ID: 1183640662

View in Genome Browser
Species Human (GRCh38)
Location 22:39090614-39090636
Sequence CCTCCACCCAGGAAGCCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183640654_1183640662 -2 Left 1183640654 22:39090593-39090615 CCCACAAGTTCTGGTCCAGCCCC No data
Right 1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG No data
1183640655_1183640662 -3 Left 1183640655 22:39090594-39090616 CCACAAGTTCTGGTCCAGCCCCT No data
Right 1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG No data
1183640651_1183640662 22 Left 1183640651 22:39090569-39090591 CCTGACGTGATGGCAGTCTTCCT No data
Right 1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG No data
1183640653_1183640662 2 Left 1183640653 22:39090589-39090611 CCTGCCCACAAGTTCTGGTCCAG No data
Right 1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183640662 Original CRISPR CCTCCACCCAGGAAGCCCTC GGG Intergenic
No off target data available for this crispr