ID: 1183643423

View in Genome Browser
Species Human (GRCh38)
Location 22:39107351-39107373
Sequence ATGTCCTTCTAGAAGAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183643423_1183643426 18 Left 1183643423 22:39107351-39107373 CCTTTACTCTTCTAGAAGGACAT No data
Right 1183643426 22:39107392-39107414 TCCATAGTTTAGAATAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183643423 Original CRISPR ATGTCCTTCTAGAAGAGTAA AGG (reversed) Intergenic
No off target data available for this crispr