ID: 1183659347

View in Genome Browser
Species Human (GRCh38)
Location 22:39209506-39209528
Sequence GCCACACTCAGACCCACCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183659345_1183659347 -5 Left 1183659345 22:39209488-39209510 CCAGAGTGCCGTTATATGGCCAC No data
Right 1183659347 22:39209506-39209528 GCCACACTCAGACCCACCATCGG No data
1183659343_1183659347 13 Left 1183659343 22:39209470-39209492 CCTCTCATGTCTCATTAGCCAGA No data
Right 1183659347 22:39209506-39209528 GCCACACTCAGACCCACCATCGG No data
1183659341_1183659347 24 Left 1183659341 22:39209459-39209481 CCCACAGACTTCCTCTCATGTCT No data
Right 1183659347 22:39209506-39209528 GCCACACTCAGACCCACCATCGG No data
1183659340_1183659347 25 Left 1183659340 22:39209458-39209480 CCCCACAGACTTCCTCTCATGTC No data
Right 1183659347 22:39209506-39209528 GCCACACTCAGACCCACCATCGG No data
1183659342_1183659347 23 Left 1183659342 22:39209460-39209482 CCACAGACTTCCTCTCATGTCTC No data
Right 1183659347 22:39209506-39209528 GCCACACTCAGACCCACCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183659347 Original CRISPR GCCACACTCAGACCCACCAT CGG Intergenic
No off target data available for this crispr