ID: 1183644656

View in Genome Browser
Species Human (GRCh38)
Location 22:39117522-39117544
Sequence AACCGAAGGCTTCTTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183644654_1183644656 1 Left 1183644654 22:39117498-39117520 CCAGGAAATATGGCTATCAATTA No data
Right 1183644656 22:39117522-39117544 AACCGAAGGCTTCTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183644656 Original CRISPR AACCGAAGGCTTCTTCTCAA AGG Intergenic
No off target data available for this crispr