ID: 1183640373

View in Genome Browser
Species Human (GRCh38)
Location 22:39089005-39089027
Sequence CACCCTGGTCCCCTGTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183640373_1183640379 7 Left 1183640373 22:39089005-39089027 CCCCCTTACAGGGGACCAGGGTG 0: 2
1: 0
2: 0
3: 7
4: 140
Right 1183640379 22:39089035-39089057 GGTGAAGCCTGCACCTGTGAAGG No data
1183640373_1183640380 10 Left 1183640373 22:39089005-39089027 CCCCCTTACAGGGGACCAGGGTG 0: 2
1: 0
2: 0
3: 7
4: 140
Right 1183640380 22:39089038-39089060 GAAGCCTGCACCTGTGAAGGAGG 0: 2
1: 0
2: 1
3: 22
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183640373 Original CRISPR CACCCTGGTCCCCTGTAAGG GGG (reversed) Intergenic
900112031 1:1011584-1011606 CTCCCTGGCCCCCGGTAACGGGG + Intergenic
900139712 1:1134592-1134614 CACTCTGGGCCCCTGTTCGGCGG - Intergenic
900297642 1:1960001-1960023 CCCCCTGGCCCCCTGTCAGCCGG - Exonic
900509085 1:3049945-3049967 GAACATGGTCCCCTGTGAGGAGG - Intergenic
901033809 1:6324116-6324138 CAGCCTGGTCTCCTGTATGGTGG - Intronic
902957817 1:19938018-19938040 CAACCTGGATCCCTGAAAGGCGG - Intergenic
903227989 1:21904609-21904631 CTTCCTGGTTCCCTGTAAGCTGG - Intronic
904538932 1:31219617-31219639 CGCCCAGGTCCCCTGTAGCGGGG + Intronic
905521675 1:38605275-38605297 CATCCTTGTCCCCTGTAAGCTGG - Intergenic
913395527 1:118366995-118367017 CACCTTGGCCCCATGTAACGGGG - Intergenic
915366790 1:155321298-155321320 CACCCAGATGCCCTGAAAGGAGG - Intronic
919243129 1:194940353-194940375 CACCCTCCTACCCTGTAAGAAGG + Intergenic
919519490 1:198570176-198570198 GAGCCTGGTCCTCTGTCAGGAGG - Intergenic
1062767426 10:76264-76286 GACCCTGGTCCCCGGAGAGGAGG - Intergenic
1063424736 10:5942253-5942275 CACACAGGTCCCCAGTGAGGAGG - Intronic
1063536516 10:6889367-6889389 CACCCTGGGACCCTGTAAAATGG + Intergenic
1068504889 10:57887900-57887922 CACCCTGGGGGCCTGTCAGGGGG + Intergenic
1070810918 10:79297809-79297831 CTCCCTGGTCCCCTGTCCTGGGG + Intronic
1070972951 10:80582499-80582521 CACCCTGGGCCCCAGTGCGGGGG - Intronic
1073541532 10:104319456-104319478 CACCCTGGCCCCCAGCAAAGGGG + Intronic
1075640131 10:124058637-124058659 CACCCGTCTCCCTTGTAAGGAGG + Intronic
1075724428 10:124604246-124604268 CACCCAGCTACCCCGTAAGGAGG + Intronic
1076414108 10:130272934-130272956 CACCCTGGACCCGTGGGAGGAGG + Intergenic
1076546565 10:131249366-131249388 CACCCGGGTCCCCAGTATAGGGG + Intronic
1077022866 11:426976-426998 AACCCTGGTCTCCTGTCTGGAGG - Intronic
1077137118 11:1006055-1006077 CAGCCGGGTCCCCTGACAGGAGG + Intronic
1077326669 11:1966988-1967010 CAGGCTGGTCCCCAGTGAGGAGG + Intronic
1078867176 11:15308605-15308627 CATCCTGGTTCCCAGAAAGGAGG + Intergenic
1081620486 11:44616440-44616462 CTCCCAGGTCCCTTGTCAGGTGG - Intronic
1083720689 11:64602140-64602162 GGCCCTGGACCCCTGGAAGGGGG - Exonic
1084321688 11:68376952-68376974 CACCAGGGTCCCCAGCAAGGGGG + Intronic
1084416373 11:69035281-69035303 CACCATGCACCCCTGCAAGGAGG - Intergenic
1086448417 11:86891717-86891739 CCACCTGGTCCCTTGTAACGTGG - Intronic
1087660217 11:100978786-100978808 CAGCCTGGTACTCTGTAAGCTGG + Intronic
1088251551 11:107865400-107865422 CACCCTGTTCCTTTGAAAGGTGG - Intronic
1089993851 11:122886161-122886183 CGCCCTGGTCCCAGGTATGGTGG - Exonic
1202809650 11_KI270721v1_random:22168-22190 CAGGCTGGTCCCCAGTGAGGAGG + Intergenic
1098550424 12:71755358-71755380 CGCCCTGGTCCCCTGGATGTAGG + Intronic
1101080230 12:101173947-101173969 CACTCTGGTCCCCAGTAACTGGG - Intronic
1101909032 12:108849031-108849053 TAACCTGGTCCCCAGAAAGGCGG + Intronic
1103446203 12:120996729-120996751 CACCCTGGTCATCGGTAAGCTGG + Exonic
1104783888 12:131437674-131437696 CACCCTGGGTGCCTGTGAGGTGG + Intergenic
1110551700 13:76818049-76818071 CACTCTGCTCCTCTGTAAAGTGG + Intergenic
1111231829 13:85354218-85354240 CACTCTGGAACCCTGGAAGGAGG + Intergenic
1112497263 13:99915123-99915145 TACCCTGGTTTCCTGGAAGGAGG - Intergenic
1113432231 13:110261196-110261218 CAGCCTGCTCCCCAGGAAGGGGG + Intronic
1113472258 13:110555431-110555453 CACCCTGATCCCTTCTCAGGTGG + Intronic
1117251847 14:53946834-53946856 CCCCCTGGTCCCCCGCAGGGAGG + Intergenic
1118710350 14:68513647-68513669 CTCTCTGCTCCCCTGTGAGGTGG - Intronic
1119663218 14:76465962-76465984 CAGCCTGGGCCCCTGCCAGGTGG + Intronic
1122691712 14:103534826-103534848 CTCCCTGGTGCCCTGGGAGGCGG - Exonic
1128798314 15:70480466-70480488 CACCCTGATCCCCAGAAATGAGG + Intergenic
1132023484 15:98384708-98384730 CACTCTGGTGCCCTTTCAGGCGG - Intergenic
1132496600 16:266343-266365 CACCCTGGCCCCATGCAAGCGGG + Intronic
1134568153 16:15268833-15268855 CAGCCTGCTCACCTGTCAGGTGG - Intergenic
1134734280 16:16487522-16487544 CAGCCTGCTCACCTGTCAGGTGG + Intergenic
1134933221 16:18224757-18224779 CAGCCTGCTCACCTGTCAGGTGG - Intergenic
1138656483 16:58494545-58494567 CACCCTTGTGGCCTGTAAGATGG + Intronic
1139848202 16:69935204-69935226 CACCCGGCTCCCCTCTTAGGAGG + Intronic
1146565321 17:33908081-33908103 CACACTGGGACACTGTAAGGAGG - Intronic
1146577625 17:34008689-34008711 CACACTTGGCCCCTGTATGGAGG + Intronic
1147214040 17:38888871-38888893 CAGCCTGGTCCCCAGGAAGAGGG - Intronic
1151888896 17:76940561-76940583 CATCCTGGTCCCCGATCAGGAGG + Intronic
1152239123 17:79152437-79152459 CACCCTAGTCCCCCCTAAGGAGG - Intronic
1154109995 18:11559627-11559649 CAGCTTCCTCCCCTGTAAGGAGG - Intergenic
1156521451 18:37725218-37725240 CACACTGGTCACATGTCAGGGGG + Intergenic
1163761994 19:19142292-19142314 CACCCTCATCCCCAGTGAGGTGG - Intergenic
1163867790 19:19788876-19788898 CACCTTGGTGCCCAGTAATGAGG - Intronic
1164107557 19:22122115-22122137 CACCCTGGTGCTGTGTAATGAGG - Intergenic
1166528154 19:43526245-43526267 CAGCCTGGGCCCCACTAAGGCGG + Exonic
1168196366 19:54777004-54777026 AACCCTGGTACCCTGTTGGGAGG - Intronic
926397082 2:12454447-12454469 CTCACTGGTCATCTGTAAGGAGG + Intergenic
931978419 2:67668309-67668331 CACCCTGGTTTCCTGGAAGGTGG - Intergenic
933832253 2:86220283-86220305 ATCCCAGATCCCCTGTAAGGAGG - Intronic
934046856 2:88179432-88179454 CACCCTGACCCCGTGTGAGGTGG + Intronic
934730513 2:96653712-96653734 CAAACTGGTCCCCAGCAAGGTGG + Intergenic
937043555 2:118838709-118838731 TGCCCTGCTCCCCTGTATGGTGG + Intergenic
938117592 2:128612421-128612443 CCTCCTGGGCCGCTGTAAGGCGG - Intergenic
938202570 2:129387326-129387348 CAACCTGGATCCCTGGAAGGTGG - Intergenic
939637961 2:144606196-144606218 GACCCTGGTCCCCTCTCAGGTGG - Intergenic
944933797 2:204546032-204546054 CATCGTGGTGCCCTGCAAGGAGG + Exonic
946001362 2:216485287-216485309 CACCCAGATCCCCTTCAAGGAGG + Intergenic
947949377 2:234134493-234134515 AACCCTTGTCACCTGTAAAGGGG + Intergenic
1169329622 20:4706166-4706188 CACCCTGGGCACCTGGAATGTGG - Intergenic
1170129147 20:13000300-13000322 CACGCAGTTCCCCTGAAAGGAGG + Intergenic
1170770826 20:19331050-19331072 CTCCCTGGTCTCCTCTAATGTGG - Intronic
1171083084 20:22208591-22208613 CACACTGGTAGCCTGTCAGGGGG - Intergenic
1173657626 20:44711360-44711382 CACCCTGGGCCCTTGTGTGGGGG + Intergenic
1173977155 20:47195680-47195702 CTCGCTGGTCACCTCTAAGGAGG + Intergenic
1174381669 20:50159731-50159753 CACTCTTGTCCCTTGTCAGGAGG - Intergenic
1175212965 20:57373034-57373056 CACCCTGTTACCCTGTGAGACGG + Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1176002418 20:62838673-62838695 CACCCTGGTTTCCTGTCACGAGG - Exonic
1176969046 21:15244719-15244741 CACCCTCATTCCATGTAAGGTGG - Intergenic
1178249586 21:30989472-30989494 GACCCTGGTTCCCATTAAGGAGG - Intergenic
1181348652 22:22239526-22239548 GAGCCTGGTCCCCTGTCAGTGGG + Intergenic
1183619573 22:38964714-38964736 CACCCTGGTCCCCTGTAAGGGGG - Intronic
1183640373 22:39089005-39089027 CACCCTGGTCCCCTGTAAGGGGG - Intergenic
1185268903 22:49919175-49919197 CACCCTGGACCCGGGTCAGGTGG + Intronic
1185402557 22:50626451-50626473 CACCTTGGGCCCCTGCAACGTGG + Intronic
952881067 3:37986659-37986681 AACCCTGGGCCCCTGCAAAGAGG - Intergenic
953213734 3:40898506-40898528 CACCTTTGTCCCCTGTATGCTGG - Intergenic
954532819 3:51335558-51335580 CTCCCTGTTCCCCTGTATGGGGG + Intronic
962686850 3:137856255-137856277 CACTCTAGTCCACTCTAAGGTGG + Intergenic
962988771 3:140559814-140559836 CACCCTGGTCCCTAGTGAAGGGG + Intronic
967998349 3:195183766-195183788 CACCCTGGTCCCCAGGAAAGGGG + Intronic
968872732 4:3249913-3249935 CACCCTGCTCCCCCATAGGGAGG + Intronic
969545481 4:7823849-7823871 CAACCTGGTGCCCAGCAAGGGGG + Intronic
972148905 4:36064639-36064661 CAACCTGGTTCCCTGTGGGGAGG + Intronic
974162417 4:58156959-58156981 CACTCTGGTCCCCTGCAATCTGG - Intergenic
974866407 4:67586505-67586527 CAGCCTGATCCCTTTTAAGGTGG + Intronic
975673454 4:76804095-76804117 CACTCTGCTTCTCTGTAAGGGGG - Intergenic
976912711 4:90327135-90327157 CACCATTTTCCCCTGTAAGAGGG + Intronic
979338248 4:119488690-119488712 CACCCTGGTCCAGTGCAAGCTGG - Intergenic
979831748 4:125314240-125314262 CCCCCTAGTCACCTGGAAGGTGG + Intergenic
992615659 5:78543677-78543699 CACCTTGGTCCCCTGTATCCTGG - Intronic
992990158 5:82275629-82275651 CATCTTGGGCCCCTGTAAGATGG + Exonic
994992438 5:107014452-107014474 CACCCTGGTGGCCTGGAAGCAGG + Intergenic
995839610 5:116430866-116430888 CACCATGGTCCTCCTTAAGGTGG - Intergenic
996801462 5:127408153-127408175 CACACTGGTTCCCTGTAATTTGG + Intronic
997207141 5:132056622-132056644 AGACCTGGTCCCCTGTAAGATGG - Intergenic
1003519688 6:6847776-6847798 CATCCTGGTCACCTGGAATGTGG - Intergenic
1004956719 6:20735380-20735402 CCTCCTGCTCCCCTGTAAAGAGG - Intronic
1006059888 6:31411897-31411919 AGCCCTGCTCCCCTCTAAGGAGG - Intronic
1006451798 6:34109624-34109646 CACCCATGTCACCTGGAAGGAGG + Intronic
1009990857 6:70841317-70841339 CAGCCTGGTTCCTTGTCAGGAGG + Intronic
1017670377 6:156764788-156764810 CACACTGGTCCCCTGCTTGGAGG + Intergenic
1018857886 6:167688509-167688531 TTCCCTGGTGCCCTGCAAGGAGG - Intergenic
1019057099 6:169231804-169231826 CCCCCTGGTCCCCTCTCTGGAGG - Intronic
1019305977 7:335934-335956 AACCCTGGTGCCCTGTGAGTGGG - Intergenic
1019706567 7:2499809-2499831 CACCCTGGACCCCTGTTTAGTGG + Intergenic
1021858196 7:24878924-24878946 CAGCCTGGTCTCCTGGAATGTGG - Intronic
1023045827 7:36209396-36209418 CCACCTGGTGCCCTGTGAGGAGG + Intronic
1024551218 7:50564020-50564042 CACCCTGGTCTCCAGGAAAGGGG - Intronic
1026929194 7:74213795-74213817 CACCCTGGCCACCAGTGAGGAGG - Intronic
1027596763 7:80184057-80184079 CCCACTGGTCTCCTTTAAGGAGG - Intronic
1044848854 8:96408454-96408476 CACCATGGTCCCCGTCAAGGAGG + Intergenic
1047764764 8:127981386-127981408 CTTCCTGGTGCCCTGTCAGGAGG - Intergenic
1049256037 8:141614409-141614431 CACCCTGGGCCCCGGGGAGGGGG - Intergenic
1050360573 9:4826875-4826897 CAGCCTGGCCTCCTGTATGGTGG + Exonic
1053281074 9:36820098-36820120 CTCCCTGGTCCCCGGGCAGGGGG + Intergenic
1058896779 9:109407165-109407187 CAACGTGGTTCACTGTAAGGAGG + Intronic
1059346515 9:113632619-113632641 AACACTGGGCCCCTGGAAGGTGG + Intergenic
1062265441 9:135684720-135684742 CAGCCTGGTCCCCTCTGGGGAGG + Intergenic
1062267157 9:135692455-135692477 CATCGTGGTCCCTTGGAAGGAGG - Intergenic
1191858086 X:65643737-65643759 CTTCTTGGTCCCCTGTCAGGTGG + Intronic
1194412857 X:93578089-93578111 CACCCTGGGCCCCTGAAACATGG - Intergenic
1198320740 X:135516634-135516656 CACCCTGCTCCCATGAAAGATGG + Intergenic
1199883942 X:152000091-152000113 CAGACTGGTACCCTGTAATGGGG + Intergenic