ID: 1183658671

View in Genome Browser
Species Human (GRCh38)
Location 22:39205839-39205861
Sequence TGGTGACTGGGGGGTGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183658671_1183658690 13 Left 1183658671 22:39205839-39205861 CCCGGGACACCCCCCAGTCACCA No data
Right 1183658690 22:39205875-39205897 AGTGGCTTCGTGGGGGATGTGGG No data
1183658671_1183658684 5 Left 1183658671 22:39205839-39205861 CCCGGGACACCCCCCAGTCACCA No data
Right 1183658684 22:39205867-39205889 AGCCTCCCAGTGGCTTCGTGGGG No data
1183658671_1183658689 12 Left 1183658671 22:39205839-39205861 CCCGGGACACCCCCCAGTCACCA No data
Right 1183658689 22:39205874-39205896 CAGTGGCTTCGTGGGGGATGTGG No data
1183658671_1183658678 -5 Left 1183658671 22:39205839-39205861 CCCGGGACACCCCCCAGTCACCA No data
Right 1183658678 22:39205857-39205879 CACCACCCACAGCCTCCCAGTGG No data
1183658671_1183658682 3 Left 1183658671 22:39205839-39205861 CCCGGGACACCCCCCAGTCACCA No data
Right 1183658682 22:39205865-39205887 ACAGCCTCCCAGTGGCTTCGTGG No data
1183658671_1183658685 6 Left 1183658671 22:39205839-39205861 CCCGGGACACCCCCCAGTCACCA No data
Right 1183658685 22:39205868-39205890 GCCTCCCAGTGGCTTCGTGGGGG No data
1183658671_1183658683 4 Left 1183658671 22:39205839-39205861 CCCGGGACACCCCCCAGTCACCA No data
Right 1183658683 22:39205866-39205888 CAGCCTCCCAGTGGCTTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183658671 Original CRISPR TGGTGACTGGGGGGTGTCCC GGG (reversed) Intergenic
No off target data available for this crispr