic
950725987 3:14917370-14917392 CAGGGAGACCCCAGGGGAGAAGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954408495 3:50358859-50358881 CCTGGCCACCCATGGGCTGATGG - Exonic
954991110 3:54841508-54841530 CAGGGACAGCCATGGCCAAATGG + Intronic
955034694 3:55255879-55255901 CAGGGACAGCCCTGTGGAGAAGG - Intergenic
959265657 3:104134077-104134099 CAGGGACACACATGAGGAGTGGG - Intergenic
960117003 3:113905201-113905223 AAGGGGCTCCCATTGGCAGAGGG - Intronic
960502715 3:118456443-118456465 CAGGTACACCCACTTGCAGAGGG - Intergenic
962280710 3:134049713-134049735 CAGGGACACCAATGGTTAGGTGG - Intronic
962709089 3:138070766-138070788 CAGGGACACATGTGGCCAGAAGG - Intronic
965578533 3:170243629-170243651 CAGGCACATCCTTGGGCAGATGG + Intronic
967622002 3:191644509-191644531 CAAGGACACCCATAGGCTCAAGG + Intergenic
968188358 3:196649364-196649386 CATGGACACACAAGGGCACACGG - Intronic
968658563 4:1789332-1789354 CAGGGGGTCCCATGGGCAGAAGG + Intergenic
968914042 4:3489439-3489461 CAGGGCCATCCACGGGCACAGGG + Intronic
969486448 4:7474954-7474976 CAGGGACAGTCATGTGAAGATGG - Intronic
971479024 4:27098125-27098147 GAGGGACAGCCATTTGCAGAAGG + Intergenic
972712195 4:41608808-41608830 AAGGGACACCCATGGGGACGAGG + Intronic
973706777 4:53588896-53588918 CAAGGTCACCCAAGGGCACAGGG + Intronic
974232389 4:59133537-59133559 AAGGGACACACATGGACAAAAGG - Intergenic
976086098 4:81408680-81408702 CTGGAACAGCCATGGGCAGAGGG + Intergenic
976504574 4:85832104-85832126 CAGGGTCAGTCAGGGGCAGAGGG + Intronic
976694713 4:87907027-87907049 CTGGGACACCCACTGGCACAGGG + Intergenic
977440124 4:97055301-97055323 CATGGACACCTATGAGCTGAAGG + Intergenic
978455891 4:108890862-108890884 CAAAGCCAGCCATGGGCAGAGGG - Intronic
980708944 4:136539122-136539144 CAAGAAAACCCTTGGGCAGATGG - Intergenic
985717755 5:1472147-1472169 GAGGAGCACCCAAGGGCAGAGGG + Intronic
985717784 5:1472253-1472275 GAGGAGCACCCAGGGGCAGAGGG + Intronic
985801108 5:2005722-2005744 CAGGGACACTCTTGGGGAGCTGG + Intergenic
986422536 5:7599161-7599183 CAGGGATAGCCCGGGGCAGATGG + Intronic
986579954 5:9255564-9255586 CAGGATGAGCCATGGGCAGAAGG - Intronic
988497550 5:31758021-31758043 CAGGGACTGCTGTGGGCAGAAGG - Intronic
989181575 5:38582820-38582842 CAGGGAATTCCCTGGGCAGAAGG - Intronic
991484848 5:67124196-67124218 CAGGAAAACCCAAGGGTAGAAGG - Intronic
994108604 5:95975046-95975068 CAGTGGCATGCATGGGCAGAAGG + Intergenic
995332902 5:110965467-110965489 CAGGGACAGCCTAGGGCTGATGG + Intergenic
995735075 5:115291820-115291842 CATGGACACCAAAAGGCAGAGGG - Intronic
997104387 5:131002280-131002302 CAGGGAAACCACTGGGCTGATGG + Intergenic
997735637 5:136210670-136210692 GAGAGAGACCCAAGGGCAGATGG - Intergenic
999240084 5:150122345-150122367 CAGGCACTCCCATGGCCAGGTGG - Intronic
999526350 5:152410450-152410472 GGGTGACACCCATGGACAGAGGG + Intronic
1000976890 5:167774804-167774826 CAGAGAAACCCATGGGCATGGGG - Intronic
1002521352 5:179794710-179794732 CTGTGACACCCATCTGCAGAGGG + Intronic
1005279981 6:24262742-24262764 CAGACACACCCAGGGCCAGAAGG + Intronic
1005973334 6:30778549-30778571 GAGGGACCACGATGGGCAGAGGG + Intergenic
1006179788 6:32147958-32147980 CAGGAACAGCTATGGGCAGCTGG + Intergenic
1006191848 6:32214160-32214182 CAGGTCCCCCCATGGGCACAGGG + Exonic
1006373243 6:33658107-33658129 CGGGGACACACATGCACAGAGGG - Intronic
1007693291 6:43716441-43716463 CTGGGACATGCAGGGGCAGAGGG + Intergenic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1013179974 6:107709162-107709184 AAGGGAGACCCATTGGGAGATGG - Intronic
1014611511 6:123553458-123553480 CAGGCAGAGTCATGGGCAGAAGG - Intronic
1015289254 6:131520015-131520037 CAGGCACATCTATGGGCAGTTGG - Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1017514146 6:155140848-155140870 CAGTGACAGCCATGGGCACGTGG + Intronic
1018857204 6:167683302-167683324 CAGGGAAACCCACACGCAGACGG - Intergenic
1018890067 6:167976862-167976884 CAGGAAGACCCAGGGGCAGGAGG - Intergenic
1018911070 6:168101206-168101228 CAGGGACCCCCATGGGCCGGCGG + Intergenic
1019187628 6:170230034-170230056 CAGGGACACCCAGGAGCAAAAGG + Intergenic
1019639453 7:2095705-2095727 CAGGGACACACAGGCGCACAAGG + Intronic
1019947018 7:4338039-4338061 CAGGGATACCCAAGGGCTCAGGG - Intergenic
1020051028 7:5081773-5081795 CAGAAATACCCATGGGGAGAGGG - Intergenic
1024623447 7:51183812-51183834 CCGGAACACCCACAGGCAGAAGG + Intronic
1024670559 7:51589990-51590012 CAGGGCCATCCAGAGGCAGAGGG - Intergenic
1026731206 7:72913342-72913364 CAGAGAAAGTCATGGGCAGATGG + Intronic
1026873187 7:73865548-73865570 CAGGGAGACAGATGGGCAGGTGG - Intronic
1027112875 7:75454727-75454749 CAGAGAAAGTCATGGGCAGATGG - Intronic
1027285121 7:76639338-76639360 CAGAGAAAATCATGGGCAGATGG - Intergenic
1029548600 7:101224298-101224320 CAGGGACACAGAGGGGCGGACGG - Intergenic
1029556908 7:101276707-101276729 CAGTGACACCCACAGGCAGAAGG + Intergenic
1029691185 7:102183112-102183134 GAGAGACACCCAAGGCCAGAGGG - Intronic
1032681549 7:134189727-134189749 CAAGGACACCAATAGACAGAGGG + Intronic
1034190072 7:149207237-149207259 GAGGGACACCCAGGAGGAGAGGG + Intronic
1035826895 8:2654244-2654266 CAGTGAGACCCATGGACAGGTGG + Intergenic
1036014545 8:4767829-4767851 GAGGGACACTCCTGGGCAGTTGG - Intronic
1036461432 8:8956841-8956863 AGGGGACAAGCATGGGCAGAGGG - Intergenic
1039398385 8:37247060-37247082 CAGGGAAGCACATGGTCAGAGGG - Intergenic
1043069446 8:75620415-75620437 CAGCCACACCCATGGGAAGGAGG + Intergenic
1043562620 8:81512018-81512040 AAGGGACACCAAAGGGCAGGAGG + Intergenic
1047313127 8:123708881-123708903 CAGAGAAGGCCATGGGCAGATGG - Intronic
1047358293 8:124144115-124144137 GAGGGACAGCCATGGGCAGGAGG - Intergenic
1047692179 8:127367007-127367029 CAGGGAGTCCCATGGGTAGAAGG + Intergenic
1047803284 8:128332047-128332069 TAGGGTCACACATGGGCAGAGGG + Intergenic
1049657385 8:143804846-143804868 CAGGGAGGCCCAAGGGCAGAAGG + Intronic
1050865230 9:10489220-10489242 TAGACACACCCAGGGGCAGAAGG - Intronic
1051343094 9:16129206-16129228 CAGGGACAGGACTGGGCAGAGGG + Intergenic
1051347411 9:16164703-16164725 CAGAGACACCCATGGAGTGAAGG + Intergenic
1053222653 9:36325080-36325102 AAGGCACACCCATGGGCACAGGG + Intergenic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1055115912 9:72605490-72605512 GAGGGACAACCATGTGAAGAGGG - Intronic
1055732408 9:79291944-79291966 CAGTGAATCCCATGGGCTGAAGG + Intergenic
1056933391 9:90897144-90897166 CATGGACAGCCATGGACAGCAGG + Exonic
1060526039 9:124321878-124321900 GGGGGCCAGCCATGGGCAGAAGG + Intronic
1060586642 9:124790707-124790729 CAGGGACCCCCAAGAGGAGAAGG + Intronic
1060936653 9:127519908-127519930 CAGGCACTCCCACGGGGAGAGGG + Intronic
1061877417 9:133551400-133551422 TAGGCACACCCAGGGCCAGAGGG - Intronic
1061887429 9:133598939-133598961 CAGGGAGAGCCCAGGGCAGATGG + Intergenic
1062277465 9:135737607-135737629 CCGGGACAAGCATGGGGAGATGG + Intronic
1188181178 X:27057843-27057865 CAGGGACACACATGAGCAGTGGG + Intergenic
1188997401 X:36902988-36903010 CACTGACACCCATGGACGGAAGG - Intergenic
1189383794 X:40520559-40520581 GAGGGAGGCCCAAGGGCAGAAGG + Intergenic
1190036910 X:47033815-47033837 CAGGGACACCCTGGAGCAAATGG - Intronic
1190143453 X:47868749-47868771 CGGGGACAGCCAAGGGCAAAAGG - Intronic
1192503597 X:71668158-71668180 CAGGGACACCCGTCCCCAGAAGG + Intergenic
1192510417 X:71717787-71717809 CAGGGACACCCGTTCCCAGAAGG - Exonic
1192516280 X:71763766-71763788 CAGGGACACCCGTTCCCAGAAGG + Exonic
1193507607 X:82363016-82363038 CAGGGGCAGCCAAGGGCACATGG + Intergenic
1194447293 X:94004149-94004171 CAGGGACACACGTGGTCAGAGGG + Intergenic
1194450143 X:94035194-94035216 CAGGGGAACCCATGAACAGAGGG - Intergenic
1195265736 X:103177910-103177932 CAAAGACATCCAGGGGCAGAAGG - Intergenic
1196572041 X:117277604-117277626 CAGAGACACTCATGGGAAAAAGG + Intergenic
1197347184 X:125337895-125337917 CAGGGACACACATGTGCAGGTGG + Intergenic
1197737471 X:129862369-129862391 CAGGGACACACATGCATAGAGGG + Intergenic
1197782650 X:130172619-130172641 CAGCGGCACCTGTGGGCAGAGGG + Intronic
1200066162 X:153505050-153505072 CAGGGACACTGACGGGCACACGG - Intronic
1200796533 Y:7346115-7346137 CAGGGACACCCATAGGCAGGGGG - Intergenic