ID: 1183659353

View in Genome Browser
Species Human (GRCh38)
Location 22:39209529-39209551
Sequence TCCAGGAGAATCAGATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183659346_1183659353 10 Left 1183659346 22:39209496-39209518 CCGTTATATGGCCACACTCAGAC No data
Right 1183659353 22:39209529-39209551 TCCAGGAGAATCAGATGCCCAGG No data
1183659348_1183659353 -1 Left 1183659348 22:39209507-39209529 CCACACTCAGACCCACCATCGGT No data
Right 1183659353 22:39209529-39209551 TCCAGGAGAATCAGATGCCCAGG No data
1183659345_1183659353 18 Left 1183659345 22:39209488-39209510 CCAGAGTGCCGTTATATGGCCAC No data
Right 1183659353 22:39209529-39209551 TCCAGGAGAATCAGATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183659353 Original CRISPR TCCAGGAGAATCAGATGCCC AGG Intergenic
No off target data available for this crispr