ID: 1183648094

View in Genome Browser
Species Human (GRCh38)
Location 22:39138417-39138439
Sequence CCGGGGAAGACAGCCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183648094_1183648103 -3 Left 1183648094 22:39138417-39138439 CCCACCCAGGCTGTCTTCCCCGG 0: 1
1: 0
2: 4
3: 19
4: 226
Right 1183648103 22:39138437-39138459 CGGGCACCAGCCCCACACGCAGG 0: 1
1: 0
2: 1
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183648094 Original CRISPR CCGGGGAAGACAGCCTGGGT GGG (reversed) Intronic
900325076 1:2104645-2104667 CAGGGGAAGCCAGTGTGGGTGGG + Intronic
900534675 1:3170952-3170974 CTGGGGAGGACAGCCTCGTTTGG - Intronic
902544904 1:17184092-17184114 CCTGGGATGCCAGCCTGGCTCGG - Intergenic
903283449 1:22263144-22263166 CAGGGGACCACAGCCTGGCTTGG - Intergenic
903327445 1:22577521-22577543 CCAGGGAGTACAGTCTGGGTTGG + Intronic
905926972 1:41758156-41758178 CCGGGGAAGGCAGCCTTGGTTGG - Intronic
906116930 1:43363447-43363469 CCTGGGAATACAGCCTGTGGAGG - Exonic
911086392 1:93980816-93980838 TCGGGGAAGACAGCGTGGAGGGG + Intergenic
912271609 1:108216251-108216273 CTGTGCAAGACAGCCAGGGTGGG + Intergenic
913300678 1:117366755-117366777 CCCGGGCAGCCAGGCTGGGTGGG + Intergenic
917505495 1:175623581-175623603 CTGGGGAAGAAAGCCTGGTTAGG - Intronic
917523016 1:175763511-175763533 CCAGGGCAGACAGCCTTGGAAGG + Intergenic
919535014 1:198776647-198776669 CCAGCTAAGACAGGCTGGGTGGG - Intergenic
919739738 1:200974421-200974443 CGGGGGAAGACAGCCAGGGCAGG + Intronic
919766734 1:201132218-201132240 GCAGGGAAGTCAGACTGGGTGGG + Intergenic
920184308 1:204151028-204151050 CTGGGGAAGATGGCCTGTGTGGG + Intronic
920369300 1:205467823-205467845 CTGGGTCAGACTGCCTGGGTTGG - Intergenic
920544981 1:206808893-206808915 CAGGAAAGGACAGCCTGGGTGGG + Intronic
923070805 1:230562781-230562803 CTGGAGGAGACAGTCTGGGTTGG - Intergenic
923686979 1:236160369-236160391 CCGGGGAAGTGAGGTTGGGTTGG - Intronic
923819825 1:237426240-237426262 CCAGGAAAGACAGTCAGGGTAGG + Intronic
1066012772 10:31209671-31209693 CAGGGGAAGCCAGCCAGGCTGGG - Intergenic
1067247282 10:44557512-44557534 CCGGGAAAGGCAGCAGGGGTAGG - Intergenic
1067466413 10:46502238-46502260 CCAGGGTAGCCAGCCTGGCTTGG - Intergenic
1067620775 10:47882367-47882389 CCAGGGTAGCCAGCCTGGCTTGG + Intergenic
1068523829 10:58106010-58106032 CCTGGGTAGACAGGCTGGGCAGG + Intergenic
1069800834 10:71080565-71080587 TCGGGGAGGCCAGCCTGGGCTGG - Intergenic
1070752916 10:78974320-78974342 CCTGTGAAAACAGCCTGGGAGGG + Intergenic
1070783568 10:79150699-79150721 CCTGTGAAGACAGCCAGGCTTGG + Intronic
1072197228 10:93126567-93126589 AGGGAGAACACAGCCTGGGTGGG + Intergenic
1072456246 10:95578929-95578951 ACTGGGATGACAGACTGGGTGGG + Intergenic
1074870188 10:117570064-117570086 CCCAGGAAGTCAGCCTGGGAAGG - Intergenic
1076036463 10:127202425-127202447 CCGGGGCAGAAGGCCTGGGAAGG - Intronic
1076078972 10:127560748-127560770 CTGGAGAAGACAGCCTGCGGGGG + Intergenic
1076495329 10:130893374-130893396 CCGGGGAAGACACCCAGGGAAGG - Intergenic
1076727358 10:132419845-132419867 CCTGGGAAGACAGCCAGGGTTGG - Intergenic
1076818738 10:132927540-132927562 CCGGGGCACACAGCCTGGGGTGG - Intronic
1077300271 11:1843454-1843476 CCGGGGCAGACACGCTGTGTGGG + Intergenic
1077491311 11:2862270-2862292 CAGAGGAACCCAGCCTGGGTGGG + Intergenic
1078543310 11:12228737-12228759 ACAGGGAAGCCAGCCAGGGTCGG + Intronic
1079103131 11:17553645-17553667 CAGGTGCAGACTGCCTGGGTGGG - Intronic
1081356467 11:42120488-42120510 GCAGGGAAGACAGCATGTGTAGG - Intergenic
1081537395 11:44005643-44005665 CCGGGGAAGCCAGAATGAGTTGG - Intergenic
1082296094 11:50442470-50442492 CCGGGGCAGGCATGCTGGGTTGG - Intergenic
1083429040 11:62604262-62604284 CCAGGGAGGCCACCCTGGGTAGG + Intronic
1083654813 11:64224491-64224513 CCTGGGAGGACAGAGTGGGTGGG + Intronic
1083937839 11:65879748-65879770 AAGGGGAAGACAGGCTTGGTGGG - Intergenic
1084001170 11:66296083-66296105 CCAGGGAAGCCAACCTGGCTGGG - Exonic
1084178984 11:67437313-67437335 CCTGGGCGGACAGCCTGGGGTGG - Intronic
1084426376 11:69086617-69086639 CCATGGAGAACAGCCTGGGTGGG - Intronic
1084544085 11:69805274-69805296 CAGGGGAAGACAGCCTTGCCTGG - Intergenic
1085508013 11:77071147-77071169 CTGGGGAAGCCAGCCTCGGTGGG - Intronic
1089130408 11:116207867-116207889 CCAAGGAAGACAGGCTGGCTGGG + Intergenic
1090403439 11:126463352-126463374 CTGGGGTGGCCAGCCTGGGTTGG + Intronic
1092286479 12:7131642-7131664 CCTGGGAAGACAAGCAGGGTGGG + Intronic
1092338629 12:7656300-7656322 CCGTGGAAGAAAGTCTGGGCTGG + Intronic
1095466249 12:42490660-42490682 CCGGGGTGTACAGTCTGGGTAGG + Intronic
1096428042 12:51520830-51520852 GCGGGGAAGAAAGCCTGGGTGGG + Intergenic
1100297588 12:93277124-93277146 ACTGGGAAGATAACCTGGGTAGG + Intergenic
1101401853 12:104395001-104395023 CTGGGGCTGACTGCCTGGGTTGG - Intergenic
1102197106 12:111033868-111033890 CCGGGGGAGGCAGCCGGGGATGG - Intergenic
1102222654 12:111204949-111204971 GCGGGGAAGCCAGCTTGGCTGGG + Intronic
1102838056 12:116085912-116085934 CCAGGGAAGACAGAGTGGGTGGG + Intronic
1102963904 12:117111829-117111851 CTGGGGCAGGCAGCCGGGGTGGG + Intergenic
1104912506 12:132245979-132246001 ACGAGGAGGACAGCCTGGGGAGG - Intronic
1105018252 12:132799182-132799204 CCAGGGAAGACAGCCTTTGCTGG + Intronic
1105622863 13:22086184-22086206 CTGTGGAGGAGAGCCTGGGTAGG + Intergenic
1106503815 13:30354654-30354676 TCGGGGATGACAGCATGGGCTGG - Intergenic
1113781894 13:112981852-112981874 CCGAGGGAGACAGCCAGGGCTGG - Intronic
1113959554 13:114119075-114119097 CCGGGGAAAAGAGCTGGGGTGGG - Intronic
1118067465 14:62207372-62207394 CCGGGGAAGCAAGCCTGTGGAGG + Intergenic
1122791014 14:104184192-104184214 GCGGGGCAGACAGCCTGGCGGGG - Intergenic
1123009191 14:105339031-105339053 CCTCTGAAGTCAGCCTGGGTTGG - Intronic
1123055378 14:105566829-105566851 GCGGGGAAGTGAGGCTGGGTTGG + Intergenic
1123079830 14:105686673-105686695 GCGGGGAAGTGAGGCTGGGTTGG + Intergenic
1126200652 15:45982041-45982063 TCGGAGGAGACAGGCTGGGTAGG + Intergenic
1126679126 15:51187060-51187082 CCGGAGAAGGAAGCCAGGGTTGG - Intergenic
1127219869 15:56867927-56867949 CAGGGGAAGGCAATCTGGGTAGG + Intronic
1128133718 15:65247639-65247661 CCTGGGTAGACAGGCTGGGGTGG - Intronic
1129792884 15:78353382-78353404 TAGGGGAAAACAGACTGGGTAGG + Intergenic
1130689308 15:86066718-86066740 ACGGATAAAACAGCCTGGGTGGG + Intergenic
1132710876 16:1266661-1266683 CCGGGGAAGGCAGGCAGGGATGG + Intergenic
1132839999 16:1974290-1974312 CAGGTGAGGGCAGCCTGGGTGGG + Exonic
1134389283 16:13804329-13804351 GAGGAGAAGACTGCCTGGGTTGG - Intergenic
1135607929 16:23838818-23838840 CTTGGTAAGACAGGCTGGGTAGG - Intronic
1136284056 16:29231000-29231022 CCGGGGAAGACAGCTCAGCTGGG - Intergenic
1137875176 16:51989863-51989885 CCGGGGATGACAGGGTGGCTGGG + Intergenic
1138565296 16:57828527-57828549 CCTCAGAAGACAGCCTGGGTGGG + Intronic
1140073099 16:71670220-71670242 CCGGAGGAGACGGCCTGGGCTGG + Intronic
1141150093 16:81558582-81558604 CAGGTGGAGACAGCCTGGCTTGG + Intronic
1141165020 16:81654586-81654608 CCGGGTCAGGCAGCCTGGGCTGG - Intronic
1141698574 16:85632176-85632198 CAAGGGAAGACAGGCTAGGTGGG + Intronic
1142033968 16:87852386-87852408 CTGGGGACGGCAGCCTGGGAGGG + Intronic
1142089090 16:88200508-88200530 CCGGGGAAGACAGCTCAGCTGGG - Intergenic
1142107862 16:88315900-88315922 CCGGAGCAGGCAGCCTGGGCGGG - Intergenic
1142393185 16:89816166-89816188 CCGGGGAAGACGGCCCAGGAGGG + Intronic
1145270520 17:21402266-21402288 TCAGGGAAGACTGCCTGAGTAGG - Intronic
1145308729 17:21689663-21689685 TCAGGGAAGACTGCCTGAGTAGG - Intergenic
1146285483 17:31571637-31571659 CTGGGGAAGACTGGCTGGGGTGG + Intronic
1147331765 17:39703406-39703428 CCTGGGAAGAGAGCCGAGGTGGG + Intronic
1148693382 17:49545506-49545528 CCGGGGGAGACAGGATGGATGGG + Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149637024 17:58179169-58179191 CAGGGGAGGACAACCTGGCTGGG - Intergenic
1150626403 17:66843958-66843980 CGGGGGGAGAGAGCCTGGGCTGG + Intronic
1150883554 17:69058978-69059000 CCAGGCAAGAGAGCTTGGGTAGG + Intronic
1151333899 17:73428773-73428795 CCAAGGAAGACAGACTGGGGTGG + Intronic
1152134225 17:78494543-78494565 CCGGAGAAGCCTGCCTGGCTGGG - Intronic
1152524374 17:80879256-80879278 ACGGGTCAGACAGGCTGGGTTGG - Intronic
1152750071 17:82058578-82058600 GAGGGGAAGAGAGTCTGGGTGGG - Intronic
1152778788 17:82217410-82217432 CTTGGGAGGACAGCCTGGCTTGG - Intergenic
1153276662 18:3374248-3374270 CCAGGGAATGCAGGCTGGGTGGG + Intergenic
1153523907 18:5977441-5977463 CCAGGCCAGTCAGCCTGGGTGGG - Intronic
1155219546 18:23671809-23671831 CTGGGGAAGACAGTATGGGGAGG + Intergenic
1160161139 18:76471848-76471870 CCAGGGTAGACAGTTTGGGTGGG - Intronic
1161343223 19:3753932-3753954 GCGGGAGAGGCAGCCTGGGTGGG + Intronic
1164524540 19:29003747-29003769 TCGGGGAAGACAGGCTGGGAGGG + Intergenic
1166229316 19:41416540-41416562 CCTGGGAAGACAGCCAAGGGTGG - Intronic
1166288103 19:41844784-41844806 AGGGGGAAGACAGTCTGGGCGGG + Intronic
1166742727 19:45124072-45124094 CCTAGGAAGACAGCATGGGGTGG - Intronic
1166947936 19:46408633-46408655 CGGAGGAAGACAGGCTGGGTGGG - Intergenic
925422029 2:3720074-3720096 CCTGTGAAGACAGCATGGGGAGG + Intronic
926757395 2:16247104-16247126 CCGTGGGAGGCAGCCTGGGAAGG + Intergenic
927870103 2:26617933-26617955 CTGGGGAGGGAAGCCTGGGTTGG + Intronic
930089749 2:47523135-47523157 CCTGGGCAGACAGCCTTGTTAGG + Intronic
931516800 2:63054914-63054936 CTCGGGAAGGAAGCCTGGGTGGG - Intronic
932138057 2:69247966-69247988 CCGGGGATGACACACTGAGTCGG - Exonic
937988014 2:127647307-127647329 CCCTGGAAGACCGCCAGGGTGGG - Intronic
944443022 2:199761721-199761743 CCCAGGAAGACAGCATGGCTGGG - Intronic
945904434 2:215575312-215575334 GCAGCGAAGACAGCCTGGATGGG - Intergenic
946433327 2:219636927-219636949 CTGGGGAGGACAGCATGGGAGGG + Intronic
947444960 2:230156491-230156513 GCGGGGAAGACAGCAGGGATTGG - Intergenic
947966565 2:234287141-234287163 CCAGCGAAGTCAGCCTGGGATGG + Intergenic
948219481 2:236258220-236258242 CCTGGGAAGGCAGTGTGGGTCGG + Intronic
948359788 2:237412166-237412188 CTGAGGATGAAAGCCTGGGTGGG - Intronic
948908595 2:240991766-240991788 CCGGGGAAGCCAGCCTGACAGGG - Intronic
1170921093 20:20680135-20680157 CCTGGGGAGCCAGACTGGGTTGG - Intronic
1172602797 20:36195436-36195458 CCAGGGAAGTGAGCCTGGGATGG - Intronic
1172692395 20:36798954-36798976 CCAGGCAAGCCAGCATGGGTTGG + Intronic
1174087721 20:48020762-48020784 CCGGGAAGGGCAGCCTTGGTGGG + Intergenic
1176305995 21:5123445-5123467 CCGGGGACGACAGGCTGGGGTGG + Intronic
1176604815 21:8820176-8820198 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1176649405 21:9531195-9531217 CGGAGGAGGACAGCCTTGGTGGG + Intergenic
1179505820 21:41839586-41839608 CCGGGGATGAGTGCCTGCGTGGG - Intronic
1179851062 21:44138586-44138608 CCGGGGACGACAGGCTGGGGTGG - Intronic
1180347105 22:11711781-11711803 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1180354855 22:11829871-11829893 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1180383396 22:12162460-12162482 CCTGGGCAGACCGCCTGGCTTGG + Intergenic
1181904584 22:26184251-26184273 CCAGTGAAGACAGCCTGACTTGG - Intronic
1182675455 22:32035741-32035763 CTGGGGAAGGTAGGCTGGGTGGG + Intergenic
1182715314 22:32353226-32353248 CCGAGGAACGCAGCCAGGGTGGG - Intergenic
1183219707 22:36504713-36504735 CCAGGGAAGTCAACCTGGTTGGG + Exonic
1183648094 22:39138417-39138439 CCGGGGAAGACAGCCTGGGTGGG - Intronic
1184093752 22:42305677-42305699 CCAGGGAAGGCAGTCTGGGGAGG - Intronic
1184152070 22:42645064-42645086 CCATGGAAGTGAGCCTGGGTGGG + Intronic
1184828770 22:46970877-46970899 CCTGGGGAGATAGCCTGGGAAGG - Intronic
1185249261 22:49791177-49791199 CCGGGGAAGTCAGCCCTGGCAGG + Intronic
949414520 3:3800307-3800329 CCGGGGAAGGCAGCTGGGGCTGG + Intronic
950259887 3:11536099-11536121 CCTGAGAAAACAGCCTGGCTGGG - Intronic
950442916 3:13020223-13020245 CCGGGATAGACCTCCTGGGTGGG - Intronic
951541457 3:23786126-23786148 CCGGGGAAAACACCCTCGATGGG + Intergenic
953348086 3:42192787-42192809 TCTGGGGAGACAGCCTTGGTTGG + Intronic
954394762 3:50287628-50287650 CTGGGGAAGACTGCCTTGGAGGG + Exonic
954683658 3:52359224-52359246 TCTGGGAAGACAGCATGGGCAGG - Exonic
954985333 3:54785711-54785733 CCACTGAAGACAGCCTTGGTTGG + Intronic
954989977 3:54832307-54832329 CTGGTTAACACAGCCTGGGTTGG + Intronic
955783032 3:62506520-62506542 CCGAGGAACAAAGCCTGAGTTGG - Intronic
958998943 3:100939483-100939505 CCGGGGAAGACATCACGTGTCGG + Intronic
960295850 3:115943215-115943237 ACTGGGAAGAAAGCCTGGGGAGG + Intronic
960906343 3:122605351-122605373 CTGGGGAATACAGACAGGGTTGG + Intronic
962448839 3:135494428-135494450 TTGGGGAACACAGCCTGGGAAGG + Intergenic
963939721 3:151086372-151086394 CCGGGGAAGAGAGGCGGGGGCGG + Intronic
965747038 3:171936720-171936742 CAGGGGAAGGCAGCCTGGGGAGG + Intronic
970413357 4:15832950-15832972 AAGGGGAAGACAGCATGGGAAGG - Intronic
973373305 4:49270761-49270783 CCTGGGCAGACCGCCTGGCTTGG + Intergenic
973387700 4:49524447-49524469 CCTGGGCAGACCGCCTGGTTTGG - Intergenic
975050675 4:69860429-69860451 CCTGGGAAGAGAGACTGGGAAGG + Intergenic
975643535 4:76524409-76524431 CCGTGGAAGACTGACTGGGGTGG + Intronic
983069809 4:163254531-163254553 CCAGGGTCGACAGCCTGGGAGGG + Intergenic
985711341 5:1431526-1431548 CCAGGGTAGACAGTGTGGGTTGG + Intronic
985766005 5:1779925-1779947 CCTGGAAGGACAGGCTGGGTGGG - Intergenic
985775851 5:1841333-1841355 CCTGCGAAGACAGCCTGGACTGG + Intergenic
985879543 5:2628090-2628112 GAGGGGATGACAGCCTGGGACGG + Intergenic
988727857 5:33941898-33941920 CCAGAGAAGACAGCCTAGCTGGG + Intergenic
991957464 5:72009950-72009972 CCGGGGTGGACAGCCTGGGAAGG - Intergenic
993308926 5:86303752-86303774 CTGTGCAAGACAGCCAGGGTGGG - Intergenic
993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG + Intergenic
993770106 5:91916244-91916266 CTGGCTAAAACAGCCTGGGTTGG + Intergenic
995034469 5:107517370-107517392 CCGGGCCAGACTGCCTAGGTCGG + Intronic
998400382 5:141845745-141845767 CCGGAGAAGACAGTCGGGGAGGG - Intergenic
1000328857 5:160192148-160192170 CCAGGGAAGGCTGGCTGGGTAGG - Intronic
1001494778 5:172179880-172179902 ACGGGCAAGACGGCCTGGGAGGG + Intronic
1003235098 6:4288486-4288508 GGGGGGCAAACAGCCTGGGTTGG - Intergenic
1006192495 6:32218197-32218219 CGGGGGAGGACCGCCTGAGTGGG - Intronic
1006295295 6:33167487-33167509 CCGGGGAAGACAGGCCCGGTGGG - Exonic
1007663585 6:43501327-43501349 CCTGGGAACACAGCCTGGGTTGG - Intronic
1007842479 6:44728087-44728109 CAGGGGAAAACAGCCTGAGCAGG + Intergenic
1009990420 6:70836294-70836316 CAGGCAAAGACAGCCTGTGTAGG + Intronic
1015588773 6:134802799-134802821 CTGGGGAAGACAGGCTAGGGAGG + Intergenic
1015924029 6:138291948-138291970 TCCGGGAAGGCAGCCGGGGTCGG + Exonic
1017620227 6:156288981-156289003 CCGTGGAAGACAGGTTGGGAGGG + Intergenic
1017850617 6:158302380-158302402 CAGGGGCAGGCATCCTGGGTTGG + Intronic
1018906629 6:168079568-168079590 GGGAGGAAGGCAGCCTGGGTGGG + Intronic
1019104941 6:169660249-169660271 CTGGGGAAGGGAGCCAGGGTTGG + Intronic
1019358706 7:594179-594201 CCTGGAAGGCCAGCCTGGGTGGG - Intronic
1019502163 7:1369732-1369754 TCGGCTGAGACAGCCTGGGTGGG - Intergenic
1019787061 7:2983839-2983861 CCGTGGAAGCCAGCCTGGAGAGG + Intronic
1026155556 7:67822726-67822748 CCAGGCAGGACAGACTGGGTGGG - Intergenic
1026736851 7:72954488-72954510 CCGAGGGAGACAAGCTGGGTCGG + Intergenic
1026787071 7:73308562-73308584 CCGAGGAAGACAAGCTGGGTGGG + Intronic
1027106883 7:75410575-75410597 CCGAGGGAGACAAGCTGGGTCGG - Intronic
1029115669 7:98235897-98235919 CCAGGGAGGACAGCCAGGGCAGG - Intronic
1029327674 7:99823765-99823787 GCAGAGAAGACACCCTGGGTTGG - Intergenic
1031995810 7:128230065-128230087 CCAGGGCAGAGAGCCTGGGAAGG - Intergenic
1034269146 7:149795288-149795310 CCCAGGAGGGCAGCCTGGGTGGG - Intergenic
1035750990 8:1996189-1996211 CCTGGGAATAGCGCCTGGGTGGG - Intronic
1037838403 8:22227862-22227884 CAGGGGCAGAGAGCCCGGGTAGG - Intronic
1039244686 8:35595870-35595892 CCTTGGTAGGCAGCCTGGGTAGG + Intronic
1040323516 8:46329913-46329935 CCGTGGAGCACATCCTGGGTTGG - Intergenic
1042570332 8:70156837-70156859 CAGGGGAAAACTGACTGGGTGGG + Exonic
1045288213 8:100810120-100810142 CCGGGGATGAGAACCGGGGTGGG - Intergenic
1049664066 8:143835360-143835382 CCCGGCCAGGCAGCCTGGGTAGG + Exonic
1049762658 8:144338097-144338119 CCGGGGAAGGCGGCCTGCGGGGG + Intergenic
1053422381 9:37987722-37987744 CCTGGGAGGAAAGCCTGGGGTGG + Intronic
1055324805 9:75118335-75118357 GCAGGGAAGACAGCATGGCTTGG + Intronic
1056547544 9:87625359-87625381 CCAGGGGAGAGAGCCTTGGTTGG + Intronic
1056609447 9:88115057-88115079 CCGAGGAAGGCAGCCCTGGTGGG + Intergenic
1056847824 9:90055917-90055939 CCGAGGCAGGCTGCCTGGGTTGG - Intergenic
1058618947 9:106863401-106863423 CCGGGGAAGAGAGCGCGGGGTGG + Intronic
1059441308 9:114308599-114308621 CCAGGGAAGAGAGCCTGTGGAGG - Intronic
1059641267 9:116219194-116219216 GCGAGGAAGACGGCATGGGTGGG - Intronic
1061668329 9:132173515-132173537 TAGAGGAAGACAGCCTGGGAAGG - Intronic
1061673127 9:132200504-132200526 CCGGGAAAAACATCATGGGTTGG + Intronic
1061865793 9:133491173-133491195 GGGAGGAGGACAGCCTGGGTGGG + Intergenic
1203697019 Un_GL000214v1:108764-108786 CCTGGGAAGACCGCCTGGCTTGG + Intergenic
1203552195 Un_KI270743v1:172265-172287 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1203627146 Un_KI270750v1:34743-34765 CGGAGGAGGACAGCCTTGGTGGG + Intergenic
1185522000 X:747424-747446 CAGGGGACTACAGACTGGGTGGG - Intergenic
1187718629 X:22129195-22129217 CCGGGCCAGACAGGCTGGGATGG + Intronic
1189601028 X:42626374-42626396 TGGGGGAAGACAGTATGGGTGGG + Intergenic
1190288324 X:48975038-48975060 GCTGGGAGGACAGGCTGGGTGGG + Intronic
1192183797 X:68932231-68932253 CCAGGCTAGACAGCCTGGCTCGG + Intergenic
1192318238 X:70067894-70067916 CTGGGGCAGAGAGCCTGGGTAGG + Intergenic
1195196223 X:102500049-102500071 GCAGGCAAGACAGCCTGTGTAGG - Intergenic
1200088386 X:153622987-153623009 GCGAGGCAGACAGCCTGGGGAGG + Intergenic
1200256642 X:154585997-154586019 CCTGGGGAGACAGCCTGGGGGGG + Intronic
1200257352 X:154590670-154590692 CCGGAGAGGGCAGCCTGCGTTGG - Intergenic
1200260418 X:154613732-154613754 CCGGAGAGGGCAGCCTGCGTTGG + Intergenic
1200261127 X:154618406-154618428 CCTGGGGAGACAGCCTGGGGGGG - Intronic
1201144093 Y:11053254-11053276 AGGGAGAAGACAGCCTGGTTTGG - Intergenic
1201153476 Y:11107838-11107860 CCCGGGCAGACCGCCTGGCTTGG - Intergenic