ID: 1183661172

View in Genome Browser
Species Human (GRCh38)
Location 22:39222345-39222367
Sequence GGGCCTTCCAGGGGCCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661172_1183661183 8 Left 1183661172 22:39222345-39222367 CCCACCGGGCCCCTGGAAGGCCC No data
Right 1183661183 22:39222376-39222398 TGCTGCGCTGCTGTATGGGATGG No data
1183661172_1183661186 23 Left 1183661172 22:39222345-39222367 CCCACCGGGCCCCTGGAAGGCCC No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661172_1183661182 4 Left 1183661172 22:39222345-39222367 CCCACCGGGCCCCTGGAAGGCCC No data
Right 1183661182 22:39222372-39222394 ACTCTGCTGCGCTGCTGTATGGG No data
1183661172_1183661184 16 Left 1183661172 22:39222345-39222367 CCCACCGGGCCCCTGGAAGGCCC No data
Right 1183661184 22:39222384-39222406 TGCTGTATGGGATGGCACCCAGG No data
1183661172_1183661185 22 Left 1183661172 22:39222345-39222367 CCCACCGGGCCCCTGGAAGGCCC No data
Right 1183661185 22:39222390-39222412 ATGGGATGGCACCCAGGAAATGG No data
1183661172_1183661181 3 Left 1183661172 22:39222345-39222367 CCCACCGGGCCCCTGGAAGGCCC No data
Right 1183661181 22:39222371-39222393 GACTCTGCTGCGCTGCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661172 Original CRISPR GGGCCTTCCAGGGGCCCGGT GGG (reversed) Intergenic