ID: 1183649168

View in Genome Browser
Species Human (GRCh38)
Location 22:39144511-39144533
Sequence TCAGGCCCGCCCGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183649159_1183649168 -4 Left 1183649159 22:39144492-39144514 CCACCGCAAAGTGGCCCGCTCAG No data
Right 1183649168 22:39144511-39144533 TCAGGCCCGCCCGGGGCTCTGGG No data
1183649156_1183649168 11 Left 1183649156 22:39144477-39144499 CCCTGGCGCGCAGAGCCACCGCA No data
Right 1183649168 22:39144511-39144533 TCAGGCCCGCCCGGGGCTCTGGG No data
1183649155_1183649168 21 Left 1183649155 22:39144467-39144489 CCAGGAAACACCCTGGCGCGCAG No data
Right 1183649168 22:39144511-39144533 TCAGGCCCGCCCGGGGCTCTGGG No data
1183649157_1183649168 10 Left 1183649157 22:39144478-39144500 CCTGGCGCGCAGAGCCACCGCAA No data
Right 1183649168 22:39144511-39144533 TCAGGCCCGCCCGGGGCTCTGGG No data
1183649161_1183649168 -7 Left 1183649161 22:39144495-39144517 CCGCAAAGTGGCCCGCTCAGGCC No data
Right 1183649168 22:39144511-39144533 TCAGGCCCGCCCGGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183649168 Original CRISPR TCAGGCCCGCCCGGGGCTCT GGG Intronic