ID: 1183659345

View in Genome Browser
Species Human (GRCh38)
Location 22:39209488-39209510
Sequence GTGGCCATATAACGGCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183659345_1183659349 1 Left 1183659345 22:39209488-39209510 CCAGAGTGCCGTTATATGGCCAC No data
Right 1183659349 22:39209512-39209534 CTCAGACCCACCATCGGTCCAGG No data
1183659345_1183659353 18 Left 1183659345 22:39209488-39209510 CCAGAGTGCCGTTATATGGCCAC No data
Right 1183659353 22:39209529-39209551 TCCAGGAGAATCAGATGCCCAGG No data
1183659345_1183659347 -5 Left 1183659345 22:39209488-39209510 CCAGAGTGCCGTTATATGGCCAC No data
Right 1183659347 22:39209506-39209528 GCCACACTCAGACCCACCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183659345 Original CRISPR GTGGCCATATAACGGCACTC TGG (reversed) Intergenic
No off target data available for this crispr