ID: 1183661174

View in Genome Browser
Species Human (GRCh38)
Location 22:39222349-39222371
Sequence CCGTGGGCCTTCCAGGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661174_1183661185 18 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661185 22:39222390-39222412 ATGGGATGGCACCCAGGAAATGG No data
1183661174_1183661182 0 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661182 22:39222372-39222394 ACTCTGCTGCGCTGCTGTATGGG No data
1183661174_1183661186 19 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661174_1183661184 12 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661184 22:39222384-39222406 TGCTGTATGGGATGGCACCCAGG No data
1183661174_1183661183 4 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661183 22:39222376-39222398 TGCTGCGCTGCTGTATGGGATGG No data
1183661174_1183661181 -1 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661181 22:39222371-39222393 GACTCTGCTGCGCTGCTGTATGG No data
1183661174_1183661187 27 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661174 Original CRISPR CCGTGGGCCTTCCAGGGGCC CGG (reversed) Intergenic