ID: 1183655236

View in Genome Browser
Species Human (GRCh38)
Location 22:39180623-39180645
Sequence CTGATGGCTGCCCCTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183655228_1183655236 -9 Left 1183655228 22:39180609-39180631 CCCCACCCTTGTCCCTGATGGCT No data
Right 1183655236 22:39180623-39180645 CTGATGGCTGCCCCTCTCAAGGG No data
1183655229_1183655236 -10 Left 1183655229 22:39180610-39180632 CCCACCCTTGTCCCTGATGGCTG No data
Right 1183655236 22:39180623-39180645 CTGATGGCTGCCCCTCTCAAGGG No data
1183655226_1183655236 8 Left 1183655226 22:39180592-39180614 CCTCAGAGATTCGAGGGCCCCAC No data
Right 1183655236 22:39180623-39180645 CTGATGGCTGCCCCTCTCAAGGG No data
1183655225_1183655236 9 Left 1183655225 22:39180591-39180613 CCCTCAGAGATTCGAGGGCCCCA No data
Right 1183655236 22:39180623-39180645 CTGATGGCTGCCCCTCTCAAGGG No data
1183655224_1183655236 10 Left 1183655224 22:39180590-39180612 CCCCTCAGAGATTCGAGGGCCCC No data
Right 1183655236 22:39180623-39180645 CTGATGGCTGCCCCTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183655236 Original CRISPR CTGATGGCTGCCCCTCTCAA GGG Intergenic
No off target data available for this crispr