ID: 1183650906

View in Genome Browser
Species Human (GRCh38)
Location 22:39152757-39152779
Sequence CCCCGGGGGCGGGGTTCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183650906_1183650926 9 Left 1183650906 22:39152757-39152779 CCATCGGAACCCCGCCCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1183650926 22:39152789-39152811 GCGGGTTGCGATTGGGCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1183650906_1183650920 2 Left 1183650906 22:39152757-39152779 CCATCGGAACCCCGCCCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1183650920 22:39152782-39152804 CGCCCCCGCGGGTTGCGATTGGG 0: 1
1: 0
2: 0
3: 0
4: 13
1183650906_1183650925 8 Left 1183650906 22:39152757-39152779 CCATCGGAACCCCGCCCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1183650925 22:39152788-39152810 CGCGGGTTGCGATTGGGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1183650906_1183650913 -9 Left 1183650906 22:39152757-39152779 CCATCGGAACCCCGCCCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1183650913 22:39152771-39152793 CCCCCGGGGCCCGCCCCCGCGGG 0: 1
1: 1
2: 6
3: 75
4: 490
1183650906_1183650919 1 Left 1183650906 22:39152757-39152779 CCATCGGAACCCCGCCCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1183650919 22:39152781-39152803 CCGCCCCCGCGGGTTGCGATTGG 0: 1
1: 0
2: 0
3: 3
4: 24
1183650906_1183650911 -10 Left 1183650906 22:39152757-39152779 CCATCGGAACCCCGCCCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1183650911 22:39152770-39152792 GCCCCCGGGGCCCGCCCCCGCGG 0: 1
1: 0
2: 3
3: 62
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183650906 Original CRISPR CCCCGGGGGCGGGGTTCCGA TGG (reversed) Intergenic
900283907 1:1890488-1890510 CCCCGGGGGCGCGGGTCGGGCGG - Intronic
901871155 1:12140099-12140121 TCCCAGGGGTGGGGTTCAGAGGG + Intronic
905803944 1:40862496-40862518 CCCAAGGGGCGGGGTTCCAGTGG - Intergenic
907278006 1:53327613-53327635 CCGCGGGGGCGGGGGGCCGAGGG + Intronic
907394189 1:54178147-54178169 CCCCAGGGGCTGGGTTCTGCAGG - Intronic
909314469 1:74198161-74198183 CTCCGGGGGCGTGGTTACGTGGG + Exonic
912502277 1:110130348-110130370 CCCTGGGGGCGGGGGACCGCTGG + Intergenic
920674928 1:208032047-208032069 CCCCGGGTCCGGGCTTCCCATGG + Intronic
922124905 1:222712511-222712533 CCTCGGGGGCGGGGTCTCGGCGG - Exonic
922945200 1:229508199-229508221 CCCCGGGTACCGGGTCCCGAAGG - Exonic
1062834403 10:626463-626485 CCCCGGGGACGGGGGACGGAGGG - Intronic
1065100448 10:22325808-22325830 GCCCGGGGGCCGGGATGCGAGGG - Intronic
1073060570 10:100731091-100731113 GCTCGGGGGCGGGGTTGAGAGGG + Intergenic
1073491254 10:103854994-103855016 CCGGGGGGGCGGGGGTGCGAAGG + Intronic
1077174177 11:1181198-1181220 CCCCTGGGGCTGGGGTCCGGGGG + Intronic
1077362428 11:2146572-2146594 CCCTGGGAGAGGGGTTCAGACGG + Intronic
1079090469 11:17476875-17476897 CCCGGGGGGCGGGGGCCTGACGG - Intergenic
1081620830 11:44618383-44618405 GATCGGGGGCGGGGCTCCGAGGG + Intronic
1083309594 11:61777513-61777535 CCGCGGGGGCGGGGCTCCTGGGG + Intronic
1083609567 11:63998584-63998606 CCTCGGGGGCGGGGCGCGGAGGG + Exonic
1083657189 11:64235122-64235144 CGCCGGGGGCGGGGCTCCCTCGG + Intronic
1084003480 11:66311535-66311557 CCCTGGGGGCTGTGTTGCGAAGG - Intergenic
1084041654 11:66546269-66546291 GCCAGCGGGCGGGGCTCCGACGG - Intergenic
1085475124 11:76784320-76784342 CCCCGGGGGCGGGCTGCAAACGG - Intronic
1088604437 11:111514612-111514634 CCGCAGGGGTGGGCTTCCGACGG + Intergenic
1092226823 12:6753176-6753198 GCCAGGGGGCGGGGCTCCCACGG - Exonic
1097925438 12:65121611-65121633 CCCCGGGGGCGGGGCCGCGAGGG + Intergenic
1103091890 12:118103737-118103759 CCCGGGGCCCGGGGTACCGAGGG + Exonic
1103362419 12:120361894-120361916 CCCCGGGGCCGGCGTTGCCATGG - Intronic
1103432844 12:120903540-120903562 CCCCGGGGGTGGGAATCCCACGG - Intronic
1117353582 14:54902930-54902952 CCCCGGGGGCGGGAGGCCGAGGG - Intergenic
1118979858 14:70707557-70707579 CTCCGTGGGCCGGGTTCTGATGG - Intergenic
1122740338 14:103868399-103868421 CCCCAGGTGAGGGGGTCCGAGGG - Intergenic
1122905939 14:104801575-104801597 CCCCAGGGGCAGGGTTCCCCGGG - Exonic
1122925535 14:104897852-104897874 CCCCGGGAGTGGCGTTCAGATGG - Intergenic
1125200708 15:37098851-37098873 CCCCGGGGGCAGGGAGCGGAGGG + Intronic
1126724949 15:51622640-51622662 TCCGCGGGGCGGGTTTCCGAGGG - Intronic
1128999421 15:72319999-72320021 CCCAGGGGGCGGGGTCCGGGTGG + Exonic
1129653642 15:77508563-77508585 CCCCAGGGGTGGGGTTCAGCAGG - Intergenic
1132128415 15:99251407-99251429 CGTCGGGGGCGGGGCTCCGGGGG - Exonic
1132968637 16:2673663-2673685 CCCCGGGGGCGGGGCTCTGCGGG + Intergenic
1133756158 16:8764091-8764113 CTCCGGAGGCAGGATTCCGAGGG - Exonic
1136478374 16:30526741-30526763 GCCCGGGGCCGGGGTCCAGAAGG - Intronic
1142285710 16:89170713-89170735 CCCAGGGGGCGGGGTCTCGAAGG + Intergenic
1142298590 16:89243070-89243092 TCCAGGGGGCGGGGTCTCGAAGG + Intergenic
1142412303 16:89923022-89923044 AGCTGGGGGCGGGGTTCCCAGGG + Intronic
1142757639 17:2025234-2025256 CCGCGGCGGCGGTGGTCCGAGGG - Exonic
1142985867 17:3695178-3695200 CCCCGGGGTCAGGGCTCTGAAGG + Intronic
1143141923 17:4745737-4745759 CCCAGGGGTCGGGGCTCCCAGGG - Intronic
1143175669 17:4953553-4953575 CCCCGGGGTGGGGGTTCCCAGGG + Intronic
1147192793 17:38747515-38747537 CCCCGGGAGGGGTGTTCCGGAGG + Intronic
1148334458 17:46832265-46832287 GCCCGGGGTGGGGGCTCCGAGGG - Intronic
1148826396 17:50397338-50397360 CCCCGGCTCCGGGGTTCCGGCGG + Exonic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1152659259 17:81534879-81534901 GCCCTGGGGCAGGGTTCCCAGGG + Intronic
1152855833 17:82664163-82664185 CCCCGGGGGCGCTGTGCCGACGG + Intronic
1152855906 17:82664364-82664386 TCCCGGGGGCGCTGTGCCGATGG + Intronic
1154304166 18:13218330-13218352 GCCCGCGGGCGGGGTTACGCCGG + Intronic
1155100335 18:22604709-22604731 CCACGGGGGCGGGTGGCCGAGGG + Intergenic
1156260970 18:35444766-35444788 ACCCAGGGGCGGGCTTCCCATGG - Intronic
1157330534 18:46700724-46700746 CCCCAGGGGCTGGGCTCCTAGGG - Intronic
1159511188 18:69400639-69400661 CCCCGGGCGCGAGATTCCTAAGG - Intergenic
1160540294 18:79617314-79617336 CCGGGGGGGCGGGGTCCCGGGGG - Intergenic
1160540367 18:79617429-79617451 CCCGGGGGGCGGGGTCCCGGGGG - Intergenic
1160540404 18:79617494-79617516 CCCGGGGGGCGGGGTCCTGGGGG - Intergenic
1160613897 18:80109551-80109573 CGGCGGGGGCGGGGCTCGGAGGG - Intronic
1160810755 19:1012033-1012055 CCCCGGGGCCGAGGGTGCGAGGG - Intronic
1160847810 19:1174069-1174091 CCCCGGGCGCAGGGGTCCGCGGG + Intronic
1160864381 19:1250560-1250582 GCCCGGGGGCCGGGGCCCGAGGG - Intronic
1160917548 19:1504380-1504402 CACCTGGGGAGGGGTTCCCAGGG + Intergenic
1161031889 19:2061432-2061454 CGCCGGGGAGGGGGTTCCCAGGG - Intergenic
1161090898 19:2359823-2359845 CCCTGGGGGCGAGGTGCTGAGGG - Intergenic
1161400823 19:4065745-4065767 CCCCACGGGCGGGGGGCCGAGGG + Intronic
1162335434 19:10057364-10057386 GCCAAGGGGCGGGGTTCCGGGGG - Intergenic
1163488964 19:17605948-17605970 CCCCAGGGGCGGGGCTCGGGGGG - Exonic
1165489624 19:36115681-36115703 CCATGGGGGCGGGGTCCGGAGGG + Intronic
1167454183 19:49590071-49590093 GCCCGGGGGCGGGGCGCAGAGGG + Intronic
1168692885 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG + Exonic
926672841 2:15591787-15591809 CCCCGGGAGAACGGTTCCGATGG - Exonic
932342999 2:70978577-70978599 CCCCGGGGGCGGGGCGCCGGCGG + Intronic
936104614 2:109613992-109614014 CTCCGGGGGCGGGGTTGGGGCGG + Exonic
948945597 2:241217614-241217636 CCGCGGGGGGCGCGTTCCGAGGG + Intronic
1169132441 20:3173201-3173223 CCCGGGGGGCGGGGCGCAGAGGG + Intronic
1175368410 20:58470863-58470885 CCCTGGGGACGGGGCTGCGATGG - Intronic
1176075841 20:63247903-63247925 CCCTGGGGGCGGGGTGCAGTGGG - Intronic
1176104259 20:63378294-63378316 CCCCGGGGCCGGGGGTGTGATGG + Intronic
1176733624 21:10522337-10522359 CGCCGGGAGCGGGGGTCCGGGGG + Intronic
1178856576 21:36255205-36255227 CCCCAGGGGCGGGGTTGCAGTGG - Intronic
1179581584 21:42347807-42347829 CCCCGGGGGAGGCGGTCCCAGGG - Intronic
1181817394 22:25448660-25448682 CCCTGGGGGCGGGGGTTGGAGGG - Intergenic
1183504491 22:38201848-38201870 CCCCGGGGGCGGGGCTTCCAGGG + Intronic
1183535380 22:38398123-38398145 CGCCGGGAGCGGGGGTCCGGGGG - Intronic
1183650906 22:39152757-39152779 CCCCGGGGGCGGGGTTCCGATGG - Intergenic
1183868615 22:40723717-40723739 ACCAGGGGGCGGTGTTCCAAGGG + Intergenic
1184269423 22:43370316-43370338 CCCCGGGGACGGGGTAGCCATGG - Intergenic
1184523562 22:45009122-45009144 CCCGGGGCGCGGGGGCCCGAGGG + Intronic
1184620209 22:45671535-45671557 CCCCAGGGGAGGGGATCCGGGGG - Intergenic
950658022 3:14449349-14449371 CCCAGGGAGCGGGGAACCGAGGG - Intronic
951543768 3:23806430-23806452 CCCCAGGGGCGGGGGTTCGCGGG + Intronic
954386361 3:50246130-50246152 CGCCAGGGGCGGGGCTCAGAGGG + Intronic
960937635 3:122913182-122913204 CGCCGGGCGCGGGGTACCGTCGG + Exonic
961734735 3:128994164-128994186 GCCTGGGGGCGGGGCTCCGCGGG + Intronic
961779360 3:129312773-129312795 ACCCTGGGGCTGGGTTCCCAAGG + Intergenic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
972765919 4:42152185-42152207 CGCCGGGCGCCGGGCTCCGAGGG + Exonic
975556675 4:75672719-75672741 CCCCACGGGCGGGGTGGCGACGG + Intronic
984832445 4:183988085-183988107 CCCCAGGCGCGGGGTGGCGAGGG - Intronic
985537361 5:472817-472839 CCCCGGGCGCGGGGCTCGGTTGG + Exonic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
986017235 5:3768027-3768049 TCCCGGCTGCGGGGTGCCGATGG + Intergenic
987132423 5:14871880-14871902 CCCCGGGGGCGGGCTGGGGAGGG + Intergenic
987979576 5:25064440-25064462 CCCGTGGGTCGGGGTTCCCAGGG + Intergenic
990076450 5:51851444-51851466 CCCGGGAGGCGGAGTTGCGAAGG + Intergenic
990626498 5:57618581-57618603 CCCAGGTGGCTGGGTTCCAAAGG - Intergenic
992990425 5:82278113-82278135 CGCCGAGGTCGGGGTACCGAGGG - Intronic
996765505 5:127030989-127031011 TCCTCCGGGCGGGGTTCCGATGG - Intergenic
999288223 5:150406881-150406903 CCCCTGGGGCAGGGCTCCCATGG + Exonic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1005959884 6:30687126-30687148 CCCCGGGGGAGGGGGTGCGGAGG + Exonic
1007701785 6:43770129-43770151 GGCCGGGGGCGGGGTCCCGGCGG + Intergenic
1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG + Intergenic
1019545268 7:1571132-1571154 CTCCGAGGGTGGGGTTCTGAAGG - Intergenic
1021868384 7:24980249-24980271 GCCCAGGGGCGGGGCCCCGAGGG + Intronic
1026979455 7:74518017-74518039 CCCTTGGTGCGGGGTTCCCATGG - Intronic
1034093134 7:148382271-148382293 CCTGGGGCACGGGGTTCCGATGG - Intronic
1035282803 7:157787964-157787986 CCCCGGCTGCGTGGTTCCCAGGG - Intronic
1035724622 8:1816896-1816918 CCCCGTGGGCGGCGTCCCGTGGG - Intergenic
1036204373 8:6794376-6794398 CCCAGGGACCGGGGTTCCCAAGG + Intergenic
1037450736 8:19013827-19013849 CCCCGGGGGCGGAGGGCGGAGGG + Intronic
1037903690 8:22703145-22703167 ACCCGGGGGCAGGGTGCGGAGGG + Intergenic
1038176248 8:25184428-25184450 CCCCGGAGGCTGGGTCCCGGGGG - Intergenic
1043296138 8:78666003-78666025 CTGCGGGGGCGGGGATCCGTGGG - Intergenic
1049010521 8:139884272-139884294 CCCTGGGGGAGAGGTTCTGATGG - Intronic
1049235585 8:141510735-141510757 CCCCGGGGGGTGGCTGCCGACGG - Intergenic
1051483046 9:17579466-17579488 AGCCGGGGGCGGGGGACCGAGGG - Intronic
1053435007 9:38068727-38068749 CGCCGGGGCCGGGGCGCCGAGGG - Exonic
1060480870 9:124016168-124016190 CCCGGGGGGCTCGCTTCCGAGGG - Intronic
1060555184 9:124504425-124504447 CCCCGGGGAGGGGGTCCCGGCGG - Intronic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1061180574 9:129022905-129022927 ACCCAGGGTCGGGGTTCAGAAGG + Intronic
1185457528 X:318374-318396 ACCTGGGGGCGGGGCTCTGAGGG - Intronic
1187367129 X:18675060-18675082 CCTCGGGGGCGGGGTCACGGTGG - Intergenic
1187507119 X:19887198-19887220 CCCCGGGGGCAGGGTCCGGACGG - Intronic
1190066268 X:47243617-47243639 CCCCGGGGGTGGGGGGCGGAGGG + Intronic
1199699384 X:150364632-150364654 CCCCGGGGGCGCGGTCCCCACGG + Intronic