ID: 1183650870

View in Genome Browser
Species Human (GRCh38)
Location 22:39152645-39152667
Sequence GCGCTCGCTCGCTGGCGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 78}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183650870_1183650885 21 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650885 22:39152689-39152711 GGAGCGCGCGGAACGGCCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 98
1183650870_1183650878 -5 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650878 22:39152663-39152685 AGCGCGCGCAAGGAGGGGGCGGG 0: 1
1: 1
2: 4
3: 13
4: 170
1183650870_1183650880 -1 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650880 22:39152667-39152689 CGCGCAAGGAGGGGGCGGGGCGG 0: 1
1: 0
2: 6
3: 45
4: 519
1183650870_1183650884 20 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650884 22:39152688-39152710 GGGAGCGCGCGGAACGGCCGCGG 0: 1
1: 0
2: 0
3: 16
4: 137
1183650870_1183650879 -4 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650879 22:39152664-39152686 GCGCGCGCAAGGAGGGGGCGGGG 0: 1
1: 1
2: 4
3: 34
4: 296
1183650870_1183650876 -9 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650876 22:39152659-39152681 AGCGAGCGCGCGCAAGGAGGGGG 0: 1
1: 0
2: 1
3: 6
4: 72
1183650870_1183650875 -10 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650875 22:39152658-39152680 GAGCGAGCGCGCGCAAGGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1183650870_1183650877 -6 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650877 22:39152662-39152684 GAGCGCGCGCAAGGAGGGGGCGG 0: 1
1: 1
2: 1
3: 20
4: 232
1183650870_1183650883 14 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650883 22:39152682-39152704 CGGGGCGGGAGCGCGCGGAACGG 0: 1
1: 0
2: 5
3: 29
4: 245
1183650870_1183650881 0 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650881 22:39152668-39152690 GCGCAAGGAGGGGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 122
4: 1030
1183650870_1183650886 26 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650886 22:39152694-39152716 GCGCGGAACGGCCGCGGGCTCGG 0: 1
1: 0
2: 1
3: 10
4: 96
1183650870_1183650882 9 Left 1183650870 22:39152645-39152667 CCTCGGCGCCAGCGAGCGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1183650882 22:39152677-39152699 GGGGGCGGGGCGGGAGCGCGCGG 0: 1
1: 4
2: 30
3: 349
4: 2184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183650870 Original CRISPR GCGCTCGCTCGCTGGCGCCG AGG (reversed) Exonic
904563389 1:31413316-31413338 GCGCGCGCGGGCGGGCGCCGGGG - Intronic
907038300 1:51236218-51236240 GCCCTCGCCTCCTGGCGCCGGGG + Intergenic
915600635 1:156920958-156920980 GCCCTGGTACGCTGGCGCCGGGG + Exonic
918487503 1:185045366-185045388 GCGCACCCTCCCTCGCGCCGCGG + Exonic
922821357 1:228487724-228487746 GCCGTCGCGCGCGGGCGCCGCGG - Exonic
1065102606 10:22345658-22345680 GCCCTAACTAGCTGGCGCCGAGG + Intronic
1066094150 10:32056493-32056515 GCGCTCGCACCCTGCCGCGGCGG + Intergenic
1066370553 10:34815304-34815326 GCGCTCGCTCGGGGCCGCTGGGG + Exonic
1066562000 10:36679602-36679624 TCGCTGGCTCGCTGGCTCCCTGG - Intergenic
1069769486 10:70888367-70888389 GCTCTCTGTCGCTGGCGGCGGGG - Intronic
1071996469 10:91153913-91153935 GCGCACTCTCGCTGCCGCCCTGG + Intergenic
1075522003 10:123148664-123148686 GCGCTCGCTCGCTGCCACACTGG - Intronic
1076035559 10:127196321-127196343 GCGCTCGCTTGCTCGCGACGCGG + Intronic
1077100324 11:819632-819654 CCGCTCGCTCGCTGGAGCCGGGG - Exonic
1084636851 11:70398604-70398626 GCGCTCGCTCACCGCCGCCTGGG - Exonic
1088223249 11:107591279-107591301 GCGCTCGGTCCCGGGCGCCGAGG - Exonic
1090736880 11:129618144-129618166 GCGCTCGCTCTCGGGCACAGCGG - Intergenic
1092502648 12:9064536-9064558 GCTCTCGCCCGCCGCCGCCGCGG + Intergenic
1096863775 12:54549399-54549421 GCGCACGCACACAGGCGCCGGGG - Exonic
1108542067 13:51453632-51453654 GCCCGCGCCCGCTCGCGCCGGGG - Intronic
1122208224 14:100159131-100159153 GCACGCGCTCCCTGGCGCGGAGG - Intronic
1124652434 15:31483765-31483787 GCTCTGGCGCGCTGGCGCCGGGG + Exonic
1127753479 15:62068124-62068146 GCGCTCGCCCGGCGGCCCCGCGG + Exonic
1131144545 15:90002363-90002385 GCGCTCGCTGTCTGGGGGCGTGG + Intronic
1131215108 15:90529910-90529932 CCGGCCGCTCGCTGGCTCCGGGG + Intronic
1133784537 16:8963923-8963945 TCGCTCGCTCGCTCGCTCCGCGG - Intronic
1144128054 17:12220934-12220956 GCGCTGGCCCGCAAGCGCCGCGG - Intergenic
1146053318 17:29568703-29568725 GCGCTCCCTCGCTGGCGGAGCGG + Exonic
1155152681 18:23135474-23135496 CCGCTGGCTCGCGGGCTCCGGGG - Intronic
1160987998 19:1848405-1848427 GGGCCCCCTCACTGGCGCCGCGG + Exonic
1163424924 19:17236021-17236043 GCACTCGCTGCCTGGTGCCGTGG - Exonic
1163729528 19:18941133-18941155 CCGCTCGCTCCCTGGCTCCCGGG + Intronic
1165879417 19:39031984-39032006 GCGCGCGGCCGGTGGCGCCGTGG + Exonic
1166786539 19:45370492-45370514 GCGCTCGCTAGCGGGCGCGGGGG - Intronic
1167638419 19:50667870-50667892 GCGCTCGCTCGCGGGCGGCCAGG + Exonic
1168247028 19:55117556-55117578 GCGCTCGCTCGCTCGCTGGGCGG - Exonic
927751411 2:25673578-25673600 GCCCTCGCGCCCTCGCGCCGGGG - Exonic
928904356 2:36355401-36355423 CCGGGCGCTCGCTGGCACCGTGG - Intergenic
933666976 2:84971599-84971621 GCCCTCGCTCGCTCGCTCCCGGG - Intronic
939153812 2:138501774-138501796 GCCCTCGCGGGCTGGAGCCGGGG + Intergenic
947552004 2:231053048-231053070 GCGCCCACTAGCGGGCGCCGCGG + Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1169220595 20:3820255-3820277 GCGCCCCCTCGCGGCCGCCGGGG + Intergenic
1169327409 20:4686857-4686879 GCGGGCGATCGCTGGCGCCCAGG + Intronic
1172841083 20:37903153-37903175 GCGCTCGCTCCCCGAAGCCGGGG + Exonic
1175443852 20:59007383-59007405 CCGCTCCCTCCCTGGCTCCGGGG + Intergenic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176547886 21:8209258-8209280 TCGCGCGCCCGCGGGCGCCGGGG + Intergenic
1177795877 21:25778396-25778418 GCGCTGGCCCGCAAGCGCCGCGG - Intergenic
1181127618 22:20711141-20711163 GCCCTAGCTCCCTGGGGCCGGGG + Intronic
1183414554 22:37675058-37675080 GCGCTCTCTCGCTGGCTCCTCGG - Intergenic
1183650870 22:39152645-39152667 GCGCTCGCTCGCTGGCGCCGAGG - Exonic
1184536559 22:45091579-45091601 CCGCTCGCTCGCTGACGACCTGG + Intergenic
1184815004 22:46862574-46862596 GCTCTCGCTGGCTGGCTCCCGGG - Intronic
1185128505 22:49024810-49024832 GGGCTCGTGCTCTGGCGCCGTGG - Intergenic
950721350 3:14884911-14884933 GCATTCACTCCCTGGCGCCGAGG + Intronic
954581813 3:51707078-51707100 TCGCTCGCTCGCTGGCTCGCTGG - Exonic
961028748 3:123584597-123584619 GCGCTGGCTCGCGAGGGCCGCGG - Intronic
961144856 3:124585096-124585118 GCGCTCGCTGGCTGGCGGTGAGG + Intronic
967924167 3:194633326-194633348 GCGCTCGGCCGGAGGCGCCGCGG - Exonic
968583609 4:1406010-1406032 CCGCGCCCTCGCCGGCGCCGGGG - Exonic
972817179 4:42657141-42657163 GAGCTCGGGCGCCGGCGCCGGGG + Intergenic
985129710 4:186726929-186726951 GCCCGCGCTCGCCGGCGCCCGGG - Intergenic
994353810 5:98773735-98773757 GCCCACGCTGGCTGGGGCCGGGG + Intronic
994359966 5:98839594-98839616 TCGCCCGGTCGCTGCCGCCGGGG - Intergenic
996175102 5:120346963-120346985 GCTCTCTCTCGCTGGCTCCAGGG - Intergenic
1001542854 5:172551330-172551352 GCGCTTGCTCCCTGGAGCCCAGG + Intergenic
1003604011 6:7542786-7542808 GCGCTCGCCCGCGGGGGCTGCGG - Intronic
1006125397 6:31834644-31834666 GCGCTGGCCGGCCGGCGCCGGGG + Exonic
1008030477 6:46688451-46688473 GAGCAGGCTCGCTGGCGCCTGGG + Exonic
1012895536 6:104941572-104941594 GCGCACGCCCTCTGGCGGCGCGG - Intergenic
1014913572 6:127119799-127119821 GCGCTCGCTCCCTGGCTTCCTGG - Intronic
1016863770 6:148747110-148747132 GGGCTCGCTTGCGGCCGCCGGGG - Intergenic
1016923363 6:149317579-149317601 GCTCTCGCTCGCTCTCGCCGCGG - Intronic
1017470431 6:154733359-154733381 GGGCGCGCTAGCCGGCGCCGCGG + Exonic
1023846491 7:44123740-44123762 GGGCTCGCAGGCCGGCGCCGCGG + Intronic
1027001719 7:74658437-74658459 CCGCTCGCTCGCTCGCGCGCGGG - Intronic
1029238832 7:99144156-99144178 GCGCACGCACGCAGGCGCGGGGG - Intergenic
1029374854 7:100171454-100171476 GCGCGCGCTAGCTGGCGCTTCGG - Intronic
1034455454 7:151167636-151167658 GGGCTCGCTCCCTGGCTCCCGGG + Intronic
1039921431 8:41896710-41896732 GAGCTCGCTTGCCGGCGCCCGGG + Exonic
1041689910 8:60678746-60678768 GCGCTGGCGTGCTGGGGCCGCGG + Intergenic
1042189994 8:66177087-66177109 GCGCTCGCTCGACAGCCCCGCGG - Exonic
1049681347 8:143919870-143919892 GAGCTCGCTGGCTGGCACAGGGG + Exonic
1058508841 9:105694518-105694540 GCGCGTGCGCCCTGGCGCCGAGG - Intergenic
1060643865 9:125261786-125261808 GCGCACGCGCGCTGGCGTGGCGG + Intronic
1061541064 9:131278005-131278027 CCGCCCGCTCGCCGGCCCCGCGG + Intergenic
1061862566 9:133475573-133475595 GCGCTGGCTGGCTGTGGCCGGGG - Exonic
1189324583 X:40105043-40105065 CCGCTCCCTGGCTGGCGCCGGGG + Intronic
1197709339 X:129654647-129654669 GCGCCGGCTCGCCGGGGCCGCGG - Exonic
1199623528 X:149720245-149720267 GCGCTGGCTTGTTGGGGCCGAGG + Intergenic