ID: 1183649445

View in Genome Browser
Species Human (GRCh38)
Location 22:39145655-39145677
Sequence TGCGTGCGCGCGGCCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183649445_1183649467 28 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649467 22:39145706-39145728 ACCGGCAAACCGAGGGGGCGGGG No data
1183649445_1183649459 10 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649459 22:39145688-39145710 GGGGCGCGCGCCGGGATTACCGG No data
1183649445_1183649463 22 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649463 22:39145700-39145722 GGGATTACCGGCAAACCGAGGGG No data
1183649445_1183649469 29 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649469 22:39145707-39145729 CCGGCAAACCGAGGGGGCGGGGG No data
1183649445_1183649455 -10 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649455 22:39145668-39145690 CGCGCACGCACGCACGGGGAGGG No data
1183649445_1183649466 27 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649466 22:39145705-39145727 TACCGGCAAACCGAGGGGGCGGG No data
1183649445_1183649465 26 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649465 22:39145704-39145726 TTACCGGCAAACCGAGGGGGCGG No data
1183649445_1183649456 -9 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649456 22:39145669-39145691 GCGCACGCACGCACGGGGAGGGG No data
1183649445_1183649458 2 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649458 22:39145680-39145702 CACGGGGAGGGGCGCGCGCCGGG No data
1183649445_1183649464 23 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649464 22:39145701-39145723 GGATTACCGGCAAACCGAGGGGG No data
1183649445_1183649461 20 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649461 22:39145698-39145720 CCGGGATTACCGGCAAACCGAGG No data
1183649445_1183649457 1 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649457 22:39145679-39145701 GCACGGGGAGGGGCGCGCGCCGG No data
1183649445_1183649462 21 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA No data
Right 1183649462 22:39145699-39145721 CGGGATTACCGGCAAACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183649445 Original CRISPR TGCGTGCGCGCGGCCGGCGG GGG (reversed) Intronic