ID: 1183653827

View in Genome Browser
Species Human (GRCh38)
Location 22:39173862-39173884
Sequence CCTGGAACAGGGAGGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183653827_1183653836 -3 Left 1183653827 22:39173862-39173884 CCCTACACCCTCCCTGTTCCAGG No data
Right 1183653836 22:39173882-39173904 AGGGCTCAGTCCCTTCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183653827 Original CRISPR CCTGGAACAGGGAGGGTGTA GGG (reversed) Intergenic
No off target data available for this crispr