ID: 1183650014

View in Genome Browser
Species Human (GRCh38)
Location 22:39148464-39148486
Sequence AGGCAGGGGTGTGCGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183650010_1183650014 -5 Left 1183650010 22:39148446-39148468 CCTGGTGCGAAGCGAGAGAGGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1183650014 22:39148464-39148486 AGGCAGGGGTGTGCGCGCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 214
1183650006_1183650014 26 Left 1183650006 22:39148415-39148437 CCTGAAGGCTAACAGCTGGTGGC 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1183650014 22:39148464-39148486 AGGCAGGGGTGTGCGCGCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 214
1183650008_1183650014 4 Left 1183650008 22:39148437-39148459 CCACAGCTTCCTGGTGCGAAGCG 0: 1
1: 0
2: 0
3: 20
4: 223
Right 1183650014 22:39148464-39148486 AGGCAGGGGTGTGCGCGCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183650014 Original CRISPR AGGCAGGGGTGTGCGCGCCC AGG Intronic
900119822 1:1043783-1043805 AGGCAGGGGTCGGCAGGCCCAGG - Intronic
900345955 1:2210402-2210424 AGGCAGGGCTGTGGGCGCCGTGG - Intronic
900367251 1:2316268-2316290 AGGCAGGGGTGGGCAGGGCCTGG + Intergenic
900414576 1:2529129-2529151 GGGCAGCAGTGTGCGAGCCCCGG + Exonic
900418131 1:2544333-2544355 GGGCAGGGGTCTGCGTGCCGAGG - Intergenic
900633835 1:3652303-3652325 AGGCGGGGCAGAGCGCGCCCGGG + Intronic
901158307 1:7155290-7155312 AGGCAGGGATGGGCGCTGCCCGG - Intronic
901506308 1:9688004-9688026 AGGCCTGGCTGCGCGCGCCCTGG + Intronic
901890358 1:12258345-12258367 GGGCAGGGGTGTGGGCGCAAAGG - Intronic
902505989 1:16939248-16939270 AGGGAGGAGTCTGAGCGCCCTGG + Intronic
903028052 1:20443458-20443480 AGGCAGGGGGATGCAGGCCCTGG - Intergenic
903461206 1:23522087-23522109 AGGGAGGGGAGGGCCCGCCCAGG + Intronic
905813085 1:40927257-40927279 AGGCAGGGTTGTTTGAGCCCAGG + Intergenic
907202502 1:52739744-52739766 AGGCATGGGGGTGGGCGCCTGGG - Intronic
907487631 1:54788389-54788411 GGGCAGTGGGGTGTGCGCCCTGG - Intronic
908445062 1:64192062-64192084 AGCCAGGGGTGTGTGTGCCATGG - Intergenic
908473882 1:64470413-64470435 AGGCCGGGGTGCGCGGGCCCCGG - Intergenic
910338328 1:86157154-86157176 AGGCGGAGGCGAGCGCGCCCGGG - Intergenic
913178084 1:116293261-116293283 GGGCAGAGGTGAGCGCGCACAGG + Intergenic
915292558 1:154896463-154896485 AGGCAGGGGTGACCGGCCCCAGG + Intergenic
915324402 1:155073534-155073556 AGCCAGGGGTCTGGGCCCCCAGG - Intergenic
916700485 1:167288592-167288614 AGGCAGGAGTGTTTGTGCCCAGG + Intronic
922116488 1:222618398-222618420 ACGCGGGGGTGGGCGCGCTCCGG + Intronic
922462747 1:225825737-225825759 AGGCAGGGCTGTGCCCGTCCTGG - Intronic
924064294 1:240207691-240207713 AGGAAGGGGTATGCCTGCCCCGG - Exonic
924577232 1:245291770-245291792 AGGAAGGGGTGTTCTCGCCATGG + Intronic
1063117546 10:3082523-3082545 AGGCAGGGGTGAGCGAGCGCCGG - Intronic
1063407733 10:5813156-5813178 AGCCGGGGGTGCGCCCGCCCCGG + Intronic
1064609938 10:17087903-17087925 TGGCAGGGGTGTGAGCTTCCAGG + Intronic
1072718988 10:97769396-97769418 AGGGAGGGCTGTGGGAGCCCTGG + Intronic
1075801990 10:125159840-125159862 AGCCCGGTGGGTGCGCGCCCGGG - Intronic
1075871381 10:125774321-125774343 GGTCAGGGGTGTGGGCGGCCTGG - Exonic
1076698067 10:132256681-132256703 AGGCAGGGGTGGGTGGGGCCGGG - Intronic
1077265160 11:1645003-1645025 AGCCAGGGGTGTCCCCTCCCAGG - Intergenic
1077404846 11:2378240-2378262 AAGCTGGGGTGCGCGCACCCTGG + Intronic
1078190683 11:9091085-9091107 AGGCAGGAGGGTGCGGACCCTGG - Intronic
1079217476 11:18526728-18526750 AGGGAGCGGTGGGCGCGCCCTGG + Intronic
1079353446 11:19712599-19712621 ACGCAGGGGTGTGGGCCCCCCGG + Intronic
1082811859 11:57483144-57483166 AGGCAGGGGTTTTCCCTCCCGGG + Intergenic
1083683044 11:64359986-64360008 AGGAAAGGGTGTGCACACCCCGG - Intronic
1084013623 11:66366243-66366265 AGGCAGGGGTGTGAGCAGGCAGG + Intronic
1084332466 11:68438118-68438140 TGGCAGAAGTGAGCGCGCCCTGG - Intronic
1084578444 11:70006405-70006427 TGCCTGGGGTGGGCGCGCCCAGG + Intergenic
1084584997 11:70054197-70054219 CGGAAGGGGTGTGTGGGCCCTGG - Intergenic
1085054078 11:73394060-73394082 AGGCAGAGGTGTGCACTCCTGGG - Intronic
1085758502 11:79221603-79221625 AGGCAGGGGTGAGCACGCACAGG - Intronic
1085784576 11:79438932-79438954 AGGCCGGGGTGGGGGCGCCCCGG + Intronic
1088884221 11:113994497-113994519 AGGCAGGGTTGTGGCCGCCCCGG - Intergenic
1091697117 12:2635171-2635193 AGGCAGGGGTGTGAGAGGTCAGG - Intronic
1093654008 12:21674534-21674556 AGGCCAGGGTGGGCGCGCCAAGG + Intronic
1094498786 12:31005635-31005657 AGGCAGGGGTGGGTGGGCGCAGG + Intergenic
1096545892 12:52340064-52340086 AGGCAGGGGTGGGCTGTCCCTGG + Intergenic
1101592635 12:106138323-106138345 AGGCGGGGGTCTGTGCGCCCTGG - Intronic
1101745463 12:107538183-107538205 AGGCAGGGGTCTTCATGCCCTGG - Intronic
1103272865 12:119688078-119688100 AGACAGGGGTGTCCGTGCCGAGG + Exonic
1103614118 12:122141510-122141532 AGGCAGAGGGGTGAGTGCCCAGG + Intronic
1103851759 12:123937953-123937975 AGGCAGGGCTGTGGGGGCTCTGG + Intronic
1104460472 12:128951946-128951968 AGGCAGGGCCGTGCCCGCCATGG + Intronic
1106231828 13:27826576-27826598 AGGCAGGGGTGAGTGGGCCGAGG + Intergenic
1106449132 13:29864132-29864154 AAGGAGGGGTGAGCCCGCCCAGG - Intergenic
1106720101 13:32427830-32427852 GGGCAGGGGTGCGCTCGGCCGGG + Intronic
1107013901 13:35694101-35694123 AGGCAGGTGTCTGCGAGCCAAGG + Intergenic
1108373569 13:49793151-49793173 AGGCAGCGAGGTGCGCTCCCAGG - Intergenic
1112054387 13:95677100-95677122 AGGCAGCGGTGGGCGGGGCCCGG - Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113575077 13:111389518-111389540 AGGCAGCCGTGTGTGAGCCCAGG + Intergenic
1113692337 13:112319728-112319750 AGGCAGAGGTGAGCGAGCCAGGG + Intergenic
1113811102 13:113143177-113143199 AGGCAGGGGTGTGGGGGAGCAGG - Intronic
1117377460 14:55129338-55129360 GGGCAGGGGAGAGGGCGCCCGGG + Intronic
1119384075 14:74246225-74246247 AGGCTGGGGTGTGTGGGCCAGGG + Intronic
1119436536 14:74601119-74601141 AGCCAGGGATGTGGGCGGCCAGG - Intronic
1120142118 14:80941361-80941383 CGGCAGGGGTGTCCGCGGTCAGG - Intronic
1121510564 14:94509909-94509931 AGGAATGGGTGTGGGCACCCTGG + Intronic
1122659756 14:103287454-103287476 AGGCAGGGGTGAGGCAGCCCTGG + Intergenic
1122972893 14:105159483-105159505 AGGCAGAGGTTTGCGGGCCCTGG - Intronic
1123403959 15:20009690-20009712 AGGCAGGGTTGGGCGTCCCCAGG + Intergenic
1123513299 15:21016336-21016358 AGGCAGGGTTGGGCGTCCCCAGG + Intergenic
1124441474 15:29689079-29689101 AGGCTTGGGTGTGCACGCGCTGG + Intergenic
1124971461 15:34494310-34494332 CGGGAGGTGCGTGCGCGCCCCGG + Intergenic
1128263943 15:66252301-66252323 GGGCAGGGGTCCTCGCGCCCCGG - Intronic
1128651170 15:69414658-69414680 CGGCAGGGGTCTCCGCGCCCAGG - Intronic
1129262000 15:74373896-74373918 AGGCAGGGGACTGGGGGCCCCGG + Intergenic
1129348180 15:74937824-74937846 AGGCCGGGGAGAGCCCGCCCCGG + Intronic
1132552765 16:560230-560252 AGGCCGGTGAGTGCGCGCCAGGG + Intergenic
1136779315 16:32886697-32886719 AGGCAGGGGTGGGGGCCACCGGG - Intergenic
1136891302 16:33974821-33974843 AGGCAGGGGTGGGGGCCACCGGG + Intergenic
1137334367 16:47533485-47533507 AGGCAGGGTTGAGGGCGGCCTGG - Intronic
1138660885 16:58516172-58516194 AGACACAGGTGTGAGCGCCCCGG - Intronic
1140396776 16:74633926-74633948 AGGGAGGGGTGTGATCTCCCGGG - Intronic
1141709300 16:85688757-85688779 AGGCCGGGCTGGGCGCGTCCGGG - Intronic
1141932426 16:87214991-87215013 AGGCAGGAGTGTAAGCGCCTTGG + Intronic
1142126112 16:88411478-88411500 AGGCAGGGGTGCGAGCGGGCAGG + Intergenic
1142126121 16:88411510-88411532 AGGCAGGGGTGCGAGCGGGCAGG + Intergenic
1142156687 16:88535554-88535576 TGGCAGGGGTGGGGGCGCCCTGG + Exonic
1142379154 16:89721840-89721862 AGGCAGGTGGGTCCGCGGCCCGG + Exonic
1203081731 16_KI270728v1_random:1148785-1148807 AGGCAGGGGTGGGGGCCACCGGG - Intergenic
1143205890 17:5139077-5139099 AGGGAGGGGTGTGTGCTGCCTGG - Intronic
1145774836 17:27520694-27520716 AGGCCAGGCTGTGCCCGCCCAGG + Intronic
1152191941 17:78893483-78893505 GTGCAGGGGTGTGTGCGCGCAGG + Intronic
1153723914 18:7936455-7936477 AGCCAGGTGTGTGTGCACCCAGG + Intronic
1154197827 18:12279281-12279303 AGGCAGGAGTGAGCGCCCCTCGG - Intergenic
1154335420 18:13461222-13461244 AGGCAGGGGTCTTCGTGGCCAGG + Intronic
1156446213 18:37238876-37238898 AGGCAGAGGTGTGTGCACCTCGG + Intergenic
1156458803 18:37309691-37309713 GAGCAGAGGTATGCGCGCCCTGG + Intronic
1158382700 18:56951363-56951385 AGGTACGGGAGTGTGCGCCCTGG - Intronic
1158427423 18:57352602-57352624 AGGCAGGGGCGCGCGGGGCCCGG - Exonic
1160991998 19:1863826-1863848 AGGCCGGAGTGGGCGCGCCGGGG - Intergenic
1161070249 19:2256316-2256338 GGGCAGAGGTGTGGGCTCCCGGG - Intronic
1161089074 19:2351318-2351340 GGGCAGGGGTGTGCGAGGACGGG - Intronic
1161308048 19:3578151-3578173 AGGCCCGGATGTGCCCGCCCTGG + Intronic
1161398592 19:4058029-4058051 AGGAAGGGGTGTGGCAGCCCAGG + Intronic
1161569757 19:5024132-5024154 ATGCAGGGGTGTGGGCGCAAGGG - Intronic
1162534080 19:11253018-11253040 AGGCAGGGGTGGGTGCGCGCTGG + Intronic
1163173557 19:15549289-15549311 GGGGAGGGGTGTGCGCACTCAGG - Intronic
1163545996 19:17941889-17941911 AGGCAGGGGTGTCCGAGACCAGG + Intronic
1163583899 19:18153802-18153824 ACGCCCCGGTGTGCGCGCCCCGG - Intronic
1164702474 19:30295647-30295669 AGGCAGGGCTCTGCGTGTCCTGG - Intronic
1165092256 19:33393375-33393397 AGCCAGGGGTGTGTGTGCCCAGG - Intronic
1165102565 19:33447505-33447527 GGGCAGGGGCGTGCTAGCCCAGG + Intronic
1165561866 19:36687280-36687302 AGGCGGCGGTGTGCGCGGCGAGG - Intergenic
1165699430 19:37926267-37926289 GGGCAGGGGTTTTCACGCCCTGG - Intronic
1165855987 19:38879527-38879549 AGGCAGGGGCGAGCCCGCCTGGG - Intronic
1165903448 19:39179345-39179367 AGGCAGGGGTGGGCGGGCTGGGG - Exonic
1168102941 19:54150583-54150605 AGGAGGCAGTGTGCGCGCCCAGG + Intronic
1168102947 19:54150612-54150634 AGGAGGCAGTGTGCGCGCCCAGG + Intronic
1168351579 19:55679200-55679222 AGGCAGGTGTGTGCTCCCCGTGG + Intronic
1168404096 19:56101943-56101965 GGGCCGGGGTGTGGGCCCCCTGG + Intronic
1168494953 19:56840336-56840358 GGGCAGGGGTGGGCGCAGCCCGG - Intronic
925987907 2:9230983-9231005 AGGCAGGGGTTTGTGCTGCCAGG - Intronic
927873683 2:26640367-26640389 AGGCAGGGATGGGAGGGCCCAGG - Intronic
932842829 2:75099622-75099644 AGGGAGAGGTTTGCGCGGCCAGG + Intronic
933808642 2:86018213-86018235 CGACAGGGCTGTGCCCGCCCAGG + Intergenic
937281576 2:120720939-120720961 TGGCAGTGGGGTGCGAGCCCTGG - Intergenic
941462915 2:165793432-165793454 AGAGAGGGGTGTCCGCGTCCCGG + Intronic
942114492 2:172713841-172713863 AGCCAGGGCTGTGCGCTCCATGG - Intergenic
942849065 2:180461421-180461443 AGGCAGGGGTGTCCTCGTACAGG + Intergenic
948808878 2:240465024-240465046 AGGCAGAGGCGGGCGGGCCCTGG + Intronic
948855267 2:240727391-240727413 AGGCTGGGGTGGGCCCGCGCAGG - Intronic
948973106 2:241444553-241444575 GGGCAGGGGTGGCCGCTCCCTGG + Intronic
1169345085 20:4823085-4823107 TGGCGGGGGTCCGCGCGCCCCGG + Intronic
1169967900 20:11237739-11237761 AGGCAGGGCTGTGGGTGCCCCGG - Intergenic
1170443689 20:16403589-16403611 AAGCGGGGGTGGGGGCGCCCAGG + Intronic
1171086711 20:22244612-22244634 GGGCAGGTCTGTGCACGCCCAGG - Intergenic
1175844313 20:62050677-62050699 CAGCAGGGGTGTGCCCTCCCGGG - Intronic
1176028161 20:62996790-62996812 AGGCAGGGGTGACCCCACCCTGG + Intergenic
1176388362 21:6150988-6151010 AGGCAGGCCTGGGCGAGCCCTGG + Intergenic
1179411784 21:41168147-41168169 GGGCAGGGATGGGCGCGCACCGG - Exonic
1179439119 21:41380808-41380830 AGGCAGGGCTGTGCACTCCAAGG - Intronic
1179735110 21:43387260-43387282 AGGCAGGCCTGGGCGAGCCCTGG - Intergenic
1179968293 21:44818936-44818958 ACGCAGGGGTGTCCGCCCTCAGG - Intergenic
1180188819 21:46153191-46153213 GGGCAGGGCTGGGAGCGCCCAGG - Intronic
1181038940 22:20182900-20182922 AGGCAGGGGTGGGAGGGCCCTGG + Intergenic
1182463656 22:30500816-30500838 GGGCAGGGATGTGCCTGCCCTGG - Intronic
1183228524 22:36566294-36566316 AGGCTGGGGTGTGGGTGCTCAGG - Intronic
1183650014 22:39148464-39148486 AGGCAGGGGTGTGCGCGCCCAGG + Intronic
1183686101 22:39362277-39362299 AGGCAGGGGTCTGCTCGCCCAGG + Intronic
1183987125 22:41575976-41575998 AGGCAGGGGTGAGGGTGGCCTGG + Exonic
950043167 3:9933211-9933233 AGGATGGGGTGTCCGGGCCCGGG + Exonic
950153799 3:10707889-10707911 AGGCAGGGGCGGCCGGGCCCGGG - Intronic
952436587 3:33277657-33277679 GGGCAGGGCTGGGCGGGCCCGGG + Intronic
953099212 3:39809352-39809374 GGGCAGGGCTGCGCGCGCCCGGG - Intronic
953972264 3:47356446-47356468 AGTCAGAGGTGAGCCCGCCCCGG - Intergenic
958797597 3:98722567-98722589 AGGCAGGGGTGTGGGAGGCGAGG + Intergenic
961356606 3:126343565-126343587 AGGCAGCGGTTGGCGGGCCCTGG + Exonic
962376723 3:134864395-134864417 AGGCAGGAATGTGTGTGCCCAGG - Intronic
968428055 4:536002-536024 AGGCACGGGTGTGCGTGCCTGGG - Intronic
968585347 4:1413789-1413811 GGGCAGGGATGAGCGCGCTCAGG + Intergenic
968603326 4:1520594-1520616 AGGGAGGGGTCCGCGCACCCTGG - Intergenic
968809225 4:2792664-2792686 GGGCAGGGGTGGGGCCGCCCAGG + Intergenic
968916696 4:3499824-3499846 AAGCAGGGCTGTGCTGGCCCGGG + Intronic
968920098 4:3518017-3518039 AGGCTGGTGAGTGCCCGCCCGGG - Exonic
969053049 4:4386399-4386421 GGGCTGGGGTGTGGGCGCCCAGG - Exonic
969487991 4:7482850-7482872 AGCCAGGGGTGTCCGCGGCGGGG - Intronic
969591399 4:8123747-8123769 AGGCAGGGGTGTGCCGGCATTGG + Intronic
972333281 4:38082727-38082749 AGGCCTGGGTGGGCGAGCCCAGG - Intronic
973936348 4:55850499-55850521 AGGCAGGGGTGTGGCAGGCCAGG + Intergenic
974016804 4:56655816-56655838 AGGCAGGGGTCGGGGCGCGCTGG + Intronic
979107417 4:116705559-116705581 AGGCCGGTGTGCGCCCGCCCGGG - Intergenic
981580095 4:146242379-146242401 AGGCGGGGATCTGGGCGCCCAGG - Intergenic
983491837 4:168398313-168398335 AGCCAGGTGTGTGCACGCTCAGG + Intronic
984602389 4:181743629-181743651 AGGCAGGAGTGTGGGCACCAGGG + Intergenic
985840543 5:2301988-2302010 AGGCAGGGGTGAGCAAGCACAGG - Intergenic
986330362 5:6713081-6713103 ACGCCGGGGTCTGCGCGCCGCGG + Intergenic
988135908 5:27171701-27171723 AGGCAGGGGTCTCCAAGCCCTGG + Intergenic
994987272 5:106952706-106952728 AGGCAGGGGTGTGTGGGGCTGGG - Intergenic
1002454792 5:179339803-179339825 AGGCAGGTGTGAGCGGGTCCTGG - Intronic
1003176073 6:3752618-3752640 AGGCAGGGGTGGGAGAGCCAGGG + Intergenic
1005882468 6:30071652-30071674 AGGCGGCGGTGTGCGGTCCCAGG + Exonic
1006109027 6:31733835-31733857 AGGCAGTGCTGTGCCCTCCCAGG - Exonic
1006335929 6:33420454-33420476 AGGCAGGGGTGGGAGCAACCGGG + Intronic
1006729212 6:36223148-36223170 ATACAGGGGTGTGTGCTCCCTGG + Intronic
1006829379 6:36959429-36959451 AGGCAGAGGTGGCCCCGCCCAGG - Intronic
1008764070 6:54889462-54889484 AGGAAGGGGTGTGGGCGTCCTGG - Intronic
1014391609 6:120872163-120872185 AGCCAGGTGTGTGTGCACCCAGG + Intergenic
1017021527 6:150143580-150143602 AGTCAGGGACATGCGCGCCCCGG - Intronic
1019718742 7:2555367-2555389 AGCCCGGGGCGTGCGCGACCTGG - Intronic
1020072816 7:5238684-5238706 AGACAGAGCTGTGCGCGCCAGGG - Intergenic
1025033055 7:55572610-55572632 ACGCTGAGGTGCGCGCGCCCCGG + Intronic
1028830701 7:95324160-95324182 TGCCAGGGGTGTGAGTGCCCAGG - Intronic
1028955105 7:96680465-96680487 AAACAGGGGTGTGCCGGCCCAGG + Intronic
1029849404 7:103446295-103446317 CGGCAGGGATGCCCGCGCCCCGG - Intergenic
1034147041 7:148883529-148883551 AGCCCGGGGTCGGCGCGCCCGGG + Intronic
1034254063 7:149714900-149714922 GGGCGGGGGTGGGCGCGCCCGGG - Intronic
1034456368 7:151173158-151173180 AGGCTGGGGAGGGAGCGCCCTGG + Intronic
1035468930 7:159097508-159097530 TGGCAGGGCTGTGAGTGCCCAGG + Intronic
1035768786 8:2130082-2130104 AAGGCGGGGTGTGGGCGCCCTGG - Intronic
1035768811 8:2130182-2130204 AAGGCGGGGTGTGGGCGCCCTGG - Intronic
1035768824 8:2130232-2130254 AAGGCGGGGTGTGGGCGCCCTGG - Intronic
1035768838 8:2130282-2130304 AAGGCGGGGTGTGGGCGCCCTGG - Intronic
1035768851 8:2130332-2130354 AAGGCGGGGTGTGGGCGCCCTGG - Intronic
1036910812 8:12755528-12755550 CGGCGGGGCTGCGCGCGCCCGGG + Intronic
1039574263 8:38611054-38611076 GGGTAGGGGTGGGGGCGCCCTGG + Intergenic
1039610280 8:38913977-38913999 GGGCAGGGGTGTGCCTCCCCTGG + Intronic
1039918357 8:41875975-41875997 AGGCGCGGGTGTGTGCGCGCGGG - Intronic
1047790680 8:128200465-128200487 ATGCAGGGGTGGGAGCACCCTGG - Intergenic
1048407476 8:134138107-134138129 AGGAAGGGATGTGGGTGCCCTGG + Intergenic
1049039410 8:140100633-140100655 TGGCAGGGCTGTGCTCGCACCGG + Intronic
1049605615 8:143527957-143527979 AGGCAGGGTTATGAGCCCCCAGG - Intronic
1049791100 8:144473098-144473120 AGGCGCGGGTGGGCGGGCCCGGG - Exonic
1049831590 8:144704574-144704596 AGGCAGGGGTGGGGGCGGCTGGG + Intergenic
1049835010 8:144729971-144729993 AGGCAGGGCTGAGCCCACCCAGG + Intronic
1055018838 9:71647549-71647571 AGGCAGGGATGTGTGCTCCAGGG - Intergenic
1057192718 9:93096374-93096396 CGGCAGGGATGCGGGCGCCCTGG + Intronic
1057299958 9:93872172-93872194 GGGCAGGGGTGTGCACGGGCCGG + Intergenic
1057773021 9:97984029-97984051 AGGCCGGGCTCCGCGCGCCCCGG + Intronic
1059770146 9:117416077-117416099 ATGCAGAGGTGTCCGCTCCCTGG - Intergenic
1061117021 9:128620233-128620255 AAGCAGGAGTGTGCACTCCCAGG + Intronic
1061407126 9:130398588-130398610 AGGCTGGGGTGTGGGCGGTCAGG - Intronic
1062192661 9:135255856-135255878 AGGCTGGGGTGTGCGGGGGCAGG - Intergenic
1062368739 9:136225571-136225593 AGGCAGTTTTGTGCTCGCCCAGG - Intronic
1203444518 Un_GL000219v1:42574-42596 AGGCAGGGCCATGCGCGCCTCGG - Intergenic
1185895362 X:3853735-3853757 GGGCAGGGGTGCGCTCCCCCTGG - Intergenic
1185900479 X:3892159-3892181 GGGCAGGGGTGCGCTCCCCCTGG - Intergenic
1185905595 X:3930590-3930612 GGGCAGGGGTGCGCTCCCCCTGG - Intergenic
1186350075 X:8731750-8731772 AGGCTGGGAGGCGCGCGCCCCGG + Intronic
1190053875 X:47170908-47170930 AGCCAGGGATGTGCGGGCTCCGG - Intronic
1198727516 X:139692461-139692483 GGGCGTGGGTGTGCGCACCCAGG - Intronic
1200086771 X:153610963-153610985 AGGCTGGGCTGGGAGCGCCCCGG - Intergenic
1200100439 X:153687303-153687325 AGGCAGGGGTGGGGGCCGCCGGG + Intronic