ID: 1183649445

View in Genome Browser
Species Human (GRCh38)
Location 22:39145655-39145677
Sequence TGCGTGCGCGCGGCCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 267}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183649445_1183649458 2 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649458 22:39145680-39145702 CACGGGGAGGGGCGCGCGCCGGG No data
1183649445_1183649456 -9 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649456 22:39145669-39145691 GCGCACGCACGCACGGGGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 92
1183649445_1183649464 23 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649464 22:39145701-39145723 GGATTACCGGCAAACCGAGGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1183649445_1183649455 -10 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649455 22:39145668-39145690 CGCGCACGCACGCACGGGGAGGG 0: 1
1: 0
2: 2
3: 11
4: 93
1183649445_1183649466 27 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649466 22:39145705-39145727 TACCGGCAAACCGAGGGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1183649445_1183649463 22 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649463 22:39145700-39145722 GGGATTACCGGCAAACCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
1183649445_1183649465 26 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649465 22:39145704-39145726 TTACCGGCAAACCGAGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 30
1183649445_1183649467 28 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649467 22:39145706-39145728 ACCGGCAAACCGAGGGGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1183649445_1183649469 29 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649469 22:39145707-39145729 CCGGCAAACCGAGGGGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 113
1183649445_1183649457 1 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649457 22:39145679-39145701 GCACGGGGAGGGGCGCGCGCCGG 0: 1
1: 1
2: 8
3: 57
4: 467
1183649445_1183649459 10 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649459 22:39145688-39145710 GGGGCGCGCGCCGGGATTACCGG 0: 1
1: 0
2: 0
3: 1
4: 60
1183649445_1183649461 20 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649461 22:39145698-39145720 CCGGGATTACCGGCAAACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 16
1183649445_1183649462 21 Left 1183649445 22:39145655-39145677 CCCCCGCCGGCCGCGCGCACGCA 0: 1
1: 0
2: 0
3: 49
4: 267
Right 1183649462 22:39145699-39145721 CGGGATTACCGGCAAACCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183649445 Original CRISPR TGCGTGCGCGCGGCCGGCGG GGG (reversed) Intronic
901019667 1:6249426-6249448 GGGCTGCGCGCGGCGGGCGGCGG - Exonic
901641432 1:10694887-10694909 AGCGCGCGCGCGGCCGCCGGCGG - Intronic
903153339 1:21428422-21428444 AGCCTGGGCGCGCCCGGCGGCGG + Intergenic
903324696 1:22563332-22563354 GGCGTGCGCACGTGCGGCGGCGG + Intergenic
904054311 1:27660039-27660061 GGCGTTCGCGCAGACGGCGGTGG - Intergenic
904528848 1:31155134-31155156 CGCGGGCGCGGGGCCGGAGGTGG + Intergenic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
907012656 1:50978011-50978033 CGCGGCCGCGCGGCCGGCCGGGG + Intergenic
910670088 1:89763594-89763616 AGCGTGAGCGCGGCCTGGGGAGG - Intronic
910760934 1:90730440-90730462 TGCGTGCGCGCGCCTGGGTGTGG - Intergenic
912416239 1:109509767-109509789 CGCGTGCGCGCGGCGGGGGCGGG + Intergenic
912437361 1:109671187-109671209 TGCTTGCCCGCGGCCAGCTGGGG + Intronic
914869119 1:151458810-151458832 TGCGCGCGCGCGCGCCGCGGCGG + Intronic
916651665 1:166839606-166839628 TGAGTGCGCGCGGGCGGGGGCGG + Intronic
917433920 1:174999956-174999978 TGCGTGCTCGCGGTGGGCGGTGG + Exonic
918260320 1:182789803-182789825 TGGGTGAGCGCGGCCCGCGACGG + Intronic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
923299714 1:232630046-232630068 TGCGCTCGGGCGGCCGGCGGGGG + Intergenic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
1062843692 10:689408-689430 TGGGGGCGCGGGGCCTGCGGCGG - Intronic
1063502929 10:6571009-6571031 TGAGTGCGAGGGGACGGCGGAGG + Intronic
1064478892 10:15719979-15720001 TCCCTGCCCGCGGCCGGAGGAGG - Exonic
1065342991 10:24723718-24723740 TGCCTGGGAGCGGCCGGCCGGGG - Intergenic
1065520574 10:26567294-26567316 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1065712827 10:28533501-28533523 GGCGGGCGCGCAGGCGGCGGCGG - Exonic
1068617763 10:59138338-59138360 GGCCTGCGGGCGGCCCGCGGAGG - Intergenic
1070800661 10:79242971-79242993 TGAGTGCGGGCGGCGGGCTGGGG + Intronic
1073147955 10:101292622-101292644 TGCGTGTGCGCGGCGGGCGCGGG - Intergenic
1073932524 10:108592412-108592434 TGCTTGGGCCCGGCAGGCGGAGG - Intergenic
1074591999 10:114822138-114822160 TGCGGGCGCACGGCAGGCCGGGG + Intronic
1075032167 10:119030612-119030634 GGCGGGCGGGCGGGCGGCGGCGG - Exonic
1075048635 10:119165713-119165735 CGGGTGCGCGCGGCCCGGGGCGG - Intergenic
1075697399 10:124447301-124447323 CGGGTGCGCGCGGCGGGCAGGGG + Exonic
1076792752 10:132785728-132785750 CCCGTGGGCGCGGCGGGCGGGGG - Exonic
1076792878 10:132786100-132786122 GGCGGGCGGGCGGGCGGCGGCGG + Intergenic
1076868912 10:133183143-133183165 AGCGTGGGCGCGGGCGGCGAGGG + Intronic
1077100397 11:819903-819925 TGGGTGAGCGGGGCCGGGGGCGG + Exonic
1077602152 11:3581305-3581327 TGCGCGCGAGCGGCCAGCAGAGG - Intergenic
1078594427 11:12674501-12674523 TGGGCGCCCGCGGCGGGCGGCGG - Intergenic
1079064280 11:17276364-17276386 TGCGTGGGCGCTGCAGGCGCAGG + Intronic
1080383926 11:31799334-31799356 CGCGGCCGCTCGGCCGGCGGAGG - Intronic
1081574749 11:44311912-44311934 TGGGATCGCGCGGTCGGCGGCGG - Intergenic
1083648491 11:64186519-64186541 TGGGTGAGTCCGGCCGGCGGCGG + Intronic
1083657002 11:64234607-64234629 GGCGGGCGGGCGGCCGGTGGCGG - Exonic
1083766672 11:64844714-64844736 TGAGGGCGCGCTGGCGGCGGCGG - Intergenic
1084070081 11:66728186-66728208 GGCGGGGGCGCGGCGGGCGGGGG + Intronic
1084112552 11:67023389-67023411 TGCGTGCGCGCTGCGGGAGGCGG + Intronic
1084146154 11:67266432-67266454 CGCGGGCGCGCGGGCGGCGGCGG + Exonic
1084814697 11:71639359-71639381 TGCGTGCGAGCGGCCAGCAGAGG + Intergenic
1088869026 11:113875651-113875673 TGCGTGCGCGCGCATGCCGGGGG - Intergenic
1089515857 11:119030898-119030920 TGCGCAAGCGCGGCCGGCGGGGG + Exonic
1092428298 12:8390657-8390679 TGCGCGCGAGCGGCCAGCAGAGG - Intergenic
1094218512 12:27970350-27970372 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1095261664 12:40105630-40105652 AGCGCGGGCGCGGGCGGCGGCGG - Exonic
1095752965 12:45730318-45730340 CGCGTGCGCGCGGCGGGCGCGGG + Intronic
1096127672 12:49131477-49131499 TGGGCGCGCGGGGCCGGAGGAGG - Intergenic
1096461135 12:51821848-51821870 TGCAGGAGCGCGGCCGGGGGCGG + Intergenic
1096994613 12:55830805-55830827 CGCGTGCGCGCGGTGGGGGGAGG - Intronic
1100679850 12:96907332-96907354 TGCGCGGACGCGGCGGGCGGGGG - Intronic
1100992649 12:100267252-100267274 TGCGGCCGCGGGGGCGGCGGAGG + Intronic
1103488198 12:121296743-121296765 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1103539200 12:121654239-121654261 CGGGTGGGCGGGGCCGGCGGGGG + Intronic
1103698542 12:122835643-122835665 GGCGAGCGGGCGGCGGGCGGCGG + Exonic
1103917720 12:124384537-124384559 TGTGTGCGCGCGGCCGCTGGTGG - Intronic
1105957926 13:25301571-25301593 TACGTGCGCGCGGCGAGCGCCGG + Exonic
1105975467 13:25468765-25468787 GGCGTGGGCGGGGCCGGGGGCGG + Intronic
1106304061 13:28494928-28494950 TCAGGGCGCGGGGCCGGCGGCGG - Exonic
1106516974 13:30464814-30464836 TGCGGGCGCGGCGGCGGCGGCGG + Intronic
1106735663 13:32586258-32586280 TGCGTGCGCGCGGACGGGGCGGG + Intergenic
1106735673 13:32586295-32586317 TGCGCGCGCGCGGACGGGGCGGG + Intergenic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113655608 13:112066664-112066686 TGAGCGCGCGCGCGCGGCGGCGG - Intergenic
1113737649 13:112689930-112689952 TGTGGGCGCGGGGCCGGCGGGGG + Intergenic
1115851783 14:37595136-37595158 GGCGTGCGCGGCGGCGGCGGCGG + Intronic
1116437782 14:44913526-44913548 TGCTTGAGCGCGGGAGGCGGAGG - Intergenic
1117097703 14:52314682-52314704 TGCTGGCGCGCCGCTGGCGGGGG + Exonic
1120789092 14:88563005-88563027 GCCGTGTGCGCGGCCGGGGGCGG + Exonic
1122108725 14:99480684-99480706 TGCGCCCGCGCGGCCCGCGGGGG - Intronic
1122736750 14:103847751-103847773 CGCGTCCGCGCTCCCGGCGGCGG + Intergenic
1122768209 14:104085644-104085666 TGGGAGGGCGGGGCCGGCGGGGG - Intergenic
1122993303 14:105248994-105249016 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1202904379 14_GL000194v1_random:59944-59966 TGCATGCGCCAGGCAGGCGGAGG - Intergenic
1125626897 15:41116181-41116203 TGCGGGCGCTGGGCCGGCGGCGG + Exonic
1129326413 15:74802380-74802402 TGCGGGCGGGCAGCCGTCGGGGG - Exonic
1129348276 15:74938161-74938183 AGCCACCGCGCGGCCGGCGGCGG + Exonic
1132055498 15:98648312-98648334 TGTGTGCGCGCGGGAGGCGGTGG + Intergenic
1132105356 15:99059120-99059142 CGCGTGCGCGCCGGCCGCGGCGG + Intergenic
1132552782 16:560259-560281 GGGGGGCGCGCGGGCGGCGGGGG + Intergenic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132831326 16:1929810-1929832 TGCGTGCGCAGGCGCGGCGGGGG - Intergenic
1132889481 16:2196743-2196765 CCCGGGCGCGCGGCCGGCGCGGG - Intergenic
1133232191 16:4372069-4372091 TGCGTGTGTGCGCGCGGCGGCGG - Intronic
1133369929 16:5239696-5239718 TGCGGGCGAGCGGCCGGCAGAGG + Intergenic
1135517685 16:23149228-23149250 TGGGTCCGGGCCGCCGGCGGCGG - Exonic
1137426618 16:48385531-48385553 GGCGTTGGCGCGGCCGGCGGCGG + Intronic
1137476050 16:48810992-48811014 TGGGAGCGCGCGGCCGGCTCGGG + Intergenic
1140462221 16:75148838-75148860 TGCGGGGGCGGGGACGGCGGAGG + Intronic
1141608525 16:85169105-85169127 GGCGGGCGCGCGGCGGGCGGGGG - Intergenic
1141831758 16:86513008-86513030 TCCATGCACTCGGCCGGCGGGGG + Exonic
1142240319 16:88941747-88941769 TGGGTGTGCGCGGCCTGCGGAGG - Intronic
1142421380 16:89972594-89972616 TGCGCGCGCCCGGGCGGCGCGGG + Intergenic
1142611092 17:1109482-1109504 TGCGGGGCCGCGGCTGGCGGAGG + Intronic
1143586527 17:7853391-7853413 GGCGGGCGCGCGGGCAGCGGAGG + Exonic
1143635673 17:8162729-8162751 TGACTGCGCGCGGGCGGCCGAGG - Intronic
1147015671 17:37489823-37489845 AGCGTGCGCGCGGCCCGCCCCGG + Exonic
1147259010 17:39197760-39197782 TGTGTGCGCCGAGCCGGCGGAGG - Intergenic
1147360561 17:39927288-39927310 TGCGAGCGGGAGGCCGGGGGTGG - Intronic
1147994631 17:44354046-44354068 CGCGGGGGCGCGGGCGGCGGCGG + Exonic
1148157328 17:45431654-45431676 TGGGTGGGCGGAGCCGGCGGTGG + Intronic
1148225608 17:45896252-45896274 TCCGTGCGCGCTGCGGGCGGCGG + Intronic
1148284086 17:46372762-46372784 TGCGCGAGGGCGGGCGGCGGGGG + Intergenic
1148306307 17:46590683-46590705 TGCGCGAGGGCGGGCGGCGGGGG + Exonic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1149994578 17:61399987-61400009 TCTGTGCGCGGGGGCGGCGGGGG - Exonic
1149995314 17:61403205-61403227 AAGGTGCGCGCGGCGGGCGGTGG + Exonic
1150268820 17:63849398-63849420 GGCGTGCGAGCGGGCGGCCGCGG + Intergenic
1150802045 17:68290642-68290664 TGCGTGCGCGCGCCAGCCTGGGG + Intronic
1152433100 17:80260501-80260523 CGCCTGCGCGGGGCCGGCGGCGG + Intergenic
1152861352 17:82698404-82698426 TGCGGGCGCGGGGCCGGGGAGGG - Intronic
1152924220 17:83080059-83080081 TGCGGGGGCGCGGCCGGGGGCGG + Intronic
1153457580 18:5296470-5296492 GGCCTGCGCGCGCCCGGGGGAGG - Intronic
1153886977 18:9475760-9475782 CGCGGGCGCGAGGCCGGCGCGGG - Intronic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1157279027 18:46333939-46333961 CGCGGGCGCGCGGGTGGCGGAGG - Intronic
1157279102 18:46334188-46334210 GGCGCGGGCGCGGGCGGCGGCGG - Intronic
1160577381 18:79864289-79864311 CGGGTGAGCGCGGCCGGGGGTGG + Exonic
1160719169 19:590018-590040 TGGGGGGGCGCGGGCGGCGGCGG - Exonic
1160909396 19:1467853-1467875 GGCGTGGGCGCGGCCGCCGGGGG - Exonic
1160948057 19:1652475-1652497 CCCGTGCGCGCGGCCGGCCGGGG + Intronic
1160991903 19:1863547-1863569 GGCGTCCGTCCGGCCGGCGGCGG + Exonic
1160999969 19:1905633-1905655 TGCGCGCGCGCGCGCGGCGCTGG + Intronic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161323279 19:3651136-3651158 GGCGTGAGCGTGGCAGGCGGAGG - Intronic
1161333813 19:3700390-3700412 TGGCCGCGCGCGGACGGCGGCGG + Exonic
1162742687 19:12782646-12782668 TGCGTGCGCGCGTGCGTGGGCGG + Intronic
1162778925 19:12996535-12996557 GGCGGGCGCGCTGCCAGCGGTGG + Intronic
1163138758 19:15332313-15332335 AGCGGGCGGACGGCCGGCGGGGG - Intronic
1165080044 19:33301837-33301859 TGCGGGTGCGAGGGCGGCGGCGG + Exonic
1165924872 19:39320773-39320795 TGGGTGAGCGCGGCCTGCAGCGG - Intergenic
1166316800 19:41993991-41994013 TGGGTGTGCGCGGGGGGCGGGGG - Intronic
1166538875 19:43592894-43592916 TGCGTGCGCACAGACGGCGAGGG - Exonic
1167001207 19:46746519-46746541 ACCGCGCGCGCGCCCGGCGGGGG + Exonic
1167058823 19:47130837-47130859 TCCGGGCGTGCTGCCGGCGGCGG + Intronic
1167072956 19:47231157-47231179 TGCGAGCGGGCGCCTGGCGGCGG - Intronic
1168342318 19:55632071-55632093 TGCTTGAGCGCGGGAGGCGGAGG + Intergenic
926095851 2:10080264-10080286 TGAGGGGGCGCGGCCGGGGGCGG + Exonic
927168736 2:20350847-20350869 TGCGCGCGCCCGGTGGGCGGGGG - Intronic
927714211 2:25341910-25341932 GGAGGGCGCGCGGGCGGCGGCGG - Intronic
928518169 2:32063547-32063569 TGCGCGTGCGCGGCCGCCGCTGG + Intergenic
931323440 2:61194867-61194889 TGCTTGAACGCGGCAGGCGGAGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
932812122 2:74834408-74834430 AGGGTGCGCCCGGCTGGCGGAGG - Exonic
935592219 2:104854086-104854108 TGGGTGCGCGCTCGCGGCGGAGG + Intergenic
936452896 2:112646377-112646399 TGGGCGCGCGCGGGCCGCGGAGG + Intronic
937261133 2:120587372-120587394 TTTGTGCCCGCGGCCGGCGGAGG + Intergenic
942505609 2:176638256-176638278 GGCGTGCGCGCGGCGGCGGGTGG + Intergenic
942565964 2:177264805-177264827 TCAGCCCGCGCGGCCGGCGGGGG - Exonic
944221658 2:197310215-197310237 TGCGTGGGCGCCGCCGGCCCGGG - Intronic
945225864 2:207530438-207530460 TGTGTGCGGGCGGCCGGCCGCGG + Intronic
945699393 2:213151668-213151690 TGCGCGAGCCCGGCCGGCGGGGG - Intronic
947745063 2:232503191-232503213 TGAGTGCCCGCGGGCGGGGGCGG - Intergenic
948805926 2:240453438-240453460 TGCGGGAGCGGGGCGGGCGGAGG - Intronic
948910053 2:240998432-240998454 TGCGGGCGCGCGCCCTGTGGTGG - Intergenic
1169191399 20:3660924-3660946 CAGGTGCGCGCGGGCGGCGGCGG - Exonic
1172284622 20:33732097-33732119 TGCGAGGGCGCGGCGGGAGGGGG - Intronic
1172354342 20:34269174-34269196 TGCCTGCTCGCGGCCGGGAGTGG - Exonic
1175847115 20:62065019-62065041 GGCGGGCGCGGGGGCGGCGGGGG + Exonic
1175847405 20:62065905-62065927 GGGCGGCGCGCGGCCGGCGGGGG + Intergenic
1176005854 20:62861902-62861924 GGCGGGGGCGGGGCCGGCGGCGG - Intergenic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176281575 20:64316616-64316638 TGCGTGGGAGCGGGCAGCGGCGG + Intergenic
1178351139 21:31873665-31873687 GGCGAGCGCGATGCCGGCGGCGG + Exonic
1178610367 21:34073932-34073954 CGCGTGCGCGCGGGAGGCGGGGG + Intronic
1179209435 21:39313213-39313235 TGCGGGCCCGCGGGCGGCTGCGG - Intronic
1180110134 21:45643613-45643635 GGCGGGGGCGGGGCCGGCGGCGG + Intergenic
1180748856 22:18110895-18110917 TGCGGGCGCGCGGCAGGCGTAGG + Intronic
1180908368 22:19431583-19431605 TGAGGGCGCGGGGCGGGCGGCGG - Exonic
1180961992 22:19766350-19766372 GGAGTGAGCGCGGCCGGCCGGGG - Intronic
1182355267 22:29719955-29719977 GGCGGGCGGGCGGCTGGCGGGGG + Intergenic
1182439829 22:30356740-30356762 TCCGTGGGCACGGGCGGCGGCGG + Exonic
1183486188 22:38088895-38088917 GGCGAGCGCCCGGGCGGCGGCGG - Exonic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1183744813 22:39686212-39686234 GGCGTGGGGGCGGCCGGGGGCGG - Exonic
1184276478 22:43411946-43411968 GGCGCGCGGGCGGGCGGCGGAGG + Intronic
1184522998 22:45007083-45007105 CGGGGGCGCGCGGCCGGGGGCGG + Intronic
1184557425 22:45240898-45240920 CGGGGGCGCGCGGGCGGCGGCGG - Intergenic
1184681130 22:46072542-46072564 CGCGAGCGCGGCGCCGGCGGCGG + Intronic
1184766864 22:46576836-46576858 GGCGTGGCCGTGGCCGGCGGCGG + Intronic
1184791556 22:46703447-46703469 TGGATGCGCACGGCCGGTGGTGG - Intronic
1185107641 22:48883368-48883390 TGCTGGCGCTCGGCTGGCGGTGG + Intergenic
1185279071 22:49962245-49962267 TGCGTGCGTGCGGAGCGCGGGGG + Intronic
950729783 3:14947601-14947623 TACCAGCGCGCGGGCGGCGGCGG + Intronic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
953908916 3:46882271-46882293 GGGATGCGCGCGGCGGGCGGTGG + Intronic
954812312 3:53255812-53255834 TGAGTGCGCGGCGCCGGCCGGGG - Intronic
955818609 3:62874144-62874166 GGCGTGCGTTCGGCGGGCGGGGG - Intronic
955911537 3:63863791-63863813 GGCGTGCGCGGCGGCGGCGGCGG + Exonic
956179119 3:66501065-66501087 TGCGGGCGAGCGGCCGGGGGCGG - Intronic
956813556 3:72888080-72888102 GGCCGGCGGGCGGCCGGCGGCGG - Exonic
957072997 3:75580369-75580391 TGCGCGCGAGCGGCCAGCAGAGG - Intergenic
961446214 3:126982996-126983018 GGCGGGGGCGGGGCCGGCGGCGG - Intergenic
961858278 3:129893763-129893785 TGCGCGTGCGCCGCCGGCCGGGG - Intergenic
962263116 3:133927534-133927556 TGCGTGCGTGCGGTGGGCGCGGG + Intergenic
966182155 3:177197368-177197390 GGGGCGCACGCGGCCGGCGGCGG + Intronic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
968405823 4:338261-338283 GGCGTGCGCGATGCCGGCGTGGG + Intronic
968542003 4:1172555-1172577 AGCGGGAGCGCGGCCGGCAGCGG + Exonic
968574041 4:1356731-1356753 TGCGTGGGGGCTGCCGGCTGGGG + Intronic
969271352 4:6105437-6105459 CGCGTGCCCGCGGGCGGGGGAGG + Intronic
969330786 4:6472499-6472521 TGCGTCCGTGCGCCCGGCGGCGG + Intronic
969737357 4:9000650-9000672 TGCGCGCGAGCGGCCAGCAGAGG + Intergenic
969796565 4:9532238-9532260 TGCGCGCGAGCGGCCAGCAGAGG + Intergenic
970407669 4:15778845-15778867 AGCGTGCCCGCGGGAGGCGGGGG + Intronic
971406028 4:26321247-26321269 CGCGTGAGGGCGGGCGGCGGCGG + Intronic
972533103 4:39977757-39977779 TGCGTGCGGGCGGGCCGCGGGGG - Exonic
972738474 4:41867311-41867333 TGCGGGCGCGCAGGCGGCGGCGG + Intergenic
977536531 4:98261297-98261319 TCCGAGCGGGCGGGCGGCGGAGG - Intergenic
985537424 5:473101-473123 TGCGCACGCGCGTTCGGCGGCGG - Intergenic
985897110 5:2755237-2755259 GTCGTGCGCGCGGGCGGCGAGGG + Exonic
987050422 5:14143600-14143622 TGCGTCCGCGCGCCGGGCGCGGG + Intergenic
989267681 5:39496614-39496636 TGCTTGAGCCCGGCAGGCGGAGG - Intergenic
990428229 5:55710284-55710306 TGCTTGAGCCCGGCAGGCGGAGG - Intronic
991769186 5:70025229-70025251 TGCGCGTGCGCGGCCGGGGCTGG - Intronic
991848481 5:70900647-70900669 TGCGCGTGCGCGGCCGGGGCTGG - Intronic
992611258 5:78510333-78510355 AGCATGAACGCGGCCGGCGGCGG - Exonic
997264982 5:132490274-132490296 TGCGTGCGCGCAGCCGCCAGGGG - Intronic
1002058006 5:176609830-176609852 TGTGTGCGCGCGGCTGGGGGCGG - Intronic
1002559478 5:180071793-180071815 CGCGCGCGCGCGGCCTGCGCGGG + Exonic
1002897995 6:1390164-1390186 TGCAAGAGCGCGGGCGGCGGCGG + Exonic
1002898062 6:1390514-1390536 TGAAGCCGCGCGGCCGGCGGCGG - Exonic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1005040445 6:21595580-21595602 GGCGGGCGAGCGGCCGGCGGCGG - Exonic
1005636398 6:27757453-27757475 TGCGTCCTGGCGGCCAGCGGGGG + Intergenic
1007033161 6:38647625-38647647 TGCGTGAACCCGGCAGGCGGAGG - Intergenic
1007739500 6:44002258-44002280 GGCGTGGGCGCGGGCGGCGGGGG - Intronic
1007783143 6:44265441-44265463 AGCGGGCGCCCGGCCCGCGGCGG + Exonic
1012939673 6:105403223-105403245 TCCGTGCGCCCGGGCGGCGCGGG - Intergenic
1013619287 6:111872886-111872908 GGCGTGCGCGGGGGCGCCGGCGG + Intronic
1014632503 6:123803781-123803803 GGCGAGCGCGCGTCGGGCGGCGG + Intergenic
1015251844 6:131135588-131135610 TGCGGGGGCCCGGGCGGCGGAGG - Intergenic
1015935702 6:138404406-138404428 TGCGTGTGCGCGCCCCGCCGAGG - Exonic
1017738216 6:157381927-157381949 GGCGGCCGGGCGGCCGGCGGCGG + Exonic
1017842425 6:158232431-158232453 TTGGTGGGCGCGGCGGGCGGGGG + Intronic
1018329955 6:162716752-162716774 TGCGTGCGCGCGCGCGCAGGCGG - Intronic
1018613399 6:165663276-165663298 TACGTGGGCGCGGAAGGCGGCGG - Intronic
1018876531 6:167826879-167826901 CGGGTGCGGGCGGCGGGCGGCGG + Intergenic
1019343584 7:519517-519539 GGCGAGCGCGGGGCCGGCGGTGG - Intronic
1019366484 7:636018-636040 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366491 7:636042-636064 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366512 7:636114-636136 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366526 7:636162-636184 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366540 7:636210-636232 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366568 7:636306-636328 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366575 7:636330-636352 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366582 7:636354-636376 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019366596 7:636402-636424 CGTGTGGGCGCGGCCGGTGGAGG - Intronic
1019431002 7:999717-999739 TGCGTGCGCGCTGGGGGCAGGGG - Intronic
1021558510 7:21945742-21945764 TGGGTGCGTCCGGACGGCGGCGG + Intronic
1021845300 7:24757455-24757477 AGCCTGCGCTGGGCCGGCGGGGG + Intronic
1021969379 7:25951419-25951441 GGCGGGGGCGCGGCCGGCGCTGG + Intergenic
1021998339 7:26201639-26201661 AGCGGGCGCGCGCCCGGCGGGGG - Intronic
1022989594 7:35694827-35694849 TGCCTGGGCGCGGAGGGCGGCGG - Exonic
1023015655 7:35967543-35967565 CGCCTGGGCGCGGCCGCCGGAGG - Intergenic
1023955725 7:44885371-44885393 GGCGCGAGCGCGGCGGGCGGTGG - Intergenic
1024578323 7:50782462-50782484 TGCGTGTGCGCCGCCGGCCCGGG + Intronic
1024920232 7:54546580-54546602 TGCGGACGCGCGCCCGGAGGTGG - Intronic
1026441911 7:70452373-70452395 TGCGTGAGCCCGGGAGGCGGAGG + Intronic
1026909404 7:74083736-74083758 GGGGCGCGGGCGGCCGGCGGCGG - Intronic
1027653378 7:80899122-80899144 TGCTTGAGCCCGGGCGGCGGAGG - Intronic
1029496047 7:100895894-100895916 TGTGTGCGGGGGGCCGGAGGCGG - Exonic
1029715144 7:102321581-102321603 GGCGCGCGCGCGGCCGGGCGCGG - Exonic
1029849334 7:103446074-103446096 TGAGTGCGCGCGGGCGGCCGCGG - Intronic
1031025205 7:116672272-116672294 TCGGCGCGCGCGGCCCGCGGCGG - Intergenic
1031369799 7:120950926-120950948 TGAGTGCGCGGCGCTGGCGGCGG + Intronic
1031966575 7:128031720-128031742 GGCGGGCGCGGGTCCGGCGGCGG + Intronic
1032298766 7:130668321-130668343 TGCGCGCGGGCCTCCGGCGGGGG - Intronic
1033361307 7:140640654-140640676 GGCTTGCGGGCGGCCGGGGGAGG - Exonic
1034147329 7:148884471-148884493 CGTGCGCGCGCGGGCGGCGGCGG + Intergenic
1034469848 7:151249217-151249239 CGCCTGCCCGGGGCCGGCGGCGG + Intronic
1035169568 7:157010043-157010065 TTCCTGGGCGCGGGCGGCGGCGG - Exonic
1035266102 7:157691006-157691028 GGCGCGCACCCGGCCGGCGGCGG + Intronic
1036359146 8:8065410-8065432 TGCGCGCGAGCGGCCAGCAGAGG + Intergenic
1036830281 8:12015218-12015240 TGCGCGCAAGCGGCCGGCAGAGG - Intronic
1036891812 8:12601542-12601564 TGCGCGCGAGCGGCCAGCAGAGG - Intergenic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1041244789 8:55879943-55879965 TGCTGGCGCGGGGCCGGGGGTGG - Exonic
1041690079 8:60679347-60679369 TGCGTCCGCCGGGCCGGCGGCGG + Intronic
1042271558 8:66961609-66961631 CGGGAGCGGGCGGCCGGCGGCGG - Exonic
1045674089 8:104589054-104589076 GGAGCGCGCGCGGGCGGCGGCGG - Intergenic
1049509044 8:143018615-143018637 CGCGTGCGCGCAGGTGGCGGGGG - Intronic
1049552624 8:143267486-143267508 TGAGTGGGCGCGGGCGGCGGCGG + Intronic
1049654205 8:143790665-143790687 TGCGTGCGTGGGGGCAGCGGTGG + Intergenic
1049752456 8:144291642-144291664 TGTGTGTGCGCAGCGGGCGGCGG + Exonic
1055945751 9:81689614-81689636 CGCGAGCGCGGAGCCGGCGGGGG + Intergenic
1056406726 9:86282354-86282376 TGAGTGCTCGCGGCGCGCGGCGG - Intronic
1056992454 9:91424061-91424083 CGCGGGCGCTCGGACGGCGGTGG - Intergenic
1057869704 9:98708667-98708689 AGCAGGCGCGCGGGCGGCGGTGG + Exonic
1057881543 9:98796338-98796360 GGCGGGCGCGGAGCCGGCGGGGG - Exonic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1059414670 9:114155577-114155599 TGAGGGCGCGCGGAGGGCGGTGG - Exonic
1060661728 9:125408580-125408602 GCCGTGGGCGCGGCCGGCAGGGG + Intergenic
1060700543 9:125746757-125746779 TGGGTGCGCGGCTCCGGCGGCGG + Intergenic
1061084921 9:128393118-128393140 TGCGTGCGCGGGGCTGGGCGGGG - Intergenic
1061541053 9:131277966-131277988 CGGCTGCGCTCGGCCGGCGGCGG - Intergenic
1062230327 9:135479000-135479022 TGTGTGCCCGAGGCTGGCGGTGG - Intergenic
1062230678 9:135479987-135480009 GGGGTCCGCGCGGCGGGCGGCGG + Exonic
1062596611 9:137302521-137302543 GGGGGGCGCGCGGACGGCGGCGG - Intergenic
1203746933 Un_GL000218v1:45139-45161 TGCATGCGCCAGGCAGGCGGAGG - Intergenic
1187915535 X:24149766-24149788 GACGTGCGGGCGGCCGGCGACGG - Exonic
1189323039 X:40097648-40097670 TGCCCGAGCGCGGGCGGCGGCGG - Intronic
1190024607 X:46912343-46912365 AGGGCGAGCGCGGCCGGCGGTGG + Intronic
1193360633 X:80574758-80574780 AGGGTGCGCCCGGCTGGCGGAGG + Intergenic
1196668921 X:118345842-118345864 TGAGAGCGCGCGGCCGACGTAGG - Intergenic
1200100757 X:153688305-153688327 CGGGGGCGCGCGGGCGGCGGCGG - Exonic
1201160258 Y:11160153-11160175 TGCATGCGCCAGGCAGGCGGAGG - Intergenic