ID: 1183661176

View in Genome Browser
Species Human (GRCh38)
Location 22:39222354-39222376
Sequence AGAGTCCGTGGGCCTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661176_1183661181 -6 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661181 22:39222371-39222393 GACTCTGCTGCGCTGCTGTATGG No data
1183661176_1183661182 -5 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661182 22:39222372-39222394 ACTCTGCTGCGCTGCTGTATGGG No data
1183661176_1183661184 7 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661184 22:39222384-39222406 TGCTGTATGGGATGGCACCCAGG No data
1183661176_1183661185 13 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661185 22:39222390-39222412 ATGGGATGGCACCCAGGAAATGG No data
1183661176_1183661187 22 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661176_1183661190 28 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data
1183661176_1183661183 -1 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661183 22:39222376-39222398 TGCTGCGCTGCTGTATGGGATGG No data
1183661176_1183661186 14 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661176 Original CRISPR AGAGTCCGTGGGCCTTCCAG GGG (reversed) Intergenic